CN113350499B

CN113350499B - Application of chicken ovalbumin OVA mRNA in preparation of non-specific immunostimulant

Info

Publication number: CN113350499B
Application number: CN202110724764.5A
Authority: CN
Inventors: 刘丽娜; 谢颖; 曾柱; 周雪; 张瑾宬
Original assignee: Guizhou Medical University
Current assignee: Guizhou Medical University
Priority date: 2021-06-29
Filing date: 2021-06-29
Publication date: 2022-06-14
Anticipated expiration: 2041-06-29
Also published as: CN113350499A

Abstract

The invention discloses application of Ovalbumin (OVA) mRNA in preparation of a non-specific immunostimulant, relates to the technical field of biomedicine, and particularly aims to effectively improve or treat cancers (such as colon cancer) by intratumorally immunizing OVA mRNA, inducing an organism to generate non-specific immune response and enhancing specific immune response, thereby providing a new way for treatment and research of the cancers.

Description

Application of chicken ovalbumin OVA mRNA in preparation of non-specific immunostimulant

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of Ovalbumin (OVA) mRNA in preparation of a non-specific immunostimulant.

Background

Cancer (cancer) refers to a malignant tumor that originates in epithelial tissue, and is the most common of the malignant tumors. Correspondingly, malignant tumors originating in mesenchymal tissue are collectively referred to as sarcomas. There are a few malignant tumors that are not named according to the above principles, such as nephroblastoma and malignant teratoma. The general term "cancer" is used to generally refer to all malignant tumors. Cancer has the biological characteristics of abnormal cell differentiation and proliferation, growth loss control, infiltration, metastasis and the like, is a multi-factor and multi-step complex process and is divided into three processes of carcinogenesis, cancer promotion and evolution, and is closely related to smoking, infection, occupational exposure, environmental pollution, unreasonable diet and genetic factors.

Recent cancer immunotherapy research has focused a great deal of effort on methods to enhance anti-tumor immunity, immunity against relevant antigens, by adoptively transferring activated effector cells, providing non-specific immunostimulants such as cytokines.

A non-specific immunostimulant is a non-specific stimulant substance that activates most or all of the T or B lymphocyte clones, and is not specifically restricted by TCR or BCR. How to develop a new nonspecific immunostimulant becomes one of the problems to be solved urgently.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide application of ovalbumin OVA mRNA in preparation of a non-specific immunostimulant.

The invention is realized by the following steps:

in a first aspect, the embodiments of the present invention provide the use of ovalbumin OVA mRNA in the preparation of a non-specific immunostimulant.

In a second aspect, the embodiments of the present invention provide the use of ovalbumin OVA mRNA in the preparation of an immunomodulator in colon cancer tumors.

In a third aspect, the embodiments of the present invention provide a use of ovalbumin OVA mRNA in the preparation of a medicament for treating or ameliorating colon cancer.

The invention has the following beneficial effects:

the invention discloses that OVA mRNA can be used as an intratumoral immunostimulant or immunomodulator for immunization for the first time, and can induce an organism to generate non-specific immune response and enhance specific immune response, so that the aim of effectively improving or treating cancers (such as colon cancer) is fulfilled, and a new way is provided for the treatment and research of the cancers.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a tumor growth curve in example 1;

FIG. 2 is a graph of the effect of intratumoral immune OVA mRNA on tumor growth of mouse colon cancer in example 1; wherein a is a tumor growth inhibition curve; b is a tumor image; c is the weight of the tumor at the end of the treatment;

FIG. 3 is a graph of the effect of intratumoral immune OVA mRNA on survival time of mice with colon cancer in example 1;

FIG. 4 is the real-time fluorescent quantitative PCR detection of cytokine secretion in the tumor microenvironment in example 1;

FIG. 5 is the tumor infiltration CD8 of example 1⁺(ii) results of immunofluorescent staining of T cells; wherein a is the result of taking tumor tissue for carrying out CD8 alpha immunofluorescence staining 25 days after inoculation, DAPI stains cell nucleus, and the scale bar is 100 mu m; b is the result of quantitative analysis of 3 randomly selected sites using ImageJ software,. p < 0.001.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Firstly, the embodiment of the invention provides the application of chicken ovalbumin OVA mRNA in the preparation of non-specific immunostimulants.

