CN113355389B - Method and application of targeted enrichment nucleic acid target region using CRISPR/Cas12a system - Google Patents

Abstract

The invention relates to a method for targeting and enriching nucleic acid target regions by using the CRISPR/Cas12a system and its application. The method includes (1) designing first and second RNAs, wherein the first RNA contains a first complementary sequence in addition to the first sgRNA molecule, the second RNA contains a second complementary sequence in addition to the second sgRNA molecule, and the first sgRNA molecule The first complementary sequence is complementary to the upstream of the target region, and the second sgRNA molecule and the second complementary sequence are complementary to the downstream of the target region; (2) mixed with the Cas12a protein to obtain a complex; (3) compound, nucleic acid, reverse transcriptase, The denaturant and dNTP are mixed and incubated and denatured to obtain denatured products; (4) RNA and protein are removed, and enriched products are amplified. In this way, the enrichment of the target region can be realized simply and quickly, and it can be applied in the field of sequencing.

Description

A method for targeting and enriching nucleic acid target regions using the CRISPR/Cas12a system and its application

technical field

The present invention relates to the technical field of molecular biology, in particular to the field of nucleic acid capture sequencing, and in particular to a method for targeting and enriching nucleic acid target regions using a CRISPR/Cas12a system and its application.

Background technique

In recent years, DNA sequencing technology has been continuously developed, from the traditional Sanger sequencing technology to the current "Next Generation Sequencing Technology (NGS)". The outstanding feature of NGS is that it can realize millions or even hundreds of millions of sequencing reactions simultaneously, improving the Sequencing throughput has achieved high-throughput sequencing, allowing DNA information to be continuously analyzed. DNA sequencing has positive significance for the understanding of genetic regulation of traits and disease formation.

Despite the continuous development of NGS technology, there are still disadvantages of high cost for whole genome sequencing, and we often do not need to sequence the whole genome, but only need to perform DNA sequencing on specific regions of interest, which can effectively reduce the cost of sequencing The cost and manpower and material resources, so the method of targeting and enriching DNA in the target region came into being. The current common target enrichment method is to use liquid phase hybridization to capture the target region, so that the targeted capture enrichment of the genomic region of interest can be carried out, the sequencing range is reduced, and the effective capture and enrichment of the target region is achieved.

The use of liquid-phase hybridization capture can effectively target and enrich the target region, but usually requires a long hybridization time (16-24h), and requires a large amount of input DNA, and high-temperature denaturation can also easily lead to non-specific hybridization, resulting in background Increased noise leads to poor targeting efficiency, and cumbersome elution procedures are required after hybridization, which is time-consuming and labor-intensive.

Therefore, it is necessary to provide a fast, efficient and accurate method for enriching the target region.

Contents of the invention

The present invention aims at solving one of the technical problems existing in the prior art at least to a certain extent. To this end, the present invention provides a method for targeting and enriching nucleic acid target regions using the CRISPR/Cas12a system and its application.

CRISPR technology is a technology derived from the immune system of archaea, which can effectively recognize the PAM sequence of the target region, so as to edit the target sequence. Recently, the team of David Liu et al. (reference Anzalone A V, Randolph P B, Davis J R, et al. Search-and-replace genome editing without double-strandbreaks or donor DNA [J]. Nature, 2019.) improved the existing gene The editing CRSPR/cas9 technology proposes the concept of Prime editing, which can achieve precise insertion of target sequences and effectively reduce off-target effects. The introduction of this technology will make it easier and more efficient for us to capture target sequences. Cas12a (Cpf1) is a protein similar to Cas9. Its recognition genome PAM sequence is TTTN, and the cleavage site is far away from the recognition sequence, forming a sticky end, which provides an effective guarantee for precise editing of the target region (reference Zetsche B , Gootenberg J S, Abudayyeh O O, et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class2 CRISPR-Cas System [J]. CELL, 2015, 163(3): 759-771.). Through research, the inventors of the present invention creatively found that the target region of nucleic acid can be effectively edited by using the CRISPR/Cas12a system and lead editing, so as to capture it efficiently and accurately, and then effectively enrich the target region by means of PCR amplification , and finally perform high-throughput sequencing and analysis of the target region, which effectively reduces the cost of sequencing, improves the specificity and sensitivity of capture, and will have strong practicability in the fields of DNA detection.

