CN113355389B - Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof - Google Patents
Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof Download PDFInfo
- Publication number
- CN113355389B CN113355389B CN202010146552.9A CN202010146552A CN113355389B CN 113355389 B CN113355389 B CN 113355389B CN 202010146552 A CN202010146552 A CN 202010146552A CN 113355389 B CN113355389 B CN 113355389B
- Authority
- CN
- China
- Prior art keywords
- sequence
- complementary
- nucleic acid
- target region
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Abstract
The invention relates to a method for enriching a nucleic acid target region in a targeted manner by using a CRISPR/Cas12a system and application thereof. The method includes (1) designing first and second RNAs, the first RNA including a first complementary sequence in addition to the first sgRNA molecule, the second RNA including a second complementary sequence in addition to the second sgRNA molecule, the first sgRNA molecule and the first complementary sequence being complementary to an upstream region of interest, the second sgRNA molecule and the second complementary sequence being complementary to a downstream region of interest; (2) mixing with a Cas12a protein to obtain a complex; (3) Mixing, incubating and denaturing the complex, the nucleic acid, the reverse transcriptase, the denaturant and the dNTP to obtain a denatured product; and (4) removing RNA and protein, and amplifying to obtain an enriched product. Therefore, enrichment of the target region can be simply, conveniently and quickly realized, and the method is applied to the sequencing field.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to the field of nucleic acid capture sequencing, and specifically relates to a method for target enrichment of a nucleic acid target region by using a CRISPR/Cas12a system and application thereof.
Background
In recent years, DNA sequencing technology is continuously developed, the traditional Sanger sequencing technology is developed to the current 'next generation sequencing technology (NGS)', the NGS has the outstanding characteristic that millions or even hundreds of millions of sequencing reactions can be simultaneously carried out, sequencing flux is improved, sequencing high flux is realized, DNA information is continuously analyzed, and DNA sequencing has positive significance for understanding aspects of genetic regulation of characters, disease formation and the like.
Despite the continuous development of NGS technologies, there is still a disadvantage of high cost for whole genome sequencing, and we often need only to perform DNA sequencing on a specific interested region without performing sequencing on the whole genome, and can also effectively reduce sequencing cost and manpower and material resources, so the method for target enrichment of target region DNA should come into play. The current common targeted enrichment method is to capture a target region by liquid phase hybridization, so that the targeted capture enrichment can be performed on the interested genome region, the sequencing range is reduced, and the effective capture enrichment of the target region is realized.
The target area can be effectively targeted and enriched by utilizing liquid phase hybridization capture, but a long time of hybridization (16-24 h) is usually needed, a large amount of input DNA is needed, meanwhile, non-specific hybridization is easily caused by high-temperature denaturation, background noise is increased, the targeting efficiency is poor, and a complicated elution procedure is needed after hybridization, so that time and labor are wasted.
Therefore, there is a need for a fast, efficient and accurate method for enriching a target region.
Disclosure of Invention
The present invention aims to solve at least to some extent one of the technical problems existing in the prior art. Therefore, the invention provides a method for target enrichment of a nucleic acid target region by using a CRISPR/Cas12a system and application thereof.
The CRISPR technology is a technology derived from an archaebacteria immune system, and can effectively identify a target region PAM sequence so as to edit the target sequence. Recently, the David Liu et al (refer to Anzalone A V, randolph P B, davis J R, et al search-and-replace genome editing with double-strings and branches or Donor DNA [ J ]. Nature, 2019.) team improved the existing gene editing CRSPR/cas9 technology, and proposed the concept of leader editing, which can realize the precise insertion of a target sequence and effectively reduce the off-target effect, and the proposal of the technology can make the target sequence capturing become simple and efficient. Cas12a (Cpf 1) Is a protein similar to Cas9, which recognizes the PAM sequence of the genome as TTTN, cleaves at sites far from the recognition sequence, forming sticky ends, which provides effective guarantee for precise editing of the target region (references Zetsche B, gootenberg J S, abudayyeh O, et al. Cpf1 Is a Single RNA-Guided endonucleolytic of a Class 2CRISPR-Cas System [ J ]. CELL 2015,163 (3): 759-771.). The inventor creatively discovers through research that the CRISPR/Cas12a system and the pilot editing can be used for effectively editing a target region of nucleic acid so as to efficiently and accurately capture the target region, then the target region is effectively enriched by means of PCR amplification, and finally the target region is subjected to high-throughput sequencing and analysis, so that the sequencing cost is effectively reduced, the specificity and the sensitivity of capture are improved, and the method has strong practicability in the fields of DNA detection and the like.