OVA, Ovalbumin, also known as egg white albumin, consists of 386 amino acids and has a molecular weight of about 45 kD. In the production and preparation of various vaccines and biological medicines, OVA is often used as a protein additive to improve the stability of biological medicines or vaccines, or used as a carrier protein for coupling haptens in the preparation process of antibodies, and also used as a protein molecular weight standard for electrophoresis or chromatographic chromatography.

After the existing vaccine based on OVA is immunized, the immune response of specifically killing the tumor cells expressing the OVA antigen can be generated, namely, the antigen-specific anti-tumor immune response induced by the vaccine can only treat the tumor expressing the OVA antigen. OVA is chicken ovalbumin, tumors are not expressed under normal conditions, tumor cells expressing OVA antigens are artificially constructed based on scientific research purposes, corresponding tumor models are established after animals are inoculated, and the research on the tumor treatment effect of OVA-based vaccines is carried out. However, in practical applications, OVA-based vaccines are not able to treat tumors.

Intratumoral injection of mRNA initiates a powerful systemic anti-tumor immune response by enhancing antigen presentation in tumors and TDLNs (tumor draining lymph nodes). The single-stranded mRNA can induce innate immune response to enhance vaccine antigen-induced immune response through recognition of Pattern Recognition Receptors (PRRs) such as TLRs (Toll-like receptors), and has adjuvant effect. The OVA mRNA in the embodiment of the invention is unmodified single-chain mRNA, has adjuvant effect, and can enhance the activation of Dendritic Cells (DCs) in tumors and the initiation of T cells, thereby enhancing the immune response induced by OVA antigen. Therefore, intratumoral injection of tumor antigen mRNA is a potential immunotherapy strategy, and provides a new idea for clinical tumor treatment.

An "OVA mRNA" herein may be an mRNA encoding a known OVA protein sequence. Wherein, the OVA protein can be derived from the OVA protein existing in the existing organism or derived from the OVA protein sequence in the existing gene database.

Optionally, the nucleotide sequence of the chicken ovalbumin OVA mRNA is shown in SEQ ID No. 1: 5'-augggcagcaucggcgccgccagcauggaguucugcuucgacguguucaaggagcugaaggugcaccacgccaacgagaacaucuucuacugccccaucgccaucaugagcgcccuggccaugguguaccugggcgccaaggacagcacccggacccagaucaacaagguggugcgguucgacaagcugcccggcuucggcgacagcaucgaggcccagugcggcaccagcgugaacgugcacagcagccugcgggacauccugaaccagaucaccaagcccaacgacguguacagcuucagccuggccagccggcuguacgccgaggagcgguaccccauccugcccgaguaccugcagugcgugaaggagcuguaccggggcggccuggagcccaucaacuuccagaccgccgccgaccaggcccgggagcugaucaacagcuggguggagagccagaccaacggcaucauccggaacgugcugcagcccagcagcguggacagccagaccgccauggugcuggugaacgccaucguguucaagggccugugggagaagaccuucaaggacgaggacacccaggccaugcccuuccgggugaccgagcaggagagcaagcccgugcagaugauguaccagaucggccuguuccggguggccagcauggccagcgagaagaugaagauccuggagcugcccuucgccagcggcaccaugagcaugcuggugcugcugcccgacgaggugagcggccuggagcagcuggagagcaucaucaacuucgagaagcugaccgaguggaccagcagcaacgugauggaggagcggaagaucaagguguaccugccccggaugaagauggaggagaaguacaaccugaccagcgugcugauggccaugggcaucaccgacguguucagcagcagcgccaaccugagcggcaucagcagcgccgagagccugaagaucagccaggccgugcacgccgcccacgccgagaucaacgaggccggccgggagguggugggcagcgccgaggccggcguggacgccgccagcgugagcgaggaguuccgggccgaccaccccuuccuguucugcaucaagcacaucgccaccaacgccgugcuguucuucggccggugcgugagccccuga-3' are provided. Preferably, the non-specific immunostimulant has at least one of the following effects:

