CN113355391A

CN113355391A - Method for establishing database by targeting FFPE RNA

Info

Publication number: CN113355391A
Application number: CN202110627190.XA
Authority: CN
Inventors: 刘娜; 戴广伟; 卢瑶; 曹振; 宋东亮
Original assignee: Yisheng Biotechnology Shanghai Co ltd
Current assignee: Yisheng Biotechnology Shanghai Co ltd
Priority date: 2021-06-04
Filing date: 2021-06-04
Publication date: 2021-09-07

Abstract

The invention provides a method for targeted FFPE RNA library construction, which comprises the following steps: fragmenting the FFPE RNA of the sample to ensure that the size of the FFPE RNA is mainly concentrated to 150-200 bp; adding poly (A) polynucleic acid at the end of the fragmented FFPE RNA; using reverse transcriptase and taking FFPE RNA with A added at the tail end as a template to synthesize 1st cDNA; carrying out enrichment treatment on the genes in the target region on the synthesized 1st cDNA; and (4) amplifying the library. The method directly amplifies a target region on 1st cDNA by using a specific primer with a linker sequence, then realizes a complete sequencing library through PCR, and directly amplifies, builds and sequences the target region, so that the target region is more concentrated, and the library building process is simpler, the time is short, the data utilization rate is high, and the cost is low.

Description

Method for establishing database by targeting FFPE RNA

Technical Field

The invention relates to a method for constructing a targeted FFPE RNA library.

Background

FFPE samples of tumor tissues after formalin fixation and wax block embedding are important resources for clinical research, can be used for histological diagnosis, and can also be used for performing NGS sequencing analysis on information such as gene expression, alternative splicing fusion genes and the like. However, formalin and protein cross-linking affect the extraction of nucleic acid, inhibit the activity of polymerase and the like, and paraffin infiltrated at high temperature can reduce the quality of nucleic acid. Furthermore, RNA is more easily degraded than DNA, so that FFPE RNA has poor integrity and low quality. About 90% of total RNA is ribosomal RNA (rrna), and thus RNA-seq of FFPE RNA samples presents a serious challenge.

The RNA-seq library construction strategy for the FFPE RNA sample is generally long, about 8-10 hours, rRNA is removed, and then the processes of RNA fragmentation, 1st cDNA synthesis, 2nd cDNA synthesis, end repair, linker connection, library amplification and the like are complicated. Capture sequencing is also typically performed to obtain the genetic information desired by the researcher, and therefore higher sequencing throughput is required. The database building strategy is long in time consumption and high in cost, and has high requirements on the quality, the input amount and the like of the sample.

Disclosure of Invention

The invention aims to provide a method for targeted FFPE RNA library construction, which can realize a library construction strategy for FFPE RNA with lower quality and less initial quantity.

The technical scheme adopted by the invention is as follows: a method for targeted FFPE RNA banking comprising the steps of:

(1) fragmenting FFPE RNA;

(2) adding poly (A) polynucleic acid to the 3' end of the fragmented FFPE RNA;

(3)1^stsynthesizing cDNA;

(4) enrichment and amplification of the target region gene;

(5) and (4) amplifying the library.

Preferably, the FFPE RNA fragmentation in step (1) is performed using Mg²⁺Different degrees of fragmentation were performed.

More preferably, the different degrees of fragmentation of the FFPE RNA in step (1) are achieved by using the length of incubation at high temperature to achieve different qualitative measures of fragmentation of the FFPE RNA.

Preferably, poly (A) polymerase is used as the 3' end of the FFPE RNA fragmented in step (2) and the poly (A) polynucleic acid is added.

More preferably, the 3' end of the segmented FFPE RNA in step (2) is added with poly (A) polynucleic acid reaction program: adding 27-33 poly (A) at the end in 10min at 37 ℃.

More preferably, the 3' end of the FFPE RNA fragmented in step (2) is added with poly (A) polynucleic acid reaction buffer: 1 XPoly (A) Polymerase Reaction Buffer was 50mM Tris-HCl, 250mM NaCl, 10mM MgCl2, pH 8.1.

Preferably, the synthesis system of 1st cDNA in step (3) comprises: FFPE RNA fragment, buffer, dNTP, Oligo-dt30v Primer, T-Primer and reverse transcriptase obtained in the step (2), wherein the Oligo-dt30v Primer sequence is as follows: 5 '-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV-3', T-Primer sequence: 5 '- -AAGCAGTGGTATCAACGCAGAGAATCATRGGrG + G-3'. Locked nucleic acid modification of T-Primer primers can increase the terminal transfer capability of reverse transcriptase.