A method for targeted enrichment of a nucleic acid target region using a CRISPR/Cas12a system, which designs a pair of RNA sequences (i.e., a first RNA containing a first complementary sequence complementary to upstream of the target region and a second RNA containing a second complementary sequence complementary to downstream of the target region) from upstream and downstream, respectively, of the target region of the nucleic acid, which are co-incubated with Cas12a to form a complex; then adding the nucleic acid, the reverse transcriptase, the DTT and the dNTP into the compound for incubation, performing denaturation treatment, obtaining a target region in a targeting mode, performing PCR amplification, enriching the target region, and using the enriched target region for follow-up high-throughput sequencing analysis. Compared with the currently common hybridization capture targeted sequencing technology, the method for targeted enrichment of the nucleic acid target region provided by the invention has the advantages of simplicity, rapidness, high sensitivity, low cost and the like, and can be effectively applied to the aspects of DNA sequence analysis, disease monitoring and the like.
Specifically, the invention provides the following technical scheme:
in a first aspect of the invention, the invention provides a method of enriching a nucleic acid target region comprising: (1) Designing a set of RNA sequences for a target region of the nucleic acid, the set of RNA sequences including a first RNA and a second RNA, the first RNA including, in series, a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insertion sequence, and a first complementary sequence, the first sgRNA molecule and the first complementary sequence both being complementary to a sequence upstream of the target region, the first sgRNA molecule being complementary to one strand of the nucleic acid, the first complementary sequence being complementary to the other strand of the nucleic acid, the second RNA including, in series, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence, and a second complementary sequence, the second sgRNA molecule and the second complementary sequence both being complementary to a sequence downstream of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complementary sequence being complementary to the other strand of the nucleic acid; (2) Mixing the set of RNA sequences and Cas12a complex, performing a first incubation, so as to obtain a complex; (3) Mixing the complex, the nucleic acid, the reverse transcriptase, the denaturant and the dNTP, carrying out second incubation, and carrying out denaturation treatment on the obtained incubation product so as to obtain a denatured product; (4) Removing RNA and protein in the denatured product, and performing PCR amplification to obtain an enriched product. The invention provides a method for enriching a target region of nucleic acid by using a CRISPR/Cas12a system, which can realize rapid, low-cost and targeted enrichment of the target region of nucleic acid, and the obtained enriched sequence can be analyzed by methods such as high-throughput sequencing and the like, so that target sequence DNA information can be obtained rapidly and at low cost, and a basis is provided for subsequent analysis.
According to embodiments of the present invention, the method for enriching a nucleic acid target region described above may further include the following technical features:
according to an embodiment of the present invention, the first incubation treatment in step (2) is incubation at a temperature of 20 to 28 degrees celsius for 10 to 30 minutes, preferably at a temperature of 25 degrees celsius for 15 minutes.
According to an embodiment of the present invention, the second incubation treatment in step (3) is a second incubation at 35-40 degrees celsius, preferably at 37 degrees celsius for 1-2 hours.
According to an embodiment of the present invention, the first promoter sequence and the second promoter sequence are each independently selected from at least one of a T7 promoter sequence, a U6 promoter sequence, preferably, the first promoter sequence and the second promoter sequence are both T7 promoter sequences.
According to the embodiment of the present invention, in step (1), the upstream complementary position between the first complementary sequence and the target region is a first position, the downstream complementary position between the second complementary sequence and the target region is a second position, and the distance between the first position and the second position is 100bp to 300bp, preferably 180 bp to 250bp.
According to an embodiment of the invention, in step (4) the RNA is removed by rnase and the protein is removed by proteinase K.
According to an embodiment of the invention, rnase is used to incubate for 10-20 minutes at 37 degrees celsius to remove the RNA; the protein was removed by incubation with proteinase K at 37 degrees Celsius for 8-10 hours.
According to an embodiment of the invention, the denaturing agent is DTT, preferably the denaturing agent is used in a concentration of 0.5 to 5mM, preferably 1mM.
According to an embodiment of the present invention, the treatment is performed at a temperature of 80 to 90 degrees celsius for 10 to 20 minutes, so as to perform the denaturation treatment, preferably at a temperature of 85 degrees celsius for 15 minutes.
