CN113368260A - Pharmaceutical preparation for treating Alzheimer disease - Google Patents

Abstract

The invention provides a medicinal preparation for diagnosing Alzheimer's disease, and belongs to the technical field of biomedicine. The pharmaceutical preparation comprises a LINC01365 silencing agent and a pharmaceutical carrier, wherein the LINC01365 silencing agent is small interfering RNA, and the sequences of the small interfering RNA are shown as SEQ ID NO.10 and SEQ ID NO. 11. The small interfering RNA can effectively promote the proliferation and differentiation of human neural stem cells.

Description

Pharmaceutical preparation for treating Alzheimer disease

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a medicinal preparation for treating Alzheimer disease.

Background

Alzheimer disease is the most common degenerative disease of the nervous system, and with the increasing number of the aged people in China, the number of patients suffering from Alzheimer disease is correspondingly increased. The early manifestation of the Alzheimer disease patient is near memory decline, and with the continuous deepening of the disease degree of the patient, the patient can suffer from long-term memory impairment and damages in multiple cognitive fields such as language, execution, logical reasoning and the like, and finally, the family and the society of the patient are heavily burdened.

Currently, the diagnosis of alzheimer's disease is mainly based on clinical manifestations of patients, neuropsychological scale assessment and craniocerebral imaging examination, and these diagnostic methods can diagnose patients with typical symptoms in middle and late stages, but accurate diagnosis is difficult for patients with mild symptoms or atypical symptoms. Therefore, the selection of biomarkers that can effectively diagnose alzheimer's disease is of great significance for achieving early diagnosis of alzheimer's patients.

In alzheimer's disease, the proliferation and self-renewal capacity of neural stem cells are reduced, resulting in a reduction in cognitive function of patients, and thus, effectively improving the proliferation and self-renewal capacity of neural stem cells would be useful for the treatment of alzheimer's patients.

Disclosure of Invention

The invention aims to provide a pharmaceutical preparation for diagnosing Alzheimer disease.

In order to achieve the purpose, the invention provides the following technical scheme:

in a first aspect, the present invention provides a pharmaceutical formulation for diagnosing alzheimer's disease, said formulation comprising a LINC01365 silencing agent and a pharmaceutical carrier.

Preferably, the LINC01365 silencing agent is a small interfering RNA, and the sequence of the small interfering RNA is shown as SEQ ID NO.10 and SEQ ID NO. 11.

Secondly, the invention provides an application of a silencing agent of long non-coding RNA in preparation of a medicinal preparation for treating Alzheimer's disease, wherein the long non-coding RNA is LINC 01365.

Preferably, the sequence of the transcript of LINC01365 is shown as SEQ ID NO. 5.

Preferably, the silencing agent is a small interfering RNA, and the sequence of the small interfering RNA is shown as SEQ ID NO.10 and SEQ ID NO. 11.

Secondly, the invention provides the application of the small interfering RNA of LINC01365 in preparing a human neural stem cell proliferation promoting preparation.

Preferably, the sequence of the small interfering RNA is shown as SEQ ID NO.10 and SEQ ID NO. 11.

Finally, the invention provides an application of the small interfering RNA of LINC01365 in preparing a human neural stem cell differentiation promoting preparation.

Preferably, the sequence of the small interfering RNA is shown as SEQ ID NO.10 and SEQ ID NO. 11.

The invention has the beneficial effects that the small interfering RNA capable of effectively silencing LINC01365 expression is provided, and after the small interfering RNA is transfected into the human neural stem cell, the proliferation and differentiation of the neural stem cell can be effectively promoted, so that the small interfering RNA can be used for preparing the medicine for treating the Alzheimer disease.

Drawings

FIG. 1 differential expression of LINC01365 in Alzheimer's disease and normal human peripheral blood mononuclear cells;

FIG. 2 ROC curve of relative LINC01365 expression in mononuclear cells of Alzheimer's disease patients;

FIG. 3 detection of silencing effect of siRNA;

FIG. 4 Effect of silencing LINC01365 on human neural stem cell proliferation;

FIG. 5 Effect of silencing LINC01365 on human neural stem cell cyclins;

FIG. 6 Effect of silencing LINC01365 on mRNA expression of the neuronal marker Tuj 1;

figure 7 effect of silencing LINC01365 on protein expression of neuronal marker Tuj 1.

Detailed Description

In order to clearly illustrate the technical features of the present solution, the present solution is explained below by way of specific embodiments.