The method of using the CRISPR/Cas12a system to target and enrich the nucleic acid target region, which designs a pair of RNA sequences (ie, the first RNA and the second RNA) according to the upstream and downstream of the target region of the nucleic acid respectively, the first RNA contains the target and The upstream complementary first complementary sequence of the region, the second RNA contains the second complementary sequence complementary to the downstream of the target region, and the RNA sequence is co-incubated with Cas12a to form a complex; then nucleic acid, reverse transcriptase, DTT And dNTPs are added to the complex for incubation and denaturation treatment, that is, the target region can be obtained in a targeted manner, and PCR amplification can enrich the target region, which can be used for subsequent high-throughput sequencing analysis. Compared with the currently commonly used hybrid capture targeted sequencing technology, the method for targeting and enriching nucleic acid target regions provided by the present invention has the advantages of simplicity, speed, high sensitivity, and low cost, and can be used in DNA sequence analysis, disease monitoring, etc. for effective application.

Specifically, the present invention provides the following technical solutions:

In the first aspect of the present invention, the present invention provides a method for enriching a nucleic acid target region, comprising: (1) designing a set of RNA sequences for the target region of the nucleic acid, the set of RNA sequences including the first RNA and the second RNA, the first RNA includes the first promoter sequence, the Cas12a protein scaffold sequence, the first sgRNA molecule, the first insertion sequence and the first complementary sequence connected in sequence, the first sgRNA molecule and the The first complementary sequence is complementary to the upstream sequence of the target region, the first sgRNA molecule is complementary to one strand of the nucleic acid, the first complementary sequence is complementary to the other strand of the nucleic acid, and the second The RNA includes a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence, and a second complementary sequence that are connected in sequence, and the second sgRNA molecule and the second complementary sequence are all related to the target region The downstream sequence of the nucleic acid is complementary, the second sgRNA molecule is complementary to one strand of the nucleic acid, and the second complementary sequence is complementary to the other strand of the nucleic acid; (2) combining the set of RNA sequences and the Cas12a complex Mixing, performing the first incubation, so as to obtain the complex; (3) mixing the complex, the nucleic acid, reverse transcriptase, denaturant and dNTP, performing the second incubation, and denaturing the obtained incubation product, so that Obtaining a denatured product; (4) removing RNA and protein in the denatured product, and performing PCR amplification, so as to obtain an enriched product. The present invention provides a method for enriching the target region of the nucleic acid by using the CRISPR/Cas12a system, which can achieve fast, low-cost, targeted enrichment of the target region of the nucleic acid, and the obtained enriched sequence can be obtained through high Through-put sequencing and other methods can be used for analysis, so that the DNA information of the target sequence can be obtained quickly and at low cost, providing a basis for subsequent analysis.

According to an embodiment of the present invention, the method for enriching a nucleic acid target region described above may further include the following technical features:

According to an embodiment of the present invention, the first incubation treatment in step (2) is incubation at a temperature of 20-28 degrees Celsius for 10-30 minutes, preferably at a temperature of 25 degrees Celsius for 15 minutes.

According to an embodiment of the present invention, the second incubation treatment in step (3) is the second incubation at 35-40 degrees Celsius, preferably at 37 degrees Celsius for 1-2 hours.

According to an embodiment of the present invention, the first promoter sequence and the second promoter sequence are each independently selected from at least one of a T7 promoter sequence and a U6 promoter sequence. Preferably, the first promoter Both the subsequence and the second promoter sequence are T7 promoter sequences.

According to an embodiment of the present invention, the upstream complementary position of the first complementary sequence and the target region in step (1) is used as the first position, and the downstream complementary position of the second complementary sequence and the target region is used as the second position. position, the distance between the first position and the second position is 100bp-300bp, preferably 180-250bp.

According to an embodiment of the present invention, in step (4), RNase is used to remove the RNA, and proteinase K is used to remove the protein.

According to an embodiment of the present invention, RNase is used to incubate at 37 degrees Celsius for 10-20 minutes to remove the RNA; proteinase K is used to incubate at 37 degrees Celsius for 8-10 hours to remove the protein.