In a second aspect of the invention, the invention provides a method of enriching a nucleic acid target region comprising: enriching a target region of the nucleic acid with a CRISPR/Cas12a system, the CRISPR/Cas12a system comprising a set of RNA sequences and a Cas12a protein, the set of RNA sequences comprising a first RNA and a second RNA, the first RNA comprising, in series, a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insertion sequence and a first complementary sequence, the first complementary sequence being complementary to an upstream sequence of the target region, the first sgRNA molecule being complementary to one strand of the nucleic acid, the first complementary sequence being complementary to another strand of the nucleic acid, the second RNA comprising, in series, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence and a second complementary sequence, the second complementary sequence being complementary to a downstream sequence of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complementary sequence being complementary to another strand of the nucleic acid. The invention provides a method for enriching a target region of nucleic acid by using a CRISPR/Cas12a system, which can realize rapid, low-cost and targeted enrichment of the target region of nucleic acid, and the obtained enriched sequence can be analyzed by methods such as high-throughput sequencing and the like, so that target sequence DNA information can be obtained rapidly and at low cost, and a basis is provided for subsequent analysis.
In a third aspect of the invention, the invention provides a method of constructing a sequencing library, comprising: enriching said nucleic acid target region using a method according to any one of the embodiments of the first aspect of the invention or using a method according to the second aspect of the invention, so as to obtain said enriched product; performing a library construction based on the enriched products to obtain a sequencing library.
In a fourth aspect of the invention, the invention provides a sequencing method comprising: constructing a sequencing library based on the method of the third aspect of the invention; sequencing is performed based on the sequencing library in order to obtain a sequencing result.
The beneficial effects obtained by the invention are as follows: compared with the traditional liquid phase hybridization capture, the method greatly shortens the library construction time, reduces the noise, reduces the cost, can effectively adapt to high-throughput sequencing, provides a good strategy for analyzing sequence information of a target DNA region, and further lays a solid foundation for aspects of gene detection, gene diagnosis and the like.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
Fig. 1 is a schematic diagram of a method for targeted enrichment of a nucleic acid target region provided in accordance with an embodiment of the present invention.
Fig. 2 is a gel agar electrophoresis image of PCR amplification of a CRISPR/Cas12a digested stock solution according to an embodiment of the present invention.
FIG. 3 is a gel electrophoresis image of a product after digestion of a precipitate with a protease according to an embodiment of the present invention.
FIG. 4 is a diagram of PCR gel agar electrophoresis using a target DNA as a template according to an embodiment of the present invention.
FIG. 5 is a diagram showing the sequencing result of TA cloning of a target sequence according to an embodiment of the present invention.
Detailed Description
The following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention.
The invention provides a method for enriching a nucleic acid target region, which realizes the target enrichment of the nucleic acid target region by modifying a CRISPR/Cas12a system. The provided CRISPR/Cas12a system comprises a set of RNA sequences comprising a first RNA and a second RNA, the first RNA comprising, in sequence, a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insertion sequence, and a first complementary sequence, the first sgRNA molecule and the first complementary sequence both being complementary upstream of the target region, the first sgRNA molecule being complementary to one strand of the nucleic acid, the first complementary sequence being complementary to the other strand of the nucleic acid, the second RNA comprising, in sequence, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence, and a second complementary sequence, the second sgRNA molecule and the second complementary sequence both being complementary to a downstream sequence of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complementary sequence being complementary to the other complementary sequence of the nucleic acid. The system can be used for carrying out complementary combination with a nucleic acid target region while targeting the nucleic acid target region, enrichment of the target region can be realized by means of PCR amplification, and the obtained sequence can be used for subsequent high-throughput sequencing analysis. Compared with the currently common hybrid capture targeted sequencing technology, the provided enrichment method has the advantages of simplicity, rapidness, high sensitivity, low cost and the like, and can be effectively applied to the aspects of DNA sequence analysis, disease monitoring and the like.
Herein, the mentioned Cas12a protein scaffold sequence is used for binding to Cas12a protein. The first sgRNA molecule and the second sgRNA molecule mentioned herein are used to recognize a PAM sequence, are complementary to one strand of a nucleic acid, and are used for cleavage of the nucleic acid sequence.