Preferably, the reverse transcriptase used in the 1st cDNA synthesis system in step (3) is

IV Reverse Transcriptase or

ⅢReverse Transcriptase。

Preferably, the 5 × RT Buffer used in the 1st cDNA synthesis system in step (3) is: 250mM Tris-HCl, 375mM KCl, 28mM MgCl2, pH 7.9.

Preferably, the step (4) is specifically: carrying out upstream specific primer design on a targeted gene, and then carrying out multiplex PCR (polymerase chain reaction) by utilizing an upstream specific primer and a downstream primer to realize amplification and enrichment of a targeted region gene, wherein the upstream specific primer is designed to be composed of a joint sequence and a specific primer, the joint primer is a sequencing primer of a sequencing platform, and the design principle of the specific primer is as follows: the length is 15-30nt, the number of continuous bases is not more than 3, the GC content is 35% -65%, the Tm value is 55-63 ℃, and the Tm of part of special regions is slightly higher or lower; the primer does not contain a self-complementary sequence, has no obvious secondary structure, and has an interval of adjacent primer recognition sites of more than 40bp and less than 100 bp; the sequence of the downstream primer is as follows: 5 '-AAGCAGTGGTATCAACGCAGAGTNNNGNNCNNNGATCGGAAGAGCACACGTCTGAAC TCCAGTC-3', wherein TNNNGNNCNNN is a UMI tag.

Preferably, the amplification enzyme used in step (4) is: 2 x Hieff

HG Multiplex PCR Master Mix 2 × high GC Multiplex PCR premix (assist in san, Cat.13283), can be compatible with Multiplex gene amplification with GC content of about 25% -70%, can be quickly and conveniently used for Multiplex PCR reaction, and has the characteristics of high uniformity, high specificity and high sensitivity.

Preferably, the method for targeted FFPE RNA banking according to claim 1, characterized in that: the library-amplifying enzyme used in step (5) was 2 Xsuper

II High-Fidelity Mix for Library Amplification (assist in san, Cat.12621), no preference, with High Amplification efficiency.

The invention has the beneficial effects that:

(1) the method increases the tolerance to the quality of the FFPE RNA, and can realize the library construction and sequencing of various samples;

(2) the method increases the selectivity of the input amount of the FFPE RNA, and can realize the library construction and sequencing of samples with different input amounts;

(3) the method directly amplifies a target region on 1st cDNA by using a specific primer with a UMI adapter sequence, then realizes a complete sequencing library through PCR, and directly amplifies, builds and sequences the target region so as to centralize the target region, and has the advantages of simpler library building process, short time, high data utilization rate and low cost.

Drawings

FIG. 1 principle of a method for targeted FFPE RNA banking.

FIG. 2 RNA fragment 3' end plus A capability test.

FIG. 3cDNA Peak Pattern analysis.

FIG. 4 FFPE RNA Peak type analysis.

FIG. 5 library peak pattern analysis.

FIG. 6 sequencing library sequencing data analysis.

FIG. 7 coverage of BACA2 gene region.

Detailed Description

The following further describes the embodiments of the present invention with reference to the drawings.

Example 1 method for targeting FFPE RNA Bank construction

1.1, using RNeasy FFPE Kit (Qiagen, Cat.73504), the paraffin section sample of the tumor tissue was subjected to FFPE RNA extraction, and the quality of the extracted FFPE RNA was judged according to the 2100 bioanalyzer RNA 6000 Pico total RNA analysis chip. The FFPE RNA was then fragmented to varying degrees. DV (distance vector)₂₀₀Representing the proportion of RNA fragments larger than 200nt in the sample, DV for the FFPE RNA sample with serious degradation₂₀₀The values are better able to reflect the quality of the sample. Thus according to different DV₂₀₀The FFPE RNA was fragmented as shown in Table 1. After high-temperature treatment of different degrees, the size of the FFPE RNA is concentrated to 150-200 bp, and the fragmentation of the FFPE RNA is completed.