According to an embodiment of the present invention, the denaturant is DTT, preferably, the denaturant is used at a concentration of 0.5-5 mM, preferably 1 mM.

According to an embodiment of the present invention, the denaturing treatment is performed at a temperature of 80-90 degrees Celsius for 10-20 minutes, preferably at a temperature of 85 degrees Celsius for 15 minutes.

In a second aspect of the present invention, the present invention provides a method for enriching a target region of a nucleic acid, comprising: enriching the target region of the nucleic acid using a CRISPR/Cas12a system, the CRISPR/Cas12a system comprising a set of RNA Sequence and Cas12a protein, described one group of RNA sequence comprises first RNA and second RNA, and described first RNA comprises first promoter sequence, Cas12a protein scaffold sequence, first sgRNA molecule, first insertion sequence and The first complementary sequence, the first complementary sequence is complementary to the upstream sequence of the target region, the first sgRNA molecule is complementary to one strand of the nucleic acid, the first complementary sequence is complementary to the other strand of the nucleic acid Complementary, the second RNA includes a connected second promoter sequence, Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence and a second complementary sequence, the second complementary sequence and the downstream sequence of the target region Complementary, the second sgRNA molecule is complementary to one strand of the nucleic acid, and the second complementary sequence is complementary to the other strand of the nucleic acid. The present invention provides a method for enriching the target region of the nucleic acid by using the CRISPR/Cas12a system, which can achieve fast, low-cost, targeted enrichment of the target region of the nucleic acid, and the obtained enriched sequence can be obtained through high Through-put sequencing and other methods can be used for analysis, so that the DNA information of the target sequence can be obtained quickly and at low cost, providing a basis for subsequent analysis.

In the third aspect of the present invention, the present invention provides a method for constructing a sequencing library, comprising: using the method described in any embodiment of the first aspect of the present invention or using the method described in the second aspect of the present invention to Enriching the nucleic acid target region to obtain the enriched product; building a library based on the enriched product to obtain a sequencing library.

In the fourth aspect of the present invention, the present invention provides a sequencing method, comprising: constructing a sequencing library based on the method described in the third aspect of the present invention; performing sequencing based on the sequencing library, so as to obtain a sequencing result.

The beneficial effects obtained by the present invention are as follows: the present invention provides a fast, low-cost method for targeting enriched DNA target regions, which greatly shortens the time for building a library and reduces the It can effectively adapt to high-throughput sequencing, provide a good strategy for analyzing the sequence information of the target DNA region, and further lay a solid foundation for gene detection and gene diagnosis.

Additional aspects and advantages of the invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Description of drawings

Fig. 1 is a schematic diagram of a method for targeting and enriching a nucleic acid target region according to an embodiment of the present invention.

Fig. 2 is a gel agar electrophoresis image of PCR amplification of the stock solution after CRISPR/Cas12a digestion provided according to an embodiment of the present invention.

Fig. 3 is a gel electrophoresis image of the precipitated product digested with protease according to an embodiment of the present invention.

Fig. 4 is an agar electrophoresis diagram of PCR gel using target DNA as a template according to an embodiment of the present invention.

Fig. 5 is a diagram of the sequencing results after TA cloning of the target sequence provided according to an embodiment of the present invention.

Detailed ways

Embodiments of the present invention are described in detail below. The embodiments described below are exemplary only for explaining the present invention and should not be construed as limiting the present invention.

The present invention provides a method for enriching nucleic acid target regions. The method realizes targeted enrichment of nucleic acid target regions by modifying the CRISPR/Cas12a system. The provided CRISPR/Cas12a system comprises a set of RNA sequences and Cas12a protein, wherein said set of RNA sequences comprises a first RNA and a second RNA, and said first RNA comprises a first promoter sequence, a Cas12a protein scaffold sequence connected in sequence , the first sgRNA molecule, the first insertion sequence and the first complementary sequence, the first sgRNA molecule and the first complementary sequence are complementary to the upstream of the target region, the first sgRNA molecule and the nucleic acid One strand is complementary, the first complementary sequence is complementary to the other strand of the nucleic acid, and the second RNA includes a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence and The second complementary sequence, the second sgRNA molecule and the second complementary sequence are complementary to the downstream sequence of the target region, the second sgRNA molecule is complementary to a strand of the nucleic acid, and the second complementary sequence Complementary to the other strand of the nucleic acid. While using this system to target nucleic acid target regions, it can also perform complementary binding with nucleic acid target regions, and by means of PCR amplification, the enrichment of target regions can be achieved, and the obtained sequences can be used for subsequent high-throughput sequencing analysis. Compared with the currently commonly used hybrid capture targeted sequencing technology, the enrichment method provided has the advantages of simplicity, speed, high sensitivity and low cost, and can be effectively applied in DNA sequence analysis and disease monitoring.

Herein, the mentioned Cas12a protein scaffold sequence is used for binding to Cas12a protein. The first sgRNA molecule and the second sgRNA molecule mentioned herein are used to recognize the PAM sequence, are complementary to one strand of nucleic acid, and are used to cut the nucleic acid sequence.

According to an embodiment of the present invention, the provided method for enriching a nucleic acid target region includes: designing a set of RNA sequences for the target region of the nucleic acid, the set of RNA sequences including a first RNA and a second RNA, the The first RNA includes the first promoter sequence, the Cas12a protein scaffold sequence, the first sgRNA molecule, the first insertion sequence and the first complementary sequence connected in sequence, and the first insertion sequence and the first complementary sequence are all compatible with the described first RNA. The upstream sequence of the target region is complementary, the first sgRNA molecule is complementary to one strand of the nucleic acid, the first complementary sequence is complementary to the other strand of the nucleic acid, and the second RNA includes a connected second promoter sequence, the Cas12a protein scaffold sequence, the second sgRNA molecule, the second insertion sequence and the second complementary sequence, the second insertion sequence and the second complementary sequence are complementary to the downstream sequence of the target region, the second The sgRNA molecule is complementary to one strand of the nucleic acid, and the second complementary sequence is complementary to the other strand of the nucleic acid; (2) mixing the set of RNA sequences and the Cas12a protein, and performing the first incubation treatment, so as to obtain Complex; (3) mixing the complex, the nucleic acid, reverse transcriptase, denaturant and dNTP, performing a second incubation treatment, and performing denaturation treatment, so as to obtain a denatured product; (4) removing the denatured product The RNA and protein in the sample were amplified by PCR in order to obtain enriched products.

Specifically, as shown in Figure 1, it should be noted that the first RNA and the second RNA in Figure 1 only show partial sequences, which are used to characterize the upstream and downstream of the first RNA and the second RNA and the target region Complementary pairing and binding to Cas12a protein for cleavage and amplification.

According to an embodiment of the present invention, the complementary position of the first complementary sequence and the upstream sequence of the target region in step (1) is taken as the first position, and the complementary position of the second complementary sequence and the downstream sequence of the target region is taken as The second position, the distance between the first position and the second position is 200bp. According to an embodiment of the present invention, in step (4), RNase is used to remove the RNA, and proteinase K is used to remove the protein. According to an embodiment of the present invention, RNase is used to incubate at a temperature of 37 degrees Celsius for 10-20 minutes, so as to remove the RNA. According to an embodiment of the present invention, proteinase K was used to incubate at a temperature of 37 degrees Celsius for 6 hours, so as to remove the protein.

The denaturant used may be DTT, wherein the concentration of DTT used may be 1 mM (final concentration). According to an embodiment of the present invention, the denaturing treatment may be performed at a temperature of 80-90 degrees Celsius for 10-20 minutes, preferably at a temperature of 85 degrees Celsius for 15 minutes.

The solutions of the present invention will be explained below in conjunction with specific embodiments. Those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be considered as limiting the scope of the present invention. If no specific technique or condition is indicated in the examples, it shall be carried out according to the technique or condition described in the literature in this field or according to the product specification. The reagents or instruments used were not indicated by the manufacturer, and they were all commercially available conventional products. It should be noted that the embodiments listed in the present invention are only to illustrate the applicability of the present invention, and do not limit the scope of application of the present invention. optimization.