According to an embodiment of the present invention, there is provided a method of enriching a nucleic acid target region, including: designing a set of RNA sequences for a target region of the nucleic acid, the set of RNA sequences comprising a first RNA and a second RNA, the first RNA comprising, in series, a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insert sequence, and a first complement sequence, the first insert sequence and the first complement sequence each being complementary to a sequence upstream of the target region, the first sgRNA molecule being complementary to one strand of the nucleic acid, the first complement sequence being complementary to another strand of the nucleic acid, the second RNA comprising, in series, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insert sequence, and a second complement sequence, the second insert sequence and the second complement sequence each being complementary to a sequence downstream of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complement sequence being complementary to another strand of the nucleic acid; (2) Mixing the set of RNA sequences and Cas12a protein, and performing a first incubation treatment to obtain a complex; (3) Mixing the complex, the nucleic acid, the reverse transcriptase, the denaturant and the dNTP, performing a second incubation treatment, and performing a denaturation treatment so as to obtain a denatured product; (4) Removing RNA and protein in the denatured product, and performing PCR amplification to obtain an enriched product.
Specifically, reference can be made to fig. 1, which illustrates that the first RNA and the second RNA in fig. 1 show only partial sequences for characterizing the upstream and downstream complementary pairing of the first RNA and the second RNA with the target region, and binding Cas12a protein for cleavage and amplification.
According to the embodiment of the present invention, in step (1), the first complementary sequence and the upstream sequence complementary position of the target region are taken as a first position, the second complementary sequence and the downstream sequence complementary position of the target region are taken as a second position, and the distance between the first position and the second position is 200bp. According to an embodiment of the invention, in step (4) the RNA is removed by rnase and the protein is removed by proteinase K. According to an embodiment of the invention, rnase is used to incubate at 37 degrees celsius for 10-20 minutes to remove the RNA. According to an embodiment of the invention, the protein is removed by incubation with proteinase K for 6 hours at a temperature of 37 degrees celsius.
The denaturant used may be DTT, wherein DTT may be used at a concentration of 1mM (final concentration). According to an embodiment of the present invention, the treatment may be performed at a temperature of 80 to 90 degrees celsius for 10 to 20 minutes, so as to perform the denaturation treatment, preferably at a temperature of 85 degrees celsius for 15 minutes.
The scheme of the invention will be explained below with reference to specific examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to techniques or conditions described in literature in the art or according to the product specification. The reagents or instruments used are conventional products which are commercially available, and are not indicated by manufacturers. It should be noted that the examples given herein are merely illustrative of the applicability of the present invention and do not limit the scope of the invention, and those skilled in the art can make various modifications to the invention without departing from the spirit of the invention.
Example 1
Example 1 specifically provides a method for targeted enrichment of nucleic acid target regions using a CRISPR/Cas12a system.
The oligonucleotide sequences used are shown in Table 1 below, and the corresponding names for each sequence are described in the following steps.
TABLE 1 nucleotide sequence
The P27 gene is selected as a target region sequence, and the target region of the P27 gene is enriched by designing a sgRNA sequence of the target region of the target P27 gene, and the specific experimental steps are as follows:
1. preparation of sgRNA sequence for targeting P27 Gene target region
1) The P27 target region sequence (shown as SEQ ID NO:1 in Table 1) was selected, and a single sgRNA was designed on each of the sense and antisense strands of the target region using Chop-Chop online sgRNA design software (http:// chopchopchopchop. Cbu. Uib. NO /).
2) The target P27 specific sgRNA was designed using software, and two sgrnas with higher score values were selected according to the prediction of the software, and the two selected sgRNA molecules were each (the sequence shown is represented by a DNA molecule, representing a sequence complementary to the nucleic acid as the template):
SgRNA1：TTCTTCTTCAGAACGGTTCAG(SEQ ID NO:11)
SgRNA2:AGAGCAGACATTAGTTTTTCA(SEQ ID NO:12)
an insertion sequence (shown in SEQ ID NO:9 and SEQ ID NO: 10) was added to the 3' end of both sgRNAs.
3) The pegRNA is designed according to the selected sgRNA, and specifically, from the 5 'end to the 3' end of the pegRNA, a T7 promoter sequence (used for transcribing the following sgRNA, scaffold, an insertion sequence and a binding site PBS), a Cas12a protein Scaffold sequence (used for binding Cas12 a), a sgRNA sequence (used for cutting a target sequence), an insertion sequence (serving as a universal joint sequence for subsequent sequencing and verification of successful insertion), and a binding site sequence (PBS) (namely, the mentioned first complementary sequence or second complementary sequence can be combined with a sequence upstream of a target region to facilitate the insertion of the insertion sequence) are respectively arranged on the pegRNA.
Then specific primers are used for overlap and PCR amplification, in vitro transcription is carried out after recovery and purification, and RNA is purified and placed at-80 ℃ for later use.