Example 1 obtaining peripheral blood mononuclear cells

(1) Peripheral blood was collected from 45 cases of alzheimer's disease (AD group) and 45 cases of normal persons (NC group);

(2) taking a 15ml centrifuge tube, adding 5ml of human peripheral blood lymphocyte separation medium, and then carefully sucking 5ml of peripheral blood by using a pipette gun and slowly adding the blood along the tube wall of the centrifuge tube;

(3) placing in a centrifuge for 25min at 800g, and after centrifugation, dividing the liquid into 4 layers from top to bottom, wherein the two layers are as follows: a plasma layer, a PBMCs layer, a transparent separation layer and a red blood cell layer;

(4) carefully sucking the PBMCs layer into a 15ml enzyme-free centrifuge tube, adding 10ml PBS buffer solution to wash the PBMCs layer, and placing the PBMCs layer in a centrifuge for centrifugation at 250g for 10 min;

(5) discarding the supernatant, adding 5ml of PBS buffer solution to resuspend the cells, placing the cells in a centrifuge, and centrifuging for 10min at 250 g;

(6) discarding the supernatant, adding 5ml of PBS buffer solution to resuspend the cells, placing the cells in a centrifuge, centrifuging for 10min at 250g, and discarding the supernatant to obtain the peripheral blood mononuclear cells.

Example 2 peripheral blood mononuclear cell RNA extraction

(1) Adding 1ml of Trizol lysis buffer solution into the peripheral blood mononuclear cells obtained in example 1, and repeatedly pipetting by using a pipette to fully lyse the cells;

(2) transferring the lysed cells to a 1.5ml EP tube without RNase, and standing at room temperature for 5 min;

(3) adding 200ul chloroform into the tube, shaking vigorously for 15s, and standing at room temperature for 2 min;

(4) placing the EP tube in a precooled 4 ℃ high-speed centrifuge, centrifuging at 12000rpm for 15min, taking out, dividing the sample into three layers, carefully absorbing the upper aqueous phase into a new EP tube, and taking care that the middle layer cannot be absorbed during absorption;

(5) adding equal volume of precooled isopropanol, fully reversing and uniformly mixing, and standing at room temperature for 10 min;

(6) placing the EP tube in a precooled high-speed centrifuge at 4 ℃, centrifuging for 10min at 1200rpm, discarding the supernatant, and keeping the white precipitate;

(7) adding 1ml of 75% ethanol, reversing, mixing, placing in a high-speed centrifuge with precooling at 4 ℃, centrifuging at 7500rpm for 5min, carefully removing supernatant, placing in a fume hood for 2min, adding 20ul RNase-Free water to dissolve precipitate, and obtaining RNA.

EXAMPLE 3 reverse transcription of Total RNA

(1) The reaction for removing the genomic DNA is carried out by the following reagent system:

TABLE 1 reaction System for removing genomic DNA

Reagent	Dosage for use
		5×gDNA Eraser Buffer	2.0μl
gDNA Eraser	1.0μl
		Total RNA	1.0μg
RNase Free dH2O	Up to 10μl

Setting reaction conditions: gently pumping, mixing, centrifuging for 15s, and reacting in a PCR instrument at 42 deg.C for 2min and 4 ∞;

(2) reverse transcription reaction, reagent system as following table:

TABLE 2 reverse transcription reaction System

Setting reaction conditions: gently pumping, mixing, centrifuging for 15s, placing into PCR instrument at 37 deg.C for 15min, 85 deg.C for 5s, and 4 deg.C for infinity.

Example 4 real-time quantitative PCR reaction

(1) Primer design, the designed primer sequences are shown in the following table:

TABLE 3 primer sequence design

Name of Gene	Primer	Sequence
			LINC01365	Forward primer	CCCGGAAAGAGAGTCAGCAA，SEQ ID NO.1
	Reverse primer	AGGGAGGCACTGTTCAAAGG,SEQ ID NO.2
			GAPDH	Forward primer	GTCAAGGCTGAGAACGGGAA,SEQ ID NO.3
	Reverse primer	GCCTTCTCCATGGTGGTGAA,SEQ ID NO.4

(2) The PCR reaction system is as follows:

reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 15s, at 60 ℃ for 30s and at 72 ℃ for 30s, and circulating for 40 times; 95 deg.C for 15s, 60 deg.C for 1min, use 2^-△△CTThe relative expression amount is calculated.

As can be seen from FIG. 1, the expression level (2.475. + -. 0.852) of LINC01365 in the AD group was significantly increased (P < 0.05) compared with that in the NC group, and the difference was statistically significant.

As can be seen from FIG. 2, the area under the ROC curve (AUC) was 0.920 (confidence interval (CI) was

0.864-0.977, P < 0.001), sensitivity of 0.756, specificity of 0.956, which shows that the relative expression of LINC01365 in peripheral blood mononuclear cells has higher accuracy for AD diagnosis and higher clinical application value.