(1) up-regulating the expression level of cytokines in tumor tissue;

(2) increase tumor infiltration CD8⁺The number of T cells;

(3) inhibiting tumor growth;

(4) prolonging the survival time of tumor patients.

Tumor infiltration CD8⁺T cells belong to the group of "Tumor Infiltrating Lymphocytes (TILs)" which are a heterogeneous population of lymphocytes present in tumors and having an anti-tumor effect, among which CD8⁺T cells are a main effector cell (cytotoxic T lymphocytes, CTL), secrete various cytokines to participate in immunization, and have killing effects on certain viruses, tumor cells and the like.

Preferably, the tumor is colon cancer.

Preferably, the cytokine is selected from at least one of IFN-gamma, TNF-alpha and IL-12.

The invention also provides application of the chicken ovalbumin OVA mRNA in preparing an immunomodulator in colon cancer tumor. The application specifically refers to: after the chicken ovalbumin OVA mRNA is subjected to intratumoral immunization, the specific and nonspecific immune response of an organism can be induced and enhanced. The research of the invention finds that after OVA mRNA is immunized in a mouse, the growth of colon cancer subcutaneous tumor can be obviously inhibited, the survival time of the mouse is prolonged, the expression levels of cell factors IFN-gamma, TNF-alpha and IL-12 in tumor tissues are up-regulated, and the tumor infiltration CD8 is increased⁺The number of T cells, and therefore, intratumoral immune OVA mRNA, can achieve the technical effect of effectively treating colon cancer.

Optionally, the nucleotide sequence of the chicken ovalbumin OVA mRNA is shown in SEQ ID No. 1.

In addition, the embodiment of the invention also provides application of the chicken ovalbumin OVA mRNA in preparing a medicament for treating or improving colon cancer.

Alternatively, the nucleotide sequence of the OVA mRNA is shown as SEQ ID No. 1.

Optionally, the dosage form of the drug is any one of a solid dosage form, a semi-solid dosage form and a liquid dosage form.

In some embodiments, the drug may also include existing chemical drugs for treating tumors.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

1.1 Main Material

Mouse CT26 colon cancer cell line was purchased from the cell resource center of shanghai academy of sciences of the chinese academy of sciences; unmodified OVA mRNA was purchased from TriLink Bio Technologies (Catalog No. L-7610); 1 XPBS, a double resistant solution of penicillin and streptomycin (100X) was purchased from Hyclone; RPMI 1640 medium was purchased from Gibco; fetal bovine serum was purchased from Hangzhou Biotechnology GmbH in Zhejiang; SuperScript III First-Strand reverse transcriptase was purchased from Invitrogen; TB

Premix Ex Taq^TMII (TliRNaseH plus), ROX plus from TaKaRa;

the TNF-alpha forward primer is 5'-ACTGGCAGAAGAGGCACTCC-3', and the reverse primer is 5'-GCCACAAGCAGGAATGAGAA-3';

5'-ACTTGCACCACCTTGGACTTC-3' as TGF-beta forward primer and 5'-GGTCATCACCGTTGGCTCA-3' as reverse primer;

the IL-12 forward primer is 5'-AAGACATCACACGGGACCAAACCA-3', and the reverse primer is 5'-CGCAGAGTCTCGCCATTATGATTC-3';

the IL-6 forward primer is 5'-CGGAGAGGAGACTTCACAGAG-3', and the reverse primer is 5'-ATTTCCACGATTTCCCAGAG-3';

the IFN-gamma forward primer is 5'-GACAATCAGGCCATCAGCAACAAC-3', and the reverse primer is 5'-GAGGCTGGATTCCGGCAACAG-3';

the beta-actin forward primer was 5'-GTGCTATGTTGCTCTAGACTTCG-3' and the reverse primer was 5'-ATGCCACAGGATTCCATACC-3'.

The primers were synthesized by Shanghai Bioengineering services, Inc.

1.2 construction of mouse Colon cancer subcutaneous tumor model

SPF (specific Pathologen free) grade female BALB/c mice of 6-8 weeks old were purchased from Gentianxin Biotechnology GmbH, and were bred at the Experimental animals center of Guizhou medical university (Experimental animals engineering technology center of Guizhou province), and were randomly divided into 4 groups of 5 mice each. The RPMI 1640 medium was used to culture mouse CT26 colon cancer cells, and the CT26 cells grown on a cell culture dish were digested and counted, and 4 groups of mice were inoculated with four cell inoculations: 1X 10⁵One/one, 5 x 10⁵1 x 10 pieces of⁶2 x 10 pieces of⁶One mouse was inoculated subcutaneously on the right side of the back, and the tumor size was measured every 2 to 3 days on the day of injection, with the tumor volume ═ 2 (length × width × height)/28 th day observed. The optimal inoculation dose of CT26 cells is determined according to the size and the living state of the tumor of the mouse.

Determination of optimal seeding dose of CT26 cells: rice-sized bumps were palpable but not measurable at the mouse inoculation site 3 days after inoculation of mice with different doses of tumor cells, and tumor sizes were recorded starting from day 6. Due to individual differences and the number of tumor cells inoculated, individual mice were not palpable and tumor measured until day 14. With increasing cell inoculation dose, the mortality rate of mice also increased, and by day 14, the maximal dose group had massive deaths, thus 2X 10⁶Group tumor growth curves the overall tumor size was smaller (FIG. 1), compared to 1X 10⁵The group growth curves are relatively consistent and 5X 10⁵And 1X 10⁶The sizes and growth trends of the tumors in the two groups are consistent. In order to ensure the tumor formation rate of the mice and the survival rate of the tumor-bearing mice in the whole immune cycle and the principle that the inoculation dose is relatively small, 5X 10 is finally selected⁵The subsequent experiments were performed at the cell seeding dose/cell.

1.3 mouse tumor growth inhibition experiment

SPF-grade female BALB/c mice 6-8 weeks old were randomly divided into 2 groups, PBS control group and OVA mRNA group, respectively, and 4 mice per group were injected subcutaneously to form tumors at the optimal dose of CT26 cells determined in 1.2 experiment, on day 0, day 6 and day 13, and immunized intratumorally with PBS (pH 7.4-7.6, concentration 0.01M, 50 μ L/mouse) or OVA mRNA (10 μ g/50 μ L/mouse), respectively. Tumor size was measured every 2-3 days, and tumor volume (length × width × height)/2.

As can be seen from a in fig. 2, OVA mRNA vaccine group tumors grew significantly slower than PBS control group (P < 0.001). After the tumor growth inhibition experiment is finished, the tumors of each group are photographed, and as can be seen from b in fig. 2, the tumors of the OVA mRNA vaccine group are obviously smaller than those of the PBS control group. Tumor weight was weighed and the OVA mRNA group had significantly lighter tumor weight than the PBS control group (c in fig. 2) (P <0.01), indicating that intratumoral injection of OVA mRNA significantly inhibited subcutaneous tumor growth in colon cancer in mice.

And then, the tumor tissue is stored in RNA (ribonucleic acid) storage solution, and after the liquid is discarded in the next day, the tumor tissue is stored at the temperature of minus 80 ℃ and used for a subsequent real-time fluorescent quantitative PCR detection experiment.

1.4 mouse survival Rate experiments

SPF-grade female BALB/c mice 6-8 weeks old are randomly divided into 2 groups, namely a PBS control group and an OVA mRNA group, 5 mice in each group are inoculated with CT26 cells, subcutaneous tumors and immune OVA mRNA according to the method in 1.2, the growth of the tumors and the health state of the mice are observed, and the survival rate is calculated.

As can be seen from fig. 3, the Survival time of the mice in the group of intratumoral immune OVA mRNA was significantly prolonged (P <0.01), Median Survival (Median Survival) was 73 days in the OVA mRNA group, and 54 days in the PBS group, compared to the PBS control group, suggesting that intratumoral immune OVA mRNA could significantly prolong the Survival time of colon cancer mice.

1.5 real-time fluorescent quantitative PCR

And detecting the expression conditions of the cell factors IFN-gamma, TNF-alpha, IL-12, IL-6 and TGF-beta in the tumor tissues by real-time fluorescent quantitative PCR. IFN-gamma and TNF-alpha are used as cytokines secreted by CTL, which is beneficial to T cells to kill tumor cells.

Specifically, total RNA of tumor tissue is extracted by TRIzol methodSuperScript III First-Strand reverse transcriptase was used to obtain cDNA. Use of TB

Premix Ex Taq II (TliRNaseH Plus), ROX Plus, RT-PCR was performed according to the instruction procedures, beta-actin was used as an internal reference. According to the PCR amplification standard program of the StepOneplus Real-Time PCR System two-step method: step1 in Holding Stage was set to 95 ℃ for 30sec, Step1 in Cycling Stage was set to 95 ℃ for 5sec, Step2 was set to 60 ℃ (Tm values were set for different primers) for 30sec, 40 cycles were set, and the system was run after program setup was completed. After the reaction was completed, the dissolution curve, the amplification curve and the corresponding Δ CT values were examined. Calculation 2 Using Excel^–ΔΔCTEach set of experimental data was analyzed and plotted.

As can be seen from FIG. 4, the expression levels of IFN-. gamma.and TNF-. alpha.in the OVA mRNA group tumors were significantly higher than in the PBS group. IL-12 can enhance the effect of active immunotherapy, and compared with the PBS group, the expression level of IL-12 in the OVA mRNA group is obviously increased (P is less than 0.001). IL-6 is a cytokine expressed in the malignant microenvironment, and IL-6 cytokine expression in the OVA mRNA group was slightly lower than that in the PBS group, but the differences were not statistically significant. TGF-beta is also an immunosuppressive cytokine, and compared with the PBS group, the expression level of TGF-beta in the OVA mRNA group is slightly reduced but the difference is not significant (P > 0.05).

1.6 immunofluorescence staining

On day 25 after tumor inoculation, treated mice tumors were fixed in paraformaldehyde for 24 hours and then paraffin sections were prepared. After deparaffinization, antigen retrieval, mounting and the like, blocking and CD8 alpha Monoclonal Antibody 4 ℃ overnight. Alexa for Secondary antibody

647Conjugate dye-labeled anti-rabbit antibodies. Nucleic acids were counterstained with DAPI. Staining images were observed by fluorescence microscopy and quantitative analysis of CD8 in tumor tissue was performed using Image J software randomly selecting 3 or more regions⁺T cells.

The results are shown in FIG. 5, with tumor-infiltrating CD8 in OVA mRNA group⁺T cells were significantly more abundant than PBS group (P < 0.001).

It should be noted that, in this embodiment, the mouse colon cancer CT26 cells do not express OVA antigen, and therefore, OVA mRNA is used as a non-specific immunostimulant or immunomodulator to induce a non-specific immune response generated by a mouse body and enhance a specific immune response, so as to achieve the purpose of treating the mouse colon cancer, and a specific action mechanism needs to be further studied.