TABLE 1 fragmentation conditions for different quality FFPE RNAs

DV₂₀₀	Fragmentation conditions
		≥70％	94℃10min
50％～70％	94℃7min
		20％～50％	85℃8min
≤20％	65℃5min

1.2 adding polynucleic acid to fragmented RNA, thereby increasing the utilization of the template. Examples of polymerases that add polynucleic acids to the template include Poly (A) polymerase, Poly (U) polymerase. The ability to add A to the 3' end of RNA for Poly (A) polymerase is critical for efficient template utilization. Thus, using a 150bp RNA RN1 sequence: 5'-TACCTGGTTGATCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTACGCACGGCCGGTACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATGGTTCCTTTGGTCGCTCGCTCCTCTCCTACTTGGATAA-3', the efficiency of adding A at the 3 ' end of RNA was tested using Poly (A) polymerase from NEB. As shown in FIG. 2, it was found that the use of 5U of Poly (A) Polymerase in a 1X Poly (A) Polymerase Reaction Buffer (50mM Tris-HCl, 250mM NaCl, 10mM MgCl2, pH 8.1@25 ℃) system allows for efficient addition of Poly (A) of different lengths at different Reaction times. 1ug of RN1 template was tested for the ability to add A at the ends of 10min, 20min and 30min in the reaction system shown in Table 2 below, and it was found that 10min of reaction was performed at 30 deg.C, about 50 poly (A) s could be added at the end of RN 13 ', about 100 poly (A) s could be added at the end of RN 13 ' for 20min, and about 150 poly (A) s could be added at the end of RN 13 ' for 30 min. Therefore, considering that about 30 (27-33) poly (A) s are required for 1st cDNA synthesis, the optimal experimental condition determined by the invention is reaction at 37 ℃ for 10min to complete the addition of poly (A) at the 3' end of RNA.

TABLE 2 RNA 3' end plus A reaction System

Components	Fragmentation conditions
		RN1	1μg
5X Poly(A)Polymerase Reaction Buffer	4μL
		ATP(10mM)	2μL
Poly(A)PolymeRase	1μL
		DEPC-H2O	/
Total volume	20μL

1.3, after A is added at the tail end of the fragmented FFPE RNA, reverse transcription of various sample RNAs is completed by utilizing a high-efficiency 1st cDNA synthesis reaction system. In the 1st cDNA synthesis of the present invention, the full-length cDNA is synthesized using the DNA polymerase activity and terminal transferase activity (Template Switch) of reverse transcriptase. The efficiency of 8 reverse transcriptases used for cDNA synthesis was tested.

S1: invitrogen SuperScript II reverse transcriptase (Cat.18064022)

S2: invitrogen SuperScript III reverse transcriptase (Cat.18080044)

S3: maxima H Minus reverse transcriptase (Thermo, Cat.18064022)

S4：EnzScript^TM(MMLV Reverse Transcriptase RNase H-) (praise, Cat. P7600L)

S5：

II Reverse Transcriptase second generation thermostable Reverse Transcriptase (assist in san, Cat.11110)

S6：

III Reverse Transcriptase third Generation Heat-resistant Reverse Transcriptase (assist in san, Cat.11111)

S7：

IV Reverse Transcriptase fourth generation thermostable Reverse Transcriptase (assist in san Francisco, Cat.11112)

S8：

V Reverse Transcriptase fifth generation thermostable Reverse Transcriptase (assist in san Francisco, Cat.11300).

First, the DNA polymerase activity and terminal transferase activity (Template Switch) of the above 8 reverse transcriptases were tested. As the test conditions are shown in Table 3, it can be seen that the DNA polymerase activity and terminal transferase activity (Template Switch) of different reverse transcriptases are different, and the higher the yield, the stronger the polymerase activity and the Template Switch. There was essentially no bias according to the cDNA peak pattern analysis of FIG. 3. According to the sequencing data analysis of Table 4, the sequencing difference is mainly expressed in rRNA residual rate, so that the preferential selection is made

IV Reverse Transcriptase fourth generation thermostable Reverse Transcriptase (assist in san, Cat.11112) in 1st cDNA synthesis system, high yield, normal cDNA peak pattern, sequencing data show that Mapping Rate is normal, and rRNA residue is less.