Example 5 detection of silencing Effect of LINC01365 siRNA

(1) 2 siRNAs are designed according to the transcript sequence (SEQ ID NO. 5) of LINC01365, namely siLINC01365-1 and siLINC01365-2 respectively, and the specific sequences are shown in Table 4;

(2) the following compositions were used: coating 6-well plate with 200-proportion diluted matrigel, and coating overnight at 37 ℃;

(3) removing matrigel, and gently washing the plate holes for 2 times by using PBS;

(4) collecting human neural stem cell balls (hNSC-H9) in logarithmic growth phase to prepare single cell suspension, inoculating the single cell suspension into a 6-well plate, and transfecting cells when the cell density reaches 70%;

(5) transfecting siNC, siLINC01365-1 and siLINC01365-2 according to the specification of Lipofectamine3000, and after transfecting for 48 hours, extracting RNA, and detecting the relative expression quantity of LINC01365, thereby judging the silencing effect of siRNA.

The experimental results are shown in FIG. 3, and it can be seen that both siRNAs can effectively inhibit LINC01365, wherein the inhibition rate of the siLINC01365-1 is 65.7%, the inhibition rate of the siLINC01365-2 is 78.9%, and the differences have statistical significance. As the Silinc01365-2 has more excellent silencing effect, the Silinc01365-2 is selected to be continued to be subjected to subsequent experiments.

Example 6

Detection of human neural stem cell proliferation by CCK-8

(1) Melting the matrigel in a refrigerator at 4 ℃, and mixing the matrigel and the gel according to the proportion of 1: diluting at a ratio of 200, adding into 96-well plate with each well at 100ul, and standing at 37 deg.C overnight;

(2) collecting human neural stem cell balls in logarithmic phase to prepare single cell suspension, and inoculating 100ul 5000 cells into a 96-well plate;

(3) after overnight incubation, siNC and siLINC01365-2 were transfected and detected using CKK-8 at 0, 24,48,72h of transfection, respectively.

The experimental result is shown in fig. 4, the abscissa is time, and the ordinate is absorbance value, so that it can be seen that the silent LINC01365 can effectively enhance the stem cell capacity of human application. Wherein, the light absorption value of the sNC is 0.306 +/-0.009, and the light absorption value of the sLINC 01365-2 is 0.398 +/-0.022 at 24 h; when 48h is needed, the light absorption value of the siNC is 0.481 +/-0.051, and the light absorption value of the siLINC01365-2 is 0.676 +/-0.045; at 96, the absorbance of the siNC is 0.786 +/-0.058, and the absorbance of the siLINC01365-2 is 1.336 +/-0.046.

Example 7

Western Blot for detecting cyclin expression

(1) The following compositions were used: coating 6-well plate with 200-proportion diluted matrigel, and coating overnight at 37 ℃;

(2) removing matrigel, and gently cleaning the plate with PBS for 2 times;

(3) collecting human neural stem cell balls in logarithmic phase to prepare single cell suspension, inoculating the single cell suspension in a 6-hole plate, and transfecting cells when the cell density reaches 70%;

(4) transfecting siNC, siLINC01365-2 according to the instructions of Lipofectamine3000, removing the culture medium after transfecting for 48h, and washing for 2 times by using PBS;

(5) adding 100ul of protein lysate into each hole, fully cracking, scraping cells by using a cell scraper, collecting the cells into a centrifuge tube, placing the centrifuge tube on ice at 4 ℃ for 30min, and shaking once every 10 min;

(6) setting a centrifugal machine at 4 ℃, 12000rpm, centrifuging for 20min, sucking a supernatant after centrifugation, measuring the protein concentration by using a Bradford method, adding a 5 xSDS loading buffer solution, and boiling for 5min at 100 ℃;

(7) preparing SDS-PAGE gel, and after the SDS-PAGE gel is prepared, carrying out sampling and electrophoresis;

(8) after electrophoresis is finished, clamping according to the electric transfer according to a classic 'sandwich' model, and carrying out electric transfer;

(9) after the electrotransformation is finished, taking out the membrane, placing the membrane in 5% of skimmed milk powder, and sealing for 1h at room temperature;

(10) Cyclin-D1, CDK1 and GAPDH were diluted according to antibody instructions, incubated overnight at 4 ℃ and after incubation, membranes were washed 3 times with PBST;

(11) the corresponding secondary antibody was incubated for 1h at room temperature with a shaker, and then the membrane was washed 3 times with TBST and exposed to light for development.

As shown in FIG. 5, it can be seen that the silencing LINC01365 can effectively promote the expression of Cyclin-D1 protein and CDK1 protein, and the result shows that the silencing LINC01365 can promote the proliferation of human neural stem cells by promoting Cyclin-D1 and CDK 1.