The data analysis and mapping in this example used GraphPad Prism software. All data are expressed as mean ± sd, and comparisons between groups are performed using the t-test. Statistical analysis of tumor growth inhibition curves was performed using the Two-way ANOVA method and statistical analysis of survival curves was performed using the log-rank method. P <0.05 the difference was considered statistically significant.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Guizhou medical university

<160> 1

<170> SIPOSequenceListing 1.0

<210> 2

<211> 1161

<212> RNA

<213> Artificial sequence

<400> 2

augggcagca ucggcgccgc cagcauggag uucugcuucg acguguucaa ggagcugaag 60

gugcaccacg ccaacgagaa caucuucuac ugccccaucg ccaucaugag cgcccuggcc 120

augguguacc ugggcgccaa ggacagcacc cggacccaga ucaacaaggu ggugcgguuc 180

gacaagcugc ccggcuucgg cgacagcauc gaggcccagu gcggcaccag cgugaacgug 240

cacagcagcc ugcgggacau ccugaaccag aucaccaagc ccaacgacgu guacagcuuc 300

agccuggcca gccggcugua cgccgaggag cgguacccca uccugcccga guaccugcag 360

ugcgugaagg agcuguaccg gggcggccug gagcccauca acuuccagac cgccgccgac 420

caggcccggg agcugaucaa cagcugggug gagagccaga ccaacggcau cauccggaac 480

gugcugcagc ccagcagcgu ggacagccag accgccaugg ugcuggugaa cgccaucgug 540

uucaagggcc ugugggagaa gaccuucaag gacgaggaca cccaggccau gcccuuccgg 600

gugaccgagc aggagagcaa gcccgugcag augauguacc agaucggccu guuccgggug 660

gccagcaugg ccagcgagaa gaugaagauc cuggagcugc ccuucgccag cggcaccaug 720

agcaugcugg ugcugcugcc cgacgaggug agcggccugg agcagcugga gagcaucauc 780

aacuucgaga agcugaccga guggaccagc agcaacguga uggaggagcg gaagaucaag 840

guguaccugc cccggaugaa gauggaggag aaguacaacc ugaccagcgu gcugauggcc 900

augggcauca ccgacguguu cagcagcagc gccaaccuga gcggcaucag cagcgccgag 960

agccugaaga ucagccaggc cgugcacgcc gcccacgccg agaucaacga ggccggccgg 1020

gagguggugg gcagcgccga ggccggcgug gacgccgcca gcgugagcga ggaguuccgg 1080

gccgaccacc ccuuccuguu cugcaucaag cacaucgcca ccaacgccgu gcuguucuuc 1140

ggccggugcg ugagccccug a 1161

Claims

1. The application of the chicken ovalbumin OVA mRNA in the preparation of non-specific immunostimulants is characterized in that the nucleotide sequence of the chicken ovalbumin OVA mRNA is shown as SEQ ID No. 1.

2. Use of chicken ovalbumin OVA mRNA in the preparation of a non-specific immunostimulant according to claim 1, wherein said non-specific immunostimulant has at least one of the following effects:

(1) up-regulating the expression level of cytokines in tumor tissue;

(2) increase tumor infiltration CD8⁺The number of T cells;

(3) inhibiting tumor growth;

(4) prolonging the survival time of tumor patients.

3. Use of chicken ovalbumin OVA mRNA in the preparation of a non-specific immunostimulant according to claim 2 wherein said tumor is colon cancer.

4. Use of the chicken ovalbumin OVA mRNA in the preparation of a non-specific immunostimulant according to claim 2 wherein said cytokine is selected from at least one of IFN- γ, TNF- α and IL-12.

5. The application of the chicken ovalbumin OVA mRNA in preparing the immunomodulator in the colon cancer tumor is characterized in that the nucleotide sequence of the chicken ovalbumin OVA mRNA is shown as SEQ ID No. 1.

6. The application of the chicken ovalbumin OVA mRNA in preparing the medicine for treating or improving colon cancer is characterized in that the nucleotide sequence of the OVA mRNA is shown as SEQ ID No. 1.

7. The use of ovalbumin OVA mRNA in the preparation of a medicament for the treatment or amelioration of colon cancer according to claim 6 wherein said medicament is in the form of any one of a solid dosage form, a semi-solid dosage form and a liquid dosage form.