TABLE 3 polymerization Capacity and template Switch Capacity test of different reverse transcriptases

TABLE 4 sequencing differential analysis of different reverse transcriptases

Secondly, the reaction Buffer, T-Primer, Oligo-dt30v Primer dosage and the like of the 1st cDNA synthesis system also have great correlation to the cDNA synthesis efficiency. The invention optimally combines a set of reaction systems: 5 × RT Buffer (250mM Tris-HCl, 375mM KCl, 28mM MgCl2, pH 7.9@25 ℃); oligo-dt30v primer sequence, 5 ' -AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV-3 ', 20pmol usage, 3 ' end non-T primer increased randomness; T-Primer sequence, 5 '-AAGCAGTGGTATCACGCAGAGTACATrGrGrGr + G-3', 50pmol usage amount, locked nucleotide modification can increase Template Switching ability; the reaction program is 42, 90 min; 15min at 70 ℃; hold at 4 ℃. The working system of the present invention can complete the synthesis of 1st cDNA of RNA of 10pg to 1. mu.g.

1.4 the present invention utilizes 2 Hieff of Hippoff, Inc., St.John, Hippo, Ltd, by designing an upstream specific primer for a target gene

HG Multiplex PCR Master Mix 2 Xhigh GC Multiplex PCR premix (assist in san, Cat.13283) for amplification enrichment of the targeted region. Wherein the specific primer consists of an adaptor sequence and the specific primer. Taking BRCA2 gene as an example, the upstream amplification primers in Table 5 are designed, wherein the upstream sequence consists of a sequencing sequence of an illumina sequencing platform and specific primers on genes, and the principle of designing the primers is as follows: the length is 15-30nt, the number of continuous bases is not more than 3, the GC content is 35% -65%, the Tm value is 55-63 ℃, and the Tm of part of special regions is slightly higher or lower; the primer does not contain self-complementary sequences and has no obvious secondary structure; adjacent primer recognition site spacing>40 and<100, when the capture rate is too low, the specific region is easily captured repeatedly, and when the capture rate is too high, the capture is missed in the middle region; preferably, about 10 bases after the primer do not match to other positions in the genome, and the specificity is high. The downstream Primer IS composed of IS Primer,10bpThe sequence composition of the UMI sequence and the sequencing sequence of the illumina sequencing platform, and the primer structure is shown in Table 5.

TABLE 5 upstream primer sequences of BRCA2

Taking BRCA2-F1 as an example, the sequence is as follows: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGGCGCGAGCTTCTGA-3' are provided.

1.5 library amplification by high fidelity, unbiased polymerase, 2 XSuper

II High-Fidelity Mix for Library Amplification (assist in san, Cat.12621) was performed.

Example 2 library application test targeting BRCA2 Gene with four different qualitative measures of FFPE RNA

2.1 quality control of FFPE RNA:

extraction of FFPE RNA was performed using the neosy FFPE Kit (Qiagen, cat.73504) Kit. The invention quickly extracts FFPE RNA from 4 different paraffins of breast cancer, and then judges the quality of the extracted FFPE RNA by using a 2100 bioanalyzer RNA 6000 Pico total RNA analysis chip, and the result is shown in FIG. 4. Judging the quality measure DV of four samples 1#, 2#, 3#, 4# according to FIG. 4₂₀₀74%, 54%, 21%, 11%, respectively.

2.2 fragmentation of FFPE RNA:

the high temperature fragmentation of Table 6 was performed based on four different quality samples FFPE RNA, 50ng was added to each sample, 1# -4# in Table 7, and high temperature Mg was used²⁺Fragmentation was performed, and the RNA size was all concentrated to about 150-200 bp in the present invention using a commercial fragmentation reagent 2 XFrag/Primer Buffer from assist in, Inc. (assist in, Cat # 11377).

TABLE 6 fragmentation of sample RNA

Sample numbering	DV₂₀₀	Fragmentation conditions
			1#	74％	94℃10min
2#	54％	94℃7min
			3#	21％	85℃8min
4#	21％	65℃5min

TABLE 7 fragmentation of sample RNA

Addition of components	Addition system
		FFPE RNA	8.5μL(50ng)
2×Frag/Primer Buffer	8.5μL
		Total volume	17μL

2.3 addition of A to the 3' end of fragmented FFPE RNA:

the addition of poly (A) to the 3 'end of the fragmented FFPE RNA was completed by performing an addition reaction of A to the 3' end of the fragmented FFPE RNA using Poly (A) polymerase from NEB under the reaction conditions of 37 ℃ for 10min as shown in Table 8.