The amplification system and the amplification procedure when performing overlap and PCR amplification are shown in tables 2 and 3 below. In Table 2, 3-Cas12a-pegRNA1/5-F is used for synthesizing a Cas12a protein Scofold sequence (shown as SEQ ID NO:2 in Table 1) at the upstream of the target sequence and a Cas12a protein Scofold sequence (shown as SEQ ID NO:6 in Table 1) at the downstream of the target sequence respectively, and is annealed with corresponding 3-Cas12a-pegRNA1/5-R (shown as SEQ ID NO:3 and SEQ ID NO:7 in Table 1 respectively).
p-sf-f (shown as SEQ ID NO:4 in Table 1) refers to an upstream primer used for amplifying a T7 promoter sequence, and 3-Cas12a-pegRNA1/5-R2 (shown as SEQ ID NO:5 and SEQ ID NO:8 in Table 1 respectively) is a downstream primer used for amplifying a T7 promoter sequence. The product after PCR amplification is used for in vitro transcription to obtain the pegRNA.
TABLE 2 PegRNA PCR amplification System
| 3-Cas12a-pegRNA1/5-F(10μM) | 1μl |
| 3-Cas12a-pegRNA1/5-R(10μM) | 1μl |
| p-sg-f(10μM) | 2μl |
| 3-Cas12a-pegRNA1/5-R2(10μM) | 2μl |
| 2×KAPA hifi master mix | 50μl |
| H 2 O | 44μl |
| In total | 100μl |
TABLE 3 PCR procedure
The PCR amplified product was recovered (zymo D4010) and then quantified using Nanodrop 2000. The in vitro transcription system of Table 4 was prepared and transcribed overnight at 37 ℃.
TABLE 4 in vitro transcription System
| Template DNA | 10μl(500-1000ng) |
| 10×T7 buffer(NEB) | 5μl |
| ATP | 2ul |
| GTP | 2μl |
| CTP | 2μl |
| UTP | 2μl |
| RNA inhibitors | 2μl |
| T7polymix | 2μl |
| H 2 O | 13μl |
Mu.l Buffer and 4. Mu.l DNase were added to the obtained transcription product and incubated at 37 ℃ for 30 minutes to remove the genome from the transcription product, thereby obtaining the pegRNA1 (corresponding to the sgRNA sequence upstream of the target sequence P27) and the pegRNA5 (corresponding to the sgRNA sequence downstream of the target sequence P27).
Finally, the pegRNA is purified by using an NEB RNA purification kit, and the Nanodrop is quantitatively placed at-80 ℃ for later use.
2. Assembly CRISPR/Cas12a-pegRNA compound and enzyme digestion target region
(1) Preparation of CRISPR/Cas12a-pegRNA Complex
Mu.g Cas12a protein (NEB, 40. Mu.l, 1. Mu.M/. Mu.l =151 ng/. Mu.l) and 2. Mu.g pegRNA1 and pegRNA5 were added to a 250. Mu.l PCR tube, and 6. Mu.l buffer NEB2.1buffer and 4. Mu.l RNA inhibitor (RNA block) were added, with H 2 O was replenished to 60 μ l and incubated at 25 ℃ for 15min (incubation using a PCR instrument) to form CRISPR/Cas12a-presgRNA complex.
(2) Enzyme digestion
Mu.g of P27 DNA, 0.5mM dNTP, 1mM DTT, 4. Mu.l of reverse transcriptase (self-purified in this laboratory, ss 3), 4. Mu.l of buffer NEB2.1buffer, in H 2 And supplementing O to 80 mu l to finally form 100 mu l of enzyme digestion system, wherein the enzyme digestion reaction is as follows: incubating at 37 deg.C for 120min and 85 deg.C for 15min to obtain a composition.
PCR amplification was performed using the assembly solution as a template according to the enrichment volumes and procedures in tables 5 and 6, and the amplification results are shown in FIG. 2. Wherein M1 is DNA Ladder, which is composed of 11 linear double-stranded DNA bands, and the fragments are 1500bp,1000bp,900bp,800bp,700bp,600bp,500bp,400bp,300bp,200bp and 100bp from top to bottom in sequence; m2 is DL2000 DNA Marker with molecular weight of 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp separately. The original plasmid in FIG. 2 was used as a negative control, and refers to the product of the ligation of the P27 sequence to the T vector in Table 1, without any treatment.