Example 8

Western Blot and fluorescent quantitative PCR (polymerase chain reaction) for detecting Tuj1 protein expression and mRNA expression

(1) The following compositions were used: coating 6-well plate with 200-proportion diluted matrigel, and coating overnight at 37 ℃;

(2) collecting human neural stem cell balls in logarithmic phase to prepare single cell suspension, inoculating the single cell suspension in a 6-hole plate, and transfecting cells when the cell density reaches 70%;

(3) transfecting siNC, siLINC01365-2 according to the instructions of Lipofectamine3000, sucking the culture medium the next day, slightly cleaning a 6-well plate by using preheated Neural basal culture medium, adding 2ml of differentiation culture medium, culturing for 72 hours, and extracting RNA and protein;

(4) primer sequences for Tuj1(TUBB3) are as follows:

(5) the remaining RNA extractions and detections, Western Blot specific procedures refer to the above examples.

The experimental results are shown in fig. 6 and fig. 7, and it can be seen from the quantitative PCR result in fig. 6 that after LINC01365 is silenced, the mRNA expression level (relative expression level is 3.210 ± 0.309) of the neuron marker Tunj1 can be significantly promoted;

meanwhile, as can be seen from the Western Blot result in fig. 7, after LINC01365 is silenced, the protein expression of the neuron marker Tunj1 can be significantly promoted. Therefore, it is known that silencing LINC01365 can effectively promote differentiation of human neural stem cells.

By combining examples 1 to 8, it was found that the detection of the expression level of LINC01365 in peripheral blood mononuclear cells is effective as an auxiliary diagnosis for the patient suffering from Alzheimer's disease. Secondly, the silencing LINC01365 can effectively promote the proliferation of human neural stem cells and the differentiation of the human neural stem cells to neuronal cells, so that the silencing preparation of the LINC01365 can be used for preparing a therapeutic drug for the Alzheimer disease.

<110> 1

<120> a pharmaceutical preparation for treating alzheimer's disease

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cccggaaaga gagtcagcaa 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agggaggcac tgttcaaagg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtcaaggctg agaacgggaa 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gccttctcca tggtggtgaa 20

<210> 5

<211> 533

<212> DNA

<213> Human source (Human)

<400> 5

atgaaggcaa acatcagaag aaacaggtta aagaattaga tgtggtcctc acagggaata 60

tttgcccctg gccgcagata caaaggatgc atttcaagct ctcccaagaa ctcttgcagt 120

gctccatccc tgtgtcctca gaaatggccc tgagtctcag cagctcaaaa agactccagt 180

tggatagtga gaagccactg cttccttgca agaaccttcc caaatttctc taaccatgtg 240

aagacatgct tgattcccct caccttcacc atgatttttc tgggagaata acaaaaagaa 300

ggaagattca gtaggaaagg aaagcaatga agaagccaag aaagagacaa ggaaccccgg 360

aaagagagtc agcaaagaga gaaatagaaa cattaatttc aggtgaagaa actgaagact 420

ttagccagag ccaagtggct aattcagagt ttaatacacc tttgacctca aaccctttgt 480

ggtcaccttt gaacagtgcc tccctctctg aaataaaata ctggttctgt cat 533

<210> 6

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

uucuccgaac gugucacgu 19

<210> 7

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acgugacacg uucggagaa 19

<210> 8

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcaaagagag aaauagaaa 19

<210> 9

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

uuucuauuucu cucuuugc 19

<210> 10

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaaacagguu aaagaauua 19

<210> 11

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

uaauucuuua accuguuuc 19

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcaactacgt gggcgact 18

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgaggcacgt acttgtgaga 20

Claims (9)

1. A pharmaceutical formulation for diagnosing alzheimer's disease, said formulation comprising a LINC01365 silencing agent and a pharmaceutical carrier.

2. The formulation of claim 1, wherein the LINC01365 silencing agent is a small interfering RNA having a sequence as set forth in SEQ ID No.10 and SEQ ID No. 11.

3. The application of a silencing agent of long-chain non-coding RNA in preparing a medicinal preparation for treating Alzheimer disease is characterized in that the long-chain non-coding RNA is LINC 01365.

4. The use of claim 3, wherein the LINC01365 transcript has the sequence as shown in SEQ ID No. 5.

5. The use of claim 3, wherein the silencing agent is a small interfering RNA having the sequence shown in SEQ ID No.10 and SEQ ID No. 11.

The application of the small interfering RNA of LINC01365 in preparing a human neural stem cell proliferation promoting preparation.

7. The use of claim 6, wherein the sequence of the small interfering RNA is as shown in SEQ ID No.10 and SEQ ID No. 11.

The application of the small interfering RNA of LINC01365 in preparing a human neural stem cell differentiation promoting preparation.

9. The use of claim 8, wherein the small interfering RNA has the sequence shown in SEQ ID No.10 and SEQ ID No. 11.

Images