Example 1

Embodiment 1 specifically provides a method of using the CRISPR/Cas12a system to target and enrich nucleic acid target regions.

The oligonucleotide sequences used are shown in Table 1 below, and the names corresponding to each sequence will be introduced in subsequent steps.

Table 1 Nucleotide sequence

Select the P27 gene as the target region sequence, and enrich the target region of the P27 gene by designing the sgRNA sequence targeting the target region of the P27 gene. The specific experimental steps are as follows:

1. Preparation of sgRNA sequence for targeting the target region of P27 gene

1) Select the target region sequence of P27 (as shown in SEQ ID NO: 1 in Table 1), and use Chop-Chop online sgRNA design software (http://chopchop.cbu.uib.no/) in the sense strand of the target region One sgRNA was designed on the antisense and antisense strands respectively.

2) Use the software to design the specific sgRNA targeting P27, and according to the prediction of the software, select two sgRNAs with higher scores, and the two selected sgRNA molecules are (the sequences shown are represented by DNA molecules, representing and as templates Nucleic acid complementary sequence):

sgRNA1: TTCTTTCTTCAGAACGGTTCAG (SEQ ID NO: 11)

sgRNA2: AGAGCAGACATTAGTTTTTCA (SEQ ID NO: 12)

Insertion sequences (as shown in SEQ ID NO:9 and SEQ ID NO:10) were added to the 3' ends of the two sgRNAs.

3) According to the selected sgRNA, design pegRNA, specifically, from the 5' end to the 3' end of the pegRNA are the T7 promoter sequence (for transcription of the following sgRNA, Scaffold, insertion sequence and binding site PBS), Cas12a Protein scaffold sequence (for binding to Cas12a), sgRNA sequence (for cutting target sequence), insertion sequence (can be used as a universal linker sequence for subsequent sequencing and verification of successful insertion), binding site sequence (PBS) (that is, The mentioned first complementary sequence or second complementary sequence can be combined with the upstream sequence of the target region to facilitate the insertion of the insertion sequence).

Then use specific primers for overlap and PCR amplification, after recovery and purification, perform in vitro transcription and purification of RNA, and store at -80°C for later use.

Wherein, the amplification system and amplification program during overlap and PCR amplification are shown in Table 2 and Table 3 below. Wherein in Table 2, 3-Cas12a-pegRNA1/5-F is respectively used to synthesize the Cas12a protein Scoffold sequence upstream of the target sequence (i.e. shown in SEQ ID NO:2 in Table 1), and is used to synthesize the Cas12a protein Scoffold downstream of the target sequence Sequence (shown in SEQ ID NO:6 in table 1), respectively annealed with corresponding 3-Cas12a-pegRNA1/5-R (shown in SEQ ID NO:3 and SEQ ID NO:7 in table 1 respectively) .

p-sf-f (shown in SEQ ID NO:4 in table 1) refers to the upstream primer for amplifying the T7 promoter sequence, 3-Cas12a-pegRNA1/5-R2 (respectively as SEQ ID NO in table 1 : 5 and shown in SEQ ID NO: 8) are downstream primers used to amplify the T7 promoter sequence. The products amplified by PCR were used for in vitro transcription to obtain pegRNA.

Table 2 pegRNA PCR amplification system

3-Cas12a-pegRNA1/5-F (10μM) 1μl 3-Cas12a-pegRNA1/5-R (10μM) 1μl p-sg-f (10μM) 2μl 3-Cas12a-pegRNA1/5-R2 (10μM) 2μl 2×KAPA hifi master mix 50μl H₂O 44μl total 100μl

Table 3 PCR program

The PCR amplified product was recovered (zymo D4010), and then quantified using Nanodrop 2000. Prepare the in vitro transcription system in Table 4, and perform in vitro transcription at 37 degrees Celsius overnight.

Table 4 In vitro transcription system

template DNA 10μl (500-1000ng) 10×T7 buffer(NEB) 5μl ATP 2ul GTP 2μl CTP 2μl UTP 2μl RNA inhibitor 2μl T7polymix 2μl H₂O 13μl

Add 6 μl Buffer and 4 μl DNase to the obtained transcript, and incubate at 37 degrees Celsius for 30 minutes to remove the genome in the transcript, and obtain pegRNA1 (corresponding to the target sequence P27 upstream sgRNA sequence) and pegRNA5 (corresponding to the target sequence P27 downstream sgRNA sequence).