TABLE 5 PCR enrichment System
TABLE 6 PCR enrichment procedure
3. Performing RNA enzyme treatment, protease K digestion, isopropanol precipitation and product recovery, and performing agar gel electrophoresis to separate and purify a target DNA sequence;
specifically, 4. Mu.l of RNase treatment was added to the above product and incubated at 37 ℃ for 30min; adding 100 μ l of 1 Xproteinase K Buffer (general formula for buffering proteinase K) and 60 μ l of protein K into the product after the RNA enzyme treatment, and digesting for 6h at 37 ℃, preferably digesting for 6h at 37 ℃ and 800 rpm; the digested product was resinated and subjected to isopropanol precipitation overnight.
The precipitated target DNA product was subjected to 2% agar gel electrophoresis (see FIG. 3) to verify the presence or absence of cleavage. FIG. 3 is a gel electrophoresis diagram of the product after protease digestion and precipitation, wherein M1 is DNA Ladder, which is composed of 11 linear double-stranded DNA bands, and the fragments are 1500bp,1000bp,900bp,800bp,700bp,600bp,500bp,400bp,300bp,200bp,100bp in sequence from top to bottom; m2 is DL2000 DNA Marker with molecular weight of 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp separately. The precipitation after enzyme digestion refers to a fragment obtained by carrying out enzyme digestion on a P27 vector by Cas12a and then precipitating by isopropanol, the original plasmid is used as a negative control, and the product obtained by connecting the P27 sequence and a T vector in the table 1 is obtained without any treatment. As can be seen from FIG. 3, the expected fragment (603 bp) was obtained after PCR amplification and efficient cleavage occurred.
And (3) recovering the target DNA product obtained by the agar gel electrophoresis, and performing PCR amplification enrichment on the recovered target DNA product by using a primer containing a sequencing joint (the PCR amplification system and the amplification conditions refer to the table 5 and the table 6) to obtain a PCR product. The enrichment effect was verified by gel electrophoresis, and the results are shown in FIG. 4. Wherein M1 in FIG. 4 is DNA Ladder, which is composed of 11 linear double-stranded DNA bands, and the fragments are 1500bp,1000bp,900bp,800bp,700bp,600bp,500bp,400bp,300bp,200bp,100bp sequentially from top to bottom; m2 is DL2000 DNA Marker, and the DNA molecular weight is 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp. The post-precipitation PCR in FIG. 4 refers to a product obtained by PCR amplification using the recovered target DNA in FIG. 3 as a template, and is the same product as the target DNA in FIG. 3, which indicates that the target region can be enriched by performing PCR on the assembly solution after enzyme digestion.
The obtained PCR product was subjected to TA Cloning (5 min TA/Blunt-Zero Cloning Kit, C601-01), ligated, incubated in a PCR apparatus at 25 ℃ for 10min, the ligated product was subjected to Fast forward to Fast-T1 component cell competence (Novodax, C505-02), plated at 37 ℃ overnight, and single clones were selected to determine whether the target sequence was trapped by enrichment and inserted correctly using Sanger sequencing (see FIG. 5).
FIG. 5 shows the corresponding sequencing results. The research shows that the expected sequence (i.e. using the insertion sequences RT1 and RT 2) can be correctly inserted and can capture and enrich the target region, and the obtained product can be used for enriching the target region and carrying out high-throughput sequencing.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Moreover, various embodiments or examples and features of various embodiments or examples described in this specification can be combined and combined by one skilled in the art without being mutually inconsistent.
Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and that changes, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
SEQUENCE LISTING
<110> Guangxi Yangxi Xiang GmbH
Huazhong Agricultural University
<120> method for target enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof
<130> PIDC3196816
<160> 12
<170> PatentIn version 3.5
<210> 1
<211> 660
<212> DNA
<213> Artificial Sequence
<220>
<223> P27
<400> 1
actgtaacgc agcacagctg aaccgttctg aagaagaaga aagttaatag cagatgccga 60
taccacaaga tcagccgtag tgatagaccc cacgtaatcc gtgtcccaac taatataaaa 120
ttctcttgct ctggatacgt taatatgacc actgggttgg tattcctccc gtggcttcaa 180
agcaaaggta atcatcatcg cacccggatc atcgggggtt ttaatcgcat tgcctccgta 240
gtggaagggt atgtaagagc tgcagaactt tgatggaaat ttatcgataa gattgatacc 300
atgagcagtt acggaaatgt ttttaataat aggtaatgtg atcggatacg taacggggct 360
aatatcagat atagatgaac atgcgtctgg aagagctgta tctctatcct gaaagcttat 420
ctctgcgtgg tgagtgggct gcataatggc gttaacaaca tgtccgaact tgtgccaatc 480
tcggtgttga tgaggatttt gatcggagat gttccaggta ggttttaatc ctataaacat 540
atattcaatg ggccacttaa gagcagacat tagtttttca tcgtggtggt tataatctct 600
agaggatccc cgggtaccga gctcgaattc gtaatcatgg tcatagctgt ttcctgtgtg 660
<210> 2
<211> 57
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA1-F
<400> 2
ggatcctaat acgactcact atagaatttc tactgttgta gatttcttct tcagaac 57
<210> 3
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA1-R
<400> 3
cagaacggtt cagctacacg ctggtgcgat tccctgaacc gttctgaaga agaaa 55
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> p-sg-f
<400> 4
ggatcctaat acgactcact a 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA1-R2
<400> 5
cagaacggtt cagctacacg c 21
<210> 6
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA5-F
<400> 6
ggatcctaat acgactcact atagaatttc tactgttgta gatagagcag acattagtt 59
<210> 7
<211> 53
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA5-R
<400> 7
cattagtttt tcatccactg cggctcctca tcctgaaaaa ctaatgtctg ctc 53
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> 3-Cas12a-pegRNA5-R2
<400> 8
cattagtttt tcatccactg c 21
<210> 9
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> RT1-F
<400> 9
ggaatcgcac cagcgtgt 18
<210> 10
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> RT2-R
<400> 10
ggatgaggag ccgcagtg 18
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> SgRNA1
<400> 11
ttcttcttca gaacggttca g 21
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> SgRNA2
<400> 12
agagcagaca ttagtttttc a 21
Claims (18)
1. A method of enriching a nucleic acid target region, comprising:
(1) Designing a set of RNA sequences for a target region of the nucleic acid, the set of RNA sequences comprising a first RNA and a second RNA,
the first RNA comprises a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insertion sequence and a first complementary sequence which are connected in sequence, wherein the first sgRNA molecule and the first complementary sequence are complementary to sequences upstream of the target region, the first sgRNA molecule is complementary to one strand of the nucleic acid, the first complementary sequence is complementary to the other strand of the nucleic acid,
the second RNA comprises, in sequence, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence, and a second complement sequence, the second sgRNA molecule and the second complement sequence each being complementary to a sequence downstream of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complement sequence being complementary to the other strand of the nucleic acid;
taking the complementary position of the first complementary sequence and the upstream sequence of the target region in the step (1) as a first position, taking the complementary position of the second complementary sequence and the downstream sequence of the target region as a second position, and taking the distance between the first position and the second position as 100-300bp;
(2) Mixing the set of RNA sequences and Cas12a protein, and performing a first incubation treatment to obtain a complex;
(3) Mixing the complex, the nucleic acid, the reverse transcriptase, the denaturant and the dNTP, performing a second incubation treatment, and performing a denaturation treatment so as to obtain a denatured product;
(4) Removing RNA and protein in the denatured product, and performing PCR amplification to obtain an enriched product.
2. The method according to claim 1, wherein the first incubation in step (2) is performed at a temperature of 20 to 28 ℃ for 10 to 30 minutes.
3. The method according to claim 1, wherein the first incubation treatment in step (2) is an incubation at a temperature of 25 degrees Celsius for 15 minutes.
4. The method according to claim 1, wherein the second incubation in step (3) is performed at 35 to 40 ℃.
5. The method according to claim 1, wherein the second incubation in step (3) is performed at 37 ℃ for 1 to 2 hours.
6. The method of claim 1, wherein the first promoter sequence and the second promoter sequence are each independently selected from at least one of a T7 promoter sequence, a U6 promoter sequence.
7. The method of claim 1, wherein the first promoter sequence and the second promoter sequence are both T7 promoter sequences.
8. The method according to claim 1, wherein the distance between the first position and the second position in step (1) is 180 to 250bp.
9. The method according to claim 1, wherein the RNA is removed in step (4) by RNase and the protein is removed by proteinase K.
10. The method according to claim 9, wherein the RNA is removed by incubating with RNase at 37 ℃ for 10 to 20 minutes.
11. The method according to claim 9, characterized in that proteinase K is used for the removal of the proteins by incubation at 37 ℃ for 8 to 10 hours.
12. The method of claim 1, wherein the denaturant is DTT.
13. The method according to claim 12, wherein the denaturant is used at a concentration of 0.5 to 5mM.
14. The method of claim 12, wherein the denaturing agent is used at a concentration of 1mM.
15. The method according to claim 1, wherein the denaturation treatment is carried out at 80 to 90 ℃ for 10 to 20 minutes.