TABLE 8 terminal-addition reaction of fragmented RNA

Addition of components	Addition system
		Fragmented FFPE RNA	17μL
5X Poly(A)Polymerase Reaction Buffer	5μL
		ATP(10mM)	2μL
Poly(A)PolymeRase	1μL
		Total volume	25μL

2.41 st cDNA Synthesis:

using the combined 1st cDNA synthesis system of the present invention, 1# -4# samples were subjected to cDNA synthesis and Template Switch conversion, as shown in Table 9, under the following reaction conditions: hold at 42 ℃ for 90min, 70 ℃ for 15min and 4 ℃ to complete 1st cDNA synthesis.

Watch 91^stcDNA Synthesis System

2.5 enrichment of the targeting region:

by using 2 x Hieff

HG Multiplex PCR Master Mix 2 Xhigh GC Multiplex PCR premix (assist in san, Cat.13283) was used for amplification enrichment of the BRCA2 gene in the target region, 104 specific primers in the upstream were mixed to 1. mu.M of the Primer Panel constituting BRCA2, and the IS-T7 Primer in the downstream was diluted to 50. mu.M for use. The reaction system is shown in Table 10, and the reaction procedure is shown in Table 11, to complete the enrichment of the targeted region.

TABLE 10 enrichment reaction System for Targeted regions

TABLE 11 enrichment reaction conditions for the target region

After the reaction, 1ul of Exonaclease I (NEB, Cat. M0293) was added, the reaction was carried out at 37 ℃ for 10min, and then magnetic bead purification of the enriched region was carried out.

2.6 magnetic bead purification of enriched library:

using Hieff commercially available from this company

RNA Cleaner (assist in san, Cat.12601), 1.0 magnetic bead purification of fragmented 3' plus A FFPE RNA, was performed as follows:

1) preparation work: will Hieff

The DNA Selection Beads (Yeasen Cat #12601) Beads were removed from the freezer and allowed to equilibrate at room temperature for at least 30 min. Preparing 80% ethanol by using nucleic free H2O;

2) vortex and oscillate or fully reverse the magnetic beads to ensure full mixing;

3) aspirate 50. mu.L of Hieff

RNA Cleaner (1.0X, Beads: DNA 1.0:1) to the product of the last step, pipette well and blow and mix, incubate for 5min at room temperature;

4) the PCR tube was placed in a magnetic rack to separate the beads from the liquid, and after the solution was clarified (about 5min), the supernatant was carefully removed;

5) keeping the PCR tube in a magnetic frame all the time, adding 200 μ L of clean free H2O freshly prepared 80% ethanol to rinse the magnetic beads, incubating at room temperature for 30sec, and carefully removing the supernatant;

6) repeating the step 5), rinsing twice in total, and sucking out residual liquid by using a 10 mu L pipette;

7) keeping the PCR tube in a magnetic frame all the time, and opening a cover to dry the magnetic beads at room temperature (5-10 min);

8) DNA elution: taking down the PCR tube from the magnetic frame, adding 22 microliter ddH20, gently blowing and beating by using a pipette until the mixture is fully and uniformly mixed, and standing for 5min at room temperature;

9) the PCR tube was centrifuged briefly and placed in a magnetic stand and left to stand until the solution cleared (about 3min), 20. mu.L of the supernatant was carefully removed to a new nucleic free PCR tube for RNA fragmentation.

2.7 library amplification:

the working company has commercialized 2 × Super

II High-Fidelity Mix for Library Amplification (assist in san, Cat.12621) was performed. The reaction system is shown in Table 12, and the reaction procedure is shown in Table 13. After the library amplification, 0.9 Xmagnetic bead purification of the library was performed, as in the 2.6 magnetic bead purification step, finally 22. mu.L of ddH20 eluted magnetic beads, 20. mu.L of supernatant was taken for the determination of the concentration of the Qubit 3.0 library, and the results are shown in Table 14, Qsep 100 analysis library peak diagram is shown in FIG. 5, the main peak of the library is about 280bp, and the insert is about 150 bp.

TABLE 12 library amplification reaction System

TABLE 13 library amplification reaction conditions

TABLE 14 library yields

Experiment number	Library concentration (ng/ul)	Library yield (ng)
			M1-1#	35.2	704
M2-2#	30.5	610
			M3-3#	20.3	406
M4-4#	10.1	202

2.8 sequencing data analysis:

and (3) carrying out Novaseq6000 sequencing analysis on four libraries, namely M1-M4(1# -4#), which are subjected to equal-mass mixed library and sent to a Nuo grass origin Illumina platform. The sequencing quality, the data uniformity, the coverage of the target region and other aspects are analyzed, as shown in FIGS. 5 and 6, the sequencing quality is better, the library data is uniform, the coverage of the BACA2 gene region is better, and the diagnosis requirement can be met.

Claims

1. A method for targeted FFPE RNA banking comprising the steps of:

(1) fragmenting FFPE RNA;

(2) poly (a) polynucleic acid is added to the 3' end of the fragmented FFPE RNA;

（3）1^stsynthesizing cDNA;

(4) enrichment and amplification of the target region gene;

(5) and (4) amplifying the library.

2. The method for targeted FFPE RNA banking of claim 1 wherein: and (1) fragmenting the FFPE RNA, namely fragmenting the FFPE RNA to 150-200 bp.

3. The method for targeted FFPE RNA banking of claim 2 wherein: poly (a) is added to the 3' -end of the FFPE RNA fragmented in step (2) and poly (a) polymerase is used as the polynucleic acid.

4. The method for targeted FFPE RNA banking according to any one of the claims 1-5, characterized in that: in the step (2), 27-33 poly (A) s are added at the end of the FFPE RNA after 10min at 37 ℃.

5. The method of claim 5 for targeted FFPE RNA banking, characterized in that: the 1 XPoly (A) Polymerase Reaction Buffer used in step (2) was 50mM Tris-HCl, 250mM NaCl, 10mM MgCl2, pH 8.1.

6. The method for targeted FFPE RNA banking of claim 1 wherein: step (3) 1^stThe cDNA synthesis system comprises: the FFPE RNA fragment obtained in the step (2), buffer, dNTP, Oligo-dt30v Primer, T-Primer, reverse transcriptase and Murine RNase Inhibitor Murine RNase Inhibitor, wherein the Oligo-dt30v Primer sequence is as follows: 5 '-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV-3', and the T-Primer sequence is: 5 '-AAGCAGTGGTATCACGCAGAGTACATRGG + G-3'.

Performing locked nucleic acid modification on the tail end of the T-Primer

The method for targeted FFPE RNA banking of claim 2 wherein: the Reverse Transcriptase used in the 1st cDNA synthesis system in the step (3) is Hifair IV Reverse Transcriptase Transcriptase or Hifair III Reverse Transcriptase Transcriptase.

8. The method for targeted FFPE RNA banking of claim 3, characterized in that: the reaction Buffer 5 × RT Buffer used in the 1st cDNA synthesis system in step (3) is: 250mM Tris-HCl, 375mM KCl, 28mM MgCl2, pH 7.9.

9. The method for targeted FFPE RNA banking of claim 1 wherein: the step (4) is specifically as follows: carrying out upstream specific primer design on a targeted gene, and then carrying out multiplex PCR (polymerase chain reaction) by utilizing an upstream specific primer and a downstream primer to realize amplification and enrichment of a targeted region gene, wherein the upstream specific primer is designed to be composed of a joint sequence and a specific primer, the joint primer is a sequencing primer of a sequencing platform, and the design principle of the specific primer is as follows: the length is 15-30nt, the number of continuous bases is not more than 3, the GC content is 35% -65%, the Tm value is 55-63 ℃, and the Tm of part of special regions is slightly higher or lower; the primer does not contain a self-complementary sequence, has no obvious secondary structure, and has an interval of adjacent primer recognition sites of more than 40bp and less than 100 bp; the sequence of the downstream primer is as follows: 5 '-AAGCAGTGGTATCAACGCAGAGTNNNGNNCNNNGATCGGAAGAGCACACGTCTGAACTCCAGTC-3', wherein TNNNGNNCNNN is a UMI tag.

10. The method for targeted FFPE RNA banking of claim 1 wherein: the amplification enzyme used in step (4) is: 2 × Hieff NGS HG Multiplex PCR Master Mix 2 × high GC Multiplex PCR premix, assist in san, Cat. 13283.

11. The method for targeted FFPE RNA banking of claim 1 wherein: the Library-amplifying enzyme used in step (5) was 2 Xsuper Canace II High-Fidelity Mix for Library Amplification, san Size in assist, Cat. 12621.