Finally, pegRNA was purified using NEB RNA purification kit, quantified by Nanodrop and stored at -80°C for later use.

2. Assemble the CRISPR/Cas12a-pegRNA complex and digest the target region

(1) Preparation of CRISPR/Cas12a-pegRNA complex

Add 2 μg Cas12a protein (NEB, 40 μl, 1 μM/μl=151ng/μl) and 2 μg pegRNA1 and pegRNA5 to a 250 μl PCR tube, and add 6 μl buffer NEB2.1Buffer and 4 μl RNA inhibitor (RNA block), wash with H ₂ Make up to 60 μl with O, and incubate at 25°C for 15 minutes (incubating with a PCR machine) to form a CRISPR/Cas12a-presgRNA complex.

(2) Digestion

Add 2μg P27 DNA, 0.5mM dNTP, 1mM DTT, 4μl reverse transcriptase (purified by our laboratory, ss3), 4μl buffer NEB2.1Buffer to 80μl with H ₂ O, and finally form a 100μl enzyme digestion system. The reaction is as follows: incubate at 37°C for 120 minutes and at 85°C for 15 minutes to obtain assembly solution.

Using the assembly solution as a template, PCR amplification was performed according to the enrichment volumes and programs in Table 5 and Table 6, and the amplification results are shown in Figure 2. Among them, M1 refers to DNA Ladder, which is composed of 11 linear double-stranded DNA strips. The fragments are 1500bp, 1000bp, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, 100bp from top to bottom; M2 Refers to DL2000 DNA Marker, the molecular weights are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp. The original plasmid in Figure 2 is used as a negative control, which refers to the product of the connection of the P27 sequence in Table 1 and the T vector without any treatment.

Table 5 PCR enrichment system

Table 6 PCR enrichment program

3. Perform RNase treatment, proteinase K digestion, isopropanol precipitation and product recovery, and agar gel electrophoresis to separate and purify the target DNA sequence;

Specifically, add 4 μl of RNase treatment to the above product and incubate at 37°C for 30 minutes; add 100 μl of 1×Protease K Buffer (general formula for buffering proteinase K) and 60 μl of Protein K to the product after RNase treatment for digestion at 37°C 6h, preferably, the digestion condition is 37°C, 800rpm for 6h; the digested product is subjected to resin and isopropanol precipitation overnight.

The precipitated target DNA product was subjected to 2% agarose gel electrophoresis (see FIG. 3 ) to verify whether there was cleavage. Figure 3 is the gel electrophoresis of the product after protease digestion and precipitation, where M1 refers to DNA Ladder, which is composed of 11 linear double-stranded DNA bands, and the fragments are 1500bp, 1000bp, 900bp, 800bp from top to bottom, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, 100bp; M2 refers to DL2000 DNA Marker, the molecular weights are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp. Wherein, the precipitation after enzyme digestion refers to the fragment after digestion of the P27 vector by Cas12a and precipitation with isopropanol. The original plasmid, as a negative control, refers to the product of the connection of the P27 sequence in Table 1 to the T vector without any treatment. It can be seen from Fig. 3 that the expected fragment (603bp) was obtained after PCR amplification and effective cleavage could occur.

The target DNA product obtained by the above-mentioned agarose gel electrophoresis was recovered, and the recovered target DNA product was enriched by PCR amplification using primers containing sequencing adapters (refer to the above table 5 and table 6 for the PCR amplification system and amplification conditions. shown) to obtain PCR products. The enrichment effect was verified by gel electrophoresis, and the results are shown in Figure 4. M1 in Figure 4 refers to DNA Ladder, which is composed of 11 linear double-stranded DNA strips, and the fragments are 1500bp, 1000bp, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, 100bp from top to bottom ; M2 refers to DL2000 DNA Marker, DNA molecular weights are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp respectively. PCR after precipitation in Figure 4 all refers to the product of PCR amplification using the product recovered from the target DNA in Figure 3 above as a template, which is the same product as the target DNA in Figure 3 above, indicating that after enzyme digestion, the assembly solution was processed PCR can enrich the target region.

Take the obtained PCR product for TA cloning (5min TA/Blunt-Zero Cloning Kit, C601-01), ligation conditions, incubate at 25°C for 10min in a PCR machine, and quickly transfer the ligation product to Fast-T1 competent cell (Novizan, C505-02), plate overnight at 37°C, pick a single clone and use Sanger sequencing to detect whether the target sequence is enriched and captured and inserted correctly (as shown in Figure 5).

Figure 5 shows the corresponding sequencing results. Studies have shown that the expected sequence (that is, using the insertion sequence RT1 and RT2) can be correctly inserted and can capture and enrich the target region, indicating that the obtained product can be used for target region enrichment and high-throughput sequencing.

In the description of this specification, descriptions with reference to the terms "one embodiment", "some embodiments", "example", "specific examples", or "some examples" mean that specific features described in connection with the embodiment or example , structure, material or feature is included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the described specific features, structures, materials or characteristics may be combined in any suitable manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine different embodiments or examples and features of different embodiments or examples described in this specification without conflicting with each other.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention, those skilled in the art can make the above-mentioned The embodiments are subject to changes, modifications, substitutions and variations.

SEQUENCE LISTING

<110> Guangxi Yangxiang Co., Ltd.

Huazhong Agricultural University

<120> The method and application of using CRISPR/Cas12a system to target and enrich the target region of nucleic acid

<130> PIDC3196816

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 660

<212>DNA

<213> Artificial Sequence

<220>

<223> P27

<400> 1

actgtaacgc agcacagctg aaccgttctg aagaagaaga aagttaatag cagatgccga 60

taccacaaga tcagccgtag tgatagaccc cacgtaatcc gtgtcccaac taatataaaa 120

ttctcttgct ctggatacgt taatatgacc actgggttgg tattcctccc gtggcttcaa 180

agcaaaggta atcatcatcg cacccggatc atcgggggtt ttaatcgcat tgcctccgta 240

gtggaagggt atgtaagagc tgcagaactt tgatggaaat ttatcgataa gattgatacc 300

atgagcagtt acggaaatgt ttttaataat aggtaatgtg atcggatacg taacggggct 360

aatatcagat atagatgaac atgcgtctgg aagagctgta tctctatcct gaaagcttat 420

ctctgcgtgg tgagtgggct gcataatggc gttaacaaca tgtccgaact tgtgccaatc 480

tcggtgttga tgaggatttt gatcggagat gttccaggta ggttttaatc ctataaacat 540

atattcaatg ggccacttaa gagcagacat tagtttttca tcgtggtggt tataatctct 600

agaggatccc cgggtaccga gctcgaattc gtaatcatgg tcatagctgt ttcctgtgtg 660

<210> 2

<211> 57

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA1-F

<400> 2

ggatcctaat acgactcact atagaatttc tactgttgta gatttcttct tcagaac 57

<210> 3

<211> 55

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA1-R

<400> 3

cagaacggtt cagctacacg ctggtgcgat tccctgaacc gttctgaaga agaaa 55

<210> 4

<211> 21

<212>DNA

<213> Artificial Sequence

<220>

<223> p-sg-f

<400> 4

ggatcctaat acgactcact a 21

<210> 5

<211> 21

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA1-R2

<400> 5

cagaacggtt cagctacacg c 21

<210> 6

<211> 59

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA5-F

<400> 6

ggatcctaat acgactcact atagaatttc tactgttgta gatagagcag acattagtt 59

<210> 7

<211> 53

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA5-R

<400> 7

cattagtttt tcatccactg cggctcctca tcctgaaaaa ctaatgtctg ctc 53

<210> 8

<211> 21

<212>DNA

<213> Artificial Sequence

<220>

<223> 3-Cas12a-pegRNA5-R2

<400> 8

cattagtttt tcatccactg c 21

<210> 9

<211> 18

<212>DNA

<213> Artificial Sequence

<220>

<223> RT1-F

<400> 9

ggaatcgcac cagcgtgt 18

<210> 10

<211> 18

<212>DNA

<213> Artificial Sequence

<220>

<223> RT2-R

<400> 10

ggatgaggag ccgcagtg 18

<210> 11

<211> 21

<212>DNA

<213> Artificial Sequence

<220>

<223> sgRNA1

<400> 11

ttcttcttca gaacggttca g 21

<210> 12

<211> 21

<212>DNA

<213> Artificial Sequence

<220>

<223> sgRNA2

<400> 12

agagcagaca ttagtttttc a 21

Claims (18)

1. A method of enriching a nucleic acid target region, comprising:

(1) Designing a set of RNA sequences for a target region of the nucleic acid, the set of RNA sequences comprising a first RNA and a second RNA,

the first RNA comprises a first promoter sequence, a Cas12a protein scaffold sequence, a first sgRNA molecule, a first insertion sequence and a first complementary sequence which are connected in sequence, wherein the first sgRNA molecule and the first complementary sequence are complementary to sequences upstream of the target region, the first sgRNA molecule is complementary to one strand of the nucleic acid, the first complementary sequence is complementary to the other strand of the nucleic acid,

the second RNA comprises, in sequence, a second promoter sequence, a Cas12a protein scaffold sequence, a second sgRNA molecule, a second insertion sequence, and a second complement sequence, the second sgRNA molecule and the second complement sequence each being complementary to a sequence downstream of the target region, the second sgRNA molecule being complementary to one strand of the nucleic acid, the second complement sequence being complementary to the other strand of the nucleic acid;

taking the complementary position of the first complementary sequence and the upstream sequence of the target region in the step (1) as a first position, taking the complementary position of the second complementary sequence and the downstream sequence of the target region as a second position, and taking the distance between the first position and the second position as 100-300bp;

(2) Mixing the set of RNA sequences and Cas12a protein, and performing a first incubation treatment to obtain a complex;

(3) Mixing the complex, the nucleic acid, the reverse transcriptase, the denaturant and the dNTP, performing a second incubation treatment, and performing a denaturation treatment so as to obtain a denatured product;

(4) Removing RNA and protein in the denatured product, and performing PCR amplification to obtain an enriched product.

2. The method according to claim 1, wherein the first incubation in step (2) is performed at a temperature of 20 to 28 ℃ for 10 to 30 minutes.

3. The method according to claim 1, wherein the first incubation treatment in step (2) is an incubation at a temperature of 25 degrees Celsius for 15 minutes.

4. The method according to claim 1, wherein the second incubation in step (3) is performed at 35 to 40 ℃.

5. The method according to claim 1, wherein the second incubation in step (3) is performed at 37 ℃ for 1 to 2 hours.

6. The method of claim 1, wherein the first promoter sequence and the second promoter sequence are each independently selected from at least one of a T7 promoter sequence, a U6 promoter sequence.

7. The method of claim 1, wherein the first promoter sequence and the second promoter sequence are both T7 promoter sequences.

8. The method according to claim 1, wherein the distance between the first position and the second position in step (1) is 180 to 250bp.

9. The method according to claim 1, wherein the RNA is removed in step (4) by RNase and the protein is removed by proteinase K.

10. The method according to claim 9, wherein the RNA is removed by incubating with RNase at 37 ℃ for 10 to 20 minutes.

11. The method according to claim 9, characterized in that proteinase K is used for the removal of the proteins by incubation at 37 ℃ for 8 to 10 hours.

12. The method of claim 1, wherein the denaturant is DTT.

13. The method according to claim 12, wherein the denaturant is used at a concentration of 0.5 to 5mM.

14. The method of claim 12, wherein the denaturing agent is used at a concentration of 1mM.

15. The method according to claim 1, wherein the denaturation treatment is carried out at 80 to 90 ℃ for 10 to 20 minutes.

16. The method according to claim 1, wherein the denaturation treatment is carried out at a temperature of 85 ℃ for 15 minutes.

17. A method of constructing a sequencing library, comprising:

enriching the nucleic acid target area by using the method of any one of claims 1 to 16 so as to obtain the enriched product;

performing a library construction based on the enriched products to obtain a sequencing library.

18. A sequencing method, comprising:

constructing a sequencing library based on the method of claim 17;

sequencing based on the sequencing library to obtain a sequencing result.

Images