16. The method according to claim 1, wherein the denaturation treatment is carried out at a temperature of 85 ℃ for 15 minutes.
17. A method of constructing a sequencing library, comprising:
enriching the nucleic acid target area by using the method of any one of claims 1 to 16 so as to obtain the enriched product;
performing a library construction based on the enriched products to obtain a sequencing library.
18. A sequencing method, comprising:
constructing a sequencing library based on the method of claim 17;
sequencing based on the sequencing library to obtain a sequencing result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010146552.9A CN113355389B (en) | 2020-03-05 | 2020-03-05 | Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010146552.9A CN113355389B (en) | 2020-03-05 | 2020-03-05 | Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113355389A CN113355389A (en) | 2021-09-07 |
| CN113355389B true CN113355389B (en) | 2022-11-15 |
Family
ID=77523632
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010146552.9A Active CN113355389B (en) | 2020-03-05 | 2020-03-05 | Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113355389B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201916379D0 (en) * | 2019-11-11 | 2019-12-25 | Biocrucible Ltd | Biochemical reaction methods and reagents |
| AU2018383712A1 (en) * | 2017-12-11 | 2020-07-02 | Editas Medicine, Inc. | Cpf1-related methods and compositions for gene editing |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210301269A1 (en) * | 2020-01-22 | 2021-09-30 | New York Genome Center, Inc. | Recombinant crispr-cas9 nucleases with altered pam specificity |
-
2020
- 2020-03-05 CN CN202010146552.9A patent/CN113355389B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2018383712A1 (en) * | 2017-12-11 | 2020-07-02 | Editas Medicine, Inc. | Cpf1-related methods and compositions for gene editing |
| GB201916379D0 (en) * | 2019-11-11 | 2019-12-25 | Biocrucible Ltd | Biochemical reaction methods and reagents |
Non-Patent Citations (3)
| Title |
|---|
| Novel CRISPR/Cas applications in plants: from prime editing to chromosome engineering;Teng-Kuei Huang等;《Transgenic Res》;20210301;第30卷;第529-549页 * |
| Search-and-replace genome editing without double-strand breaks or donor DNA;Andrew V Anzalone等;《Nature》;20191021;第576卷(第7785期);第149-157页 * |
| 植物基因组编辑新工具——引导编辑技术;杜秋丽等;《生物工程学报》;20220125;第38卷(第01期);第26-33页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113355389A (en) | 2021-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11697843B2 (en) | Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing | |
| WO2022037623A1 (en) | Kit and method for isothermal rapid detection of sars-cov-2 virus nucleic acid | |
| US9745614B2 (en) | Reduced representation bisulfite sequencing with diversity adaptors | |
| US20200399690A1 (en) | Compositions and methods for selection of nucleic acids | |
| US10858651B2 (en) | Compositions and methods for enrichment of nucleic acids | |
| CA3065172A1 (en) | A method of amplifying single cell transcriptome | |
| US20100035249A1 (en) | Rna sequencing and analysis using solid support | |
| US20180148717A1 (en) | Methods for Generating Circular DNA from Circular RNA | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| CN109689888A (en) | Cell-free nucleic acid standards and application thereof | |
| US20230056763A1 (en) | Methods of targeted sequencing | |
| CN112626173B (en) | RNA library construction method | |
| WO2017215517A1 (en) | Method for removing 5' and 3' linker connection by-products in sequencing library construction | |
| CN112322700B (en) | Construction method, kit and application of short RNA fragment library | |
| US11680285B2 (en) | Hooked probe, method for ligating nucleic acid and method for constructing sequencing library | |
| CN113355389B (en) | Method for target-oriented enrichment of nucleic acid target region by using CRISPR/Cas12a system and application thereof | |
| CN116287124A (en) | Single-stranded joint pre-connection method, library construction method of high-throughput sequencing library and kit | |
| WO2018232594A1 (en) | Pcr primer pair and application thereof | |
| CN115927540A (en) | Construction method of small RNA high-throughput sequencing library based on splint connection | |
| WO2021058145A1 (en) | Phage t7 promoters for boosting in vitro transcription | |
| CN113667714A (en) | Target area capturing method, kit and sequencing method | |
| WO2023116490A1 (en) | Novel method for detecting small rna and use thereof | |
| CN115948503A (en) | Method for efficiently enriching targeting sequences based on CRISPR (clustered regularly interspaced short palindromic repeats) | |
| CN115852494A (en) | Construction method of target sequencing library | |
| US20190249334A1 (en) | Methods and Kits for Detecting Contamination and Sample Misidentification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |