CN113337517A

CN113337517A - Method for cultivating corn with efficient nutrient utilization and herbicide tolerance and application

Info

Publication number: CN113337517A
Application number: CN202110578767.2A
Authority: CN
Inventors: 苏乔; 潘越
Original assignee: Dalian University of Technology
Current assignee: Dalian University of Technology
Priority date: 2021-05-26
Filing date: 2021-05-26
Publication date: 2021-09-03

Abstract

The invention discloses a cultivation method and application of transgenic corn with ZmNF-YA13 and bar gene transfer, high-efficiency nutrient utilization and herbicide tolerance, and belongs to the technical field of biology. Constructing ZmNF-YA13 gene and herbicide-tolerant glufosinate ammonium gene bar on an expression vector pTF101 by an agrobacterium-mediated method, transferring the expression vector pTF101 into a corn genome, and screening to obtain the transgenic corn with high nutrient utilization efficiency and herbicide tolerance. The invention can realize the introduction of exogenous gene specificity into corn strains, endows the receptor corn with high-efficiency utilization of nitrogen and potassium nutrition and herbicide-resistant glufosinate-ammonium capability, and provides a new method for high-efficiency breeding.

Description

Method for cultivating corn with efficient nutrient utilization and herbicide tolerance and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a cultivation method and application of corn with high-efficiency nutrient utilization and herbicide tolerance for expressing ZmNF-YA13 gene and bar gene.

Background

Corn is an important food crop and feed crop in China, and is also a crop with high overall yield all over the world, and the planting area and the overall yield of the corn are second to those of rice and wheat. The grain safety and the agricultural production development in China are directly influenced by the high and low yield of the corn and the quality of the economic benefit.

Nitrogen is one of the main nutrients required for maintaining plant growth and development and crop yield, and is an important component of protein, nucleic acid, growth hormone, etc. in plants. Plants absorb inorganic nitrogen (nitrate nitrogen, ammonium nitrogen, etc.) and organic nitrogen (urea, amino acids, etc.) from the outside soil through the roots. Plants lacking nitrogen elements have the phenomena of short and small plants, green and yellow leaves and the like.

Potassium ion (K)⁺) Is an inorganic cation necessary for the plant to complete the life cycle, and can reach 2 to 10 percent of the dry weight of the plant. Plants take up external potassium through the transport system present in the plasma membranes of root epidermal cells and cortical cells. The potassium ions have larger mobility, are transferred along with the transfer of a plant growth center, and are mainly distributed in organs and tissues with most active metabolism, such as sprouts, young leaves, root tips and the like. The potassium deficiency of the plants can cause the phenomena of yellow leaves, plant dwarfing, slow growth, reduced stress resistance and the like.

High yield in corn depends on sufficient potassium and nitrogen supplies, and large quantities of potassium and nitrogen fertilizers are usually required to be input to increase the yield. However, the insufficient self-supply rate of the potash fertilizer in China causes the higher price of the imported potash fertilizer, and the excessive application of the nitrogenous fertilizer causes environmental problems of resource waste, water eutrophication and the like. Therefore, how to breed new varieties of transgenic plants with low potassium and nitrogen tolerance has attracted extensive attention, and becomes an important issue to be researched urgently at present.

Disclosure of Invention

In view of the above, the invention aims to provide a cultivation method and application of herbicide-tolerant corn with high-efficiency nutrient utilization for expressing ZmNF-YA13 gene and bar gene, the corn is obtained by introducing exogenous genes ZmNF-YA13 and bar into corn strain, wherein ZmNF-YA13 is corn NF-Y family transcription factor, the exogenous target gene ZmNF-YA13 is from corn variety Zheng 58, and the open reading frame is 822bp, and encodes a polypeptide consisting of 273 amino acids. The maize plant of over-expression ZmNF-YA13 gene can obviously improve the fresh weight of the overground part and the root of the plant under the condition of nitrogen and potassium with normal concentration; under the condition of low concentration of nitrogen and potassium, the fresh weight of the upper part of the plant is increased. The exogenous marker gene bar is an anti-glufosinate gene from streptomyces hygroscopicus, has a full length of 552bp, encodes glufosinate acetyltransferase PAT, and endows recipient corn with the capability of herbicide tolerance to glufosinate.

The purpose of the invention is realized by the following modes:

the invention provides a transcription factor ZmNF-YA13 for improving the efficient utilization of plant nutrients, and the amino acid sequence of the transcription factor ZmNF-YA13 is shown as SEQ ID No. 8.

In another aspect, the invention provides a gene encoding the transcription factor ZmNF-YA 13.

Based on the technical scheme, further, the nucleotide sequence of the gene is shown in SEQ ID NO. 3.

In another aspect, the present invention provides a recombinant expression vector containing the gene.

Based on the technical scheme, the recombinant expression vector further comprises an exogenous T-DNA gene, the exogenous T-DNA gene comprises a transcription factor gene ZmNF-YA13 and a herbicide-tolerant glufosinate-ammonium gene bar, the nucleotide sequence of the transcription factor gene ZmNF-YA13 is shown in SEQ ID No.3, and the nucleotide sequence of the herbicide-tolerant glufosinate-ammonium gene bar is shown in SEQ ID No. 4.

Based on the technical scheme, further, the nucleotide sequence of the exogenous T-DNA gene is shown as SEQ ID NO. 5.

Based on the technical scheme, the exogenous T-DNA gene contains a transcription factor ZmNF-YA13 gene expression frame for efficiently utilizing nutrients and a herbicide-tolerant glufosinate gene expression frame;

the transcription factor ZmNF-YA13 gene expression frame consists of a corn ZmNubi promoter, a corn transcription factor ZmNF-YA13 and a nos terminator; wherein the ZmUbi promoter has the size of 2022bp, and the nucleotide sequence is shown as SEQ ID NO.6, is a constitutive promoter and can drive the expression of a target gene; the nos terminator is 270bp in size, comes from a nopaline synthase gene terminator in a T-DNA region of an agrobacterium tumefaciens Ti plasmid, and terminates the transcription of the ZmNF-YA13 gene, and the nucleotide sequence is shown as SEQ ID NO. 7.

Based on the technical scheme, the transcription factor ZmNF-YA13 gene has the full length of 1147bp, such as SEQ ID NO.3, the length of 822bp, 273 amino acid-encoding polypeptide and the protein molecular weight of about 29.55kDa, the encoded amino acid sequence is shown as SEQ ID NO.8, the gene is an NF-Y family transcription factor, and the expression of the target gene can be regulated and controlled through the specific combination with a 'CCAAT' frame on a target gene promoter, so that the physiological characters of plants are influenced, and a foundation is laid for cultivating a new nutrient-efficient corn variety.

Based on the technical scheme, the herbicide-resistant glufosinate-ammonium expression frame is composed of a CaMV35S promoter, a herbicide-resistant glufosinate-ammonium gene bar and a TVSP terminator, wherein the size of the CaMV35S promoter is 345bp, the promoter is from cauliflower mosaic virus CaMV and is responsible for starting the expression of the plant herbicide-resistant glufosinate-ammonium gene bar, and the nucleotide sequence is shown as SEQ ID No. 9; the TVSP terminator has the size of 682bp, the bar gene transcription is terminated, and the nucleotide sequence is shown as SEQ ID NO. 10.

Furthermore, the full length of the herbicide-resistant glufosinate-ammonium gene is 552bp, the nucleotide sequence is SEQ ID NO.4, the sequence for coding the formed PAT protein is shown in SEQ ID NO.11, the gene belongs to an acetyltransferase family, the protein molecular weight is about 23kDa, the herbicide glufosinate-ammonium is acetylated, the activity of glufosinate-ammonium is inhibited, and the effect of the herbicide-resistant glufosinate-ammonium is finally achieved.

In another aspect, the present invention provides a recombinant strain containing the recombinant expression vector.

Based on the technical scheme, the strain is agrobacterium tumefaciens EHA 101.

On the other hand, the invention provides the transcription factor ZmNF-YA13, the gene coding the transcription factor ZmNF-YA13, the recombinant expression vector of the gene coding the transcription factor ZmNF-YA13, and the application of the recombinant strain containing the recombinant expression vector in improving the utilization of plant nutrients, in particular to improving the nitrogen and potassium absorption capacity of corn plants, thereby obviously improving the fresh weight of the overground part and the root of the plants under the condition of normal concentration of nitrogen and potassium; under the condition of low concentration of nitrogen and potassium, the fresh weight of the upper part of the plant is increased.

The invention also provides a method for improving nutrient utilization and herbicide tolerance of corn, which comprises the steps of constructing a transcription factor gene ZmNF-YA13 from corn and a herbicide-tolerant glufosinate-ammonium gene bar from streptomyces hygroscopicus on a pTF101 expression vector by an agrobacterium-mediated method, transferring the pTF101 expression vector into a genome of corn HiII, and screening to obtain the transgenic corn with high nutrient utilization efficiency and herbicide tolerance.

Based on the technical scheme, further, the exogenous T-DNA is inserted into chromosome 1 of the corn genome.

Based on the technical scheme, further, the nucleotide sequence of the left flank of the T-DNA is shown as SEQ ID NO.1, and the nucleotide sequence of the right flank of the T-DNA is shown as SEQ ID NO. 2.

Based on the technical scheme, furthermore, the exogenous T-DNA gene is inserted into the corn genome in a single copy mode.

In another aspect, the present invention provides a method for identifying said nutrient efficient and herbicide tolerant transgenic corn, comprising:

(1) extracting genomic DNA from a corn sample to be identified;

(2) the extracted DNA sample is taken as a template, and PCR fragment amplification of exogenous target genes ZmNF-YA13 and marker genes bar is carried out on NP1 and NP2 by using the primer provided by the invention;

(3) detecting the PCR amplification product, if the length of the amplification product is consistent with the theoretical length between the sequences of the PCR primer pair on the transformation event, indicating that the sample is a positive sample of the corn transformation event NY 1.

Based on the technical scheme, further, primers (NP3 is used for detecting whether the left side of the exogenous gene is connected with the corn genome specific site, NP4 is used for detecting whether the right side of the exogenous gene is connected with the corn genome specific site) of the method are as follows:

based on the technical scheme, further, the PCR reaction system is as follows:

and (3) PCR reaction conditions:

according to another aspect of the invention, a method for cultivating glufosinate-ammonium tolerant corn plants with efficient nutrient utilization is provided, and the transgenic corn plants are hybridized with corn breeding materials to obtain progeny of the corn plants with efficient nutrient utilization and glufosinate-ammonium tolerance.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a corn which is excellent in expression of ZmNF-YA13 gene and bar gene, has high-efficiency utilization of nutrients and is herbicide-tolerant, a cultivation method and application thereof, the cultivation method can realize the specific introduction of exogenous genes into corn strains, endows receptor corn with the function of improving the nitrogen and potassium absorption capacity at the same time, and has the capability of herbicide-tolerant glufosinate; the transcription factor ZmNF-YA13 and the glufosinate-resistant gene bar can be stably inherited in the receptor corn; overexpression of transcription factors can improve the physiological function of maize receptors.

Drawings

In order to more clearly illustrate the embodiments of the present invention, the drawings to which the embodiments relate will be briefly described below.

FIG. 1 is a schematic representation of a plant expression vector for maize transformation;

FIG. 2 Agrobacterium-mediated transformation of maize plants for the formation of (A: co-culture; B: screening; C: differentiation; D: regenerated shoots);

FIG. 3 PCR assay of transgenic maize plants (A: Fragment-ZmNF-YA 13; B: Fragment-bar), wherein,

m: DL 2000; h: ddH 2O; WT: a wild-type control; p: plasmid pTF101-ZmNF-YA 13-Bar;

1: transgenic maize NY 1;

FIG. 4 PCR detection of the first filial generation of transgenic maize NY1 (A: Fragment-ZmNF-YA 13; B: Fragment-bar);

wherein, M: DL 2000; h: ddH 2O; WT: a wild-type control; p: plasmid pTF101-ZmNF-YA 13-Bar;

1: a first hybrid of transgenic maize NY1 with PH6 WC;

FIG. 5 RT-PCR detection of different tissue organs of transgenic maize NY1 hybrid first seedling stage (A: RNA electrophoretogram;

b, Fragment-ZmNF-YA 13; fragment-bar), wherein M: DL 2000; h: ddH 2O; WT: a wild-type control; 1. 2, 3, 4, respectively represent root, stem, leaf and seed;

FIG. 6 bar test strip assay of transgenic maize NY1 first hybrid, wherein WT: a wild type corn; 1: a first hybrid generation of NY1 with PH6 WC;

FIG. 7 is a schematic diagram of the insertion site of the T-DNA region of transgenic maize NY 1;

FIG. 8 specific PCR assay of transgenic maize NY1 transformants (A: NP 3; B: NP4), wherein M: DL 2000; h: ddH 2O; WT: comparison; 1: transgenic corn NY1 first hybrid;

FIG. 9 fresh weight determination of transgenic maize NY1 hybrid generation and wild type after 3 weeks of normal and low nitrogen treatment;

FIG. 10 fresh weight determination of transgenic maize NY1 first hybrid and wild type after 4 weeks of normal and low potassium treatment;

FIG. 11 expression analysis of nitrogen transport related genes (ZmNRTT 1.1, ZmNRTT 2.1, ZmNRTT 2.2) in maize roots overexpressing ZmNF-YA13 gene.

Detailed Description

The present invention is described in detail below with reference to examples, but the embodiments of the present invention are not limited thereto, and it is obvious that the examples in the following description are only some examples of the present invention, and it is obvious for those skilled in the art to obtain other similar examples without inventive exercise and falling into the scope of the present invention.

Example 1 acquisition of transgenic maize

1. Construction of maize expression vectors

The plant expression vector of the research is pTF101-ZmNF-YA13-Bar, and the map is shown in figure 1, wherein the nucleotide sequence of the T-DNA gene is shown in SEQ ID NO.5, the sequence comprises a complete transcription factor ZmNF-YA13 expression frame and a glufosinate-resistant expression frame, and the plant expression vector specifically comprises the following parts:

transcription factor ZmNF-YA13 expression cassette: consists of a corn ZmUbi promoter (the nucleotide sequence is shown as SEQ ID NO. 6), an exogenous gene ZmNF-YA13 (the nucleotide sequence is shown as SEQ ID NO. 3) and a nos terminator (the nucleotide sequence is shown as SEQ ID NO. 7). Herbicide tolerant glufosinate expression cassette: consists of a CaMV35S promoter (the nucleotide sequence is shown in SEQ ID NO. 9), a herbicide-resistant glufosinate-ammonium gene bar (the nucleotide sequence is shown in SEQ ID NO. 4) and a TVSP terminator (the nucleotide sequence is shown in SEQ ID NO. 10). The herbicide-tolerant glufosinate-ammonium expression frame is connected with the transcription factor ZmNF-YA13 expression frame and is jointly inserted into the framework vector pTF101, so that pTF101-ZmNF-YA13-Bar is constructed.

In the research, a target gene is recombined with a linearized vector pTF101 plant expression vector by using a seamless cloning method.

(1) Obtaining coding region of ZmNF-YA13 Gene

The primer sequence is as follows:

ZmNF-YA13-S：5’-GGATCCAACAGCCCCATGCTTCTTCCCTCTTCGTCTTC-3’

ZmNF-YA13-35s-A：5’-TTCGAGCTCGCTGTTTCATCTCATAACTGGAACCCTAT-3’

and (4) recovering products after PCR reaction.

(2) Obtaining of Linear plant expression vector pTF101-ubi

Firstly, strain activation

Escherichia coli containing the plant expression vector pTF101-ubi was stored at-80 ℃ in a super-low temperature refrigerator and taken out, streaked on LB solid medium containing 100mg/L spectinomycin, and cultured overnight at 37 ℃. A single colony is picked up and placed in LB liquid culture medium containing 100mg/L spectinomycin, and cultured for 12-16h at 37 ℃ at 180 rpm.

Extraction of pTF101-ubi plasmid

Escherichia coli plasmid was extracted using a small extraction kit for crude SanPrep column plasmid DNA.

Acquisition of pTF101-ubi Linear plasmid

The pTF101-ubi plasmid was digested with SmaI and SpeI restriction enzymes.

The enzyme digestion system is as follows:

the mixture was incubated at 37 ℃ for 6 hours for digestion.

The cleavage products were detected by 1% Agarose Gel electrophoresis and recovered using the MiniBEST Agarose Gel DNA Extraction Kit ver.3.0 DNA recovery Kit.

Obtaining of corn expression vector ubi ZmNF-YA13

Adding the recovered and purified linearized vector fragment and the ZmNF-YA13 gene fragment into a ligation reaction solution according to the molar ratio of 1:2, wherein the reaction system is as follows:

reaction conditions are as follows:

50℃ 15min。

selecting positive clones, and carrying out PCR detection on the bacteria liquid by using promoter primers and target gene primers (ubi-F and ZmNF-YA13-35 s-A).

The primer sequences are as follows:

ubi-F：5’-ATATGTGGATTTTTTTAGCCCTGCC-3’；

ZmNF-YA13-35s-A:5’-TTCGAGCTCGCTGTTTCATCTCATAACTGGAACCCTAT-3’。

TABLE 1 pTF101-ZmNF-YA13-Bar vector Main element information Table

2. Transforming maize young embryo with agrobacterium to obtain transformed plant

Selecting maize young embryos pollinated for 9-11d as explants for transformation, infecting the young embryos by using an EHA101 strain containing pTF101-ubi-ZmNF-YA13 plasmid, placing the infected young embryos in a co-culture solid culture medium with the scutellum facing upwards, and enabling the young embryos surviving for 3d to have the phenomena of large volume, hard texture and the like; transferring the surviving immature embryos into a recovery culture medium for culturing for 7 days, and transferring the immature embryos in good growth states into a screening culture medium, wherein the screening period is 14 days; after two rounds of screening, the surviving immature embryos can form II type callus, the II type callus is fluffy and grows into a plurality of tiny branches similar to 'matchsticks' (if no callus is formed, the screening rounds can be properly lengthened); under the aseptic condition, dividing the resistant callus into small blocks by using tweezers, culturing in a regeneration I culture medium, and growing milky embryoid after 2 weeks; selecting embryoid with good growth, transferring the embryoid into a regeneration II culture medium, and culturing for about 2 weeks under illumination to grow a regeneration seedling; when the regenerated seedlings grow to about 20cm, the regenerated seedlings are planted in soil to complete the transformation process (see figure 2).

The specific process is as follows:

(1) extraction of recombinant plasmid

Coli containing the recombinant plasmid ubi: ZmNF-YA13 was cultured for 12 hours at 37 ℃ on a shaker at 180 rpm. Escherichia coli plasmid was extracted using a small extraction kit for crude SanPrep column plasmid DNA.

(2) Preparation of Agrobacterium competence

The agrobacterium EHA101 strain is kept in an ultra-low temperature refrigerator at minus 80 ℃ and taken out. Streaking on YEP solid medium containing 50mg/L kanamycin and 50mg/L rifampicin, and culturing in 28 deg.C incubator for 48 h;

② selecting single colony to inoculate in YEP liquid culture medium containing kanamycin and rifampicin, and culturing overnight at 28 ℃ and 180 rpm;

thirdly, inoculating the shaken bacterial liquid into YEP culture medium without antibiotics according to the proportion of 1:100, and culturing the bacterial liquid at 28 ℃ and 180rpm until the bacterial liquid is OD₆₀₀ 0.3-0.5；

Fourthly, placing the bacterial liquid in an ice-water mixture for ice bath for 30min, then centrifuging for 10min at the temperature of 4 ℃ and the speed of 4000rpm, and removing supernatant;

fifthly, adding 4mL of 20mM ice bath-cooled CaCl into the obtained thallus precipitate₂Resuspending the solution, centrifuging at 4000rpm at 4 ℃ for 10min, and discarding the supernatant;

sixthly, adding 1mL of 20mM CaCl in ice bath into the thallus precipitate₂The solution was resuspended, an equal volume of 50% glycerol was added, and the solution was dispensed into 1.5mL centrifuge tubes, 200. mu.L per tube. Quick freezing in liquid nitrogen, and storing in a-80 deg.C ultra-low temperature refrigerator.

(3) Transformation of Agrobacterium

Transformation of Agrobacterium by freezing and thawing method

Firstly, putting agrobacterium tumefaciens competent cells on ice for unfreezing, adding 1-2 mu g of plasmid DNA after the competent cells are thawed, and gently mixing uniformly;

② carrying out ice bath on the mixture for 30min, carrying out quick freezing in liquid nitrogen for 1min, carrying out water bath at 37 ℃ for 5min, adding YEP liquid culture medium to complement to 1mL, and slowly culturing in a shaking table at 28 ℃ for 4-5 h;

thirdly, sucking 200 mu L of bacterial liquid, uniformly coating the bacterial liquid on a YEP solid culture medium containing 50mg/L kanamycin, 100mg/L spectinomycin and 50mg/L rifampicin, centrifuging the residual bacterial liquid at 5000rpm for 3min, discarding 600 mu L of supernatant, resuspending the bacterial liquid, coating the bacterial liquid on the same culture medium, and inversely culturing the bacterial liquid in a constant-temperature incubator at 28 ℃ for 36h until a single bacterial colony grows out;

fourthly, single colonies were picked up and cultured overnight in a shaker at 180rpm at 28 ℃ in 1mL YEP medium containing 50mg/L kanamycin, 100mg/L spectinomycin and 50mg/L rifampicin.

(4) PCR detection of agrobacterium liquid

Taking 1 mu L of bacterial liquid as a PCR template, and carrying out bacterial liquid PCR detection by using a primer pair NP2 on the carrier and a target gene primer pair NP 1. Selecting a colony with positive PCR detection, preparing agrobacterium tumefaciens bacteria according to the ratio of the bacteria liquid to the glycerol of 1:1, and storing the agrobacterium tumefaciens bacteria in an ultra-low temperature refrigerator at minus 80 ℃ for later use.

TABLE 2 culture media for corn transformation

3. PCR detection of transformed plants

(1) Corn DNA extraction (Rapid plant genome DNA extraction reagent purchased from Tiangen corporation)

Firstly, taking 100mg of fresh corn leaf tissue to be placed at the bottom of a 2mL centrifuge tube, adding small steel balls subjected to high-temperature sterilization, and freezing for 15-20min by using liquid nitrogen;

secondly, taking out the centrifugal tube from the liquid nitrogen, putting the centrifugal tube into an oscillator to oscillate for 1min violently, and crushing the leaf tissue;

③ taking out the small steel ball in the centrifuge tube, adding 400 mu L of buffer solution FP1 and 6 mu L of RNase A (10mg/mL), carrying out vortex oscillation for 1min, and standing for 10min at room temperature;

adding 130 mu L of buffer solution FP2, fully and uniformly mixing, and carrying out vortex oscillation for 1 min;

fifthly, centrifuging at 12,000rpm for 5min, and transferring the supernatant into a new 1.5mL centrifuge tube;

sixthly, repeating the step (the step aims at removing the precipitated impurities in the supernatant to ensure that the purity of the extracted genome DNA is higher);

adding 0.7 volume times of isopropanol (such as 500 μ L of the supernatant and 350 μ L of isopropanol) into the supernatant, mixing well, centrifuging at 12,000rpm for 2min, discarding the supernatant, and retaining the precipitate;

adding 600 mul of 70% ethanol, carrying out vortex oscillation for 5sec, centrifuging at 12,000rpm for 2min, and discarding the supernatant, wherein the step needs to be repeated once;

ninthly, uncovering and inverting, and completely airing residual ethanol at room temperature for 5-10 min;

adding a proper amount of elution buffer TE into the red (R) saline, dissolving DNA in water bath at 65 ℃ for 10-60min, and reversely and uniformly mixing the solution for several times to help the dissolution to finally obtain a DNA solution.

(2) Primers for PCR detection

The detection primer pair NP1 sequence of the exogenous target gene ZmNF-YA13 is as follows:

F:5’-AACTCCTTTGGGAAAACCGT-3’，

R:5’-TTGCGGGACTCTAATCATAAAAACC-3’；

the size of the target fragment is 943 bp.

The sequence of a detection primer pair NP2 of the exogenous marker gene bar is as follows:

F:5′-ACCATCGTCAACCACTACATCG-3，

R:5′-GCTGCCAGAAACCCACGTCAT-3；

the size of the target fragment is 430 bp.

(3) And (3) PCR reaction system:

(4) and (3) PCR reaction conditions:

the PCR amplification product (10 ul loading PCR product) was detected by 1% agarose gel electrophoresis.

As can be seen from FIG. 3, the lengths of the PCR fragments of the foreign gene and the marker gene of the transgenic maize plant were consistent with those of the plasmid positive control (plasmid pTF101-ubi-ZmNF-YA13), while no amplified band appeared in the negative control (wild type WT). The result shows that the exogenous target gene ZmNF-YA13 and the marker gene bar are integrated into the corn genome. The PCR result of the first filial generation of the transgenic corn (see figure 4) shows that the exogenous target gene ZmNF-YA13 and the marker gene bar can be stably inherited.

Example 2: RT-PCR detection of transgenic corn NY1 first filial generation

1. Extraction of RNA from various tissues and organs of corn (RNAioso Plus kit)

(1) Putting a certain amount of fresh plant tissue material into liquid nitrogen, grinding the fresh plant tissue material into powder in the liquid nitrogen, quickly putting the powder into a centrifugal tube which is precooled by ice and contains 1mL of Trizol reagent, uniformly oscillating the powder, and standing the powder for 10min at room temperature to fully crack the plant tissue.

(2) Add 200. mu.L of chloroform, slowly reverse and mix well, after standing at room temperature for 5min, centrifuge at 12000rpm for 15 min.

(3) And sucking 500 mu L of the supernatant into a new centrifuge tube, adding isopropanol with the same volume, reversing, uniformly mixing, standing at room temperature for 10min, and centrifuging at 4 ℃ and 12000rpm for 15 min.

(4) The supernatant was discarded, 1mL of a pre-cooled 75% ethanol solution was added, the RNA pellet was washed with shaking, and centrifuged at 8000rpm at 4 ℃ for 10 min.

(5) Repeat step 4 once.

(6) The supernatant was discarded, blown dry in a clean bench and dissolved in 20. mu.L of DEPC water.

(7) mu.L of the solution was taken, subjected to purity analysis and concentration measurement using Nanodrop2000c, and RNA was quantified to 500 ng/. mu.L.

(8) The extracted RNA was detected by electrophoresis on a 1.5% agarose gel.

2. Obtaining of Single-stranded cDNA

Reverse transcription reactions were performed according to the PrimeScriptTM RT reagent Kit with the g DNA Eraser (Perfect Real Time) Kit instructions.

The reverse transcription system is as follows:

corn Total RNA 2. mu.L

5×gDNA Eraser Buffer 2μL

RNase free water Up to 10μL

Reaction conditions are as follows:

42 ℃ 2min (this step is to fully degrade the genomic DNA)

Adding the following components into the reaction solution:

reaction conditions are as follows:

37℃ 15min

85℃ 5s

4℃ ∞

3.RT-PCR

the cDNA obtained by the reverse transcription is used as a template, and primers on ZmNF-YA13 and bar gene are used for RT-PCR reaction.

The primer sequences, PCR reaction system and conditions were as above.

The result shows (see figure 5), the exogenous target gene ZmNF-YA13 and the marker gene bar are stably expressed in the corn root, stem, leaf and seed.

Example 3: bar test strip detection of transgenic corn NY1 first filial generation

Selecting leaf area of about 1cm²The fresh corn leaf of (1.5) mL was placed at the bottom of a centrifuge tube, 500. mu.L of EB2 Extraction Buffer was added to the tube, the corn leaf was ground to a homogenized state using a grinding rod, a bar strip was inserted in the correct direction, and the strip was observed after standing for 1-2 min. The presence of two bands (detection band and target band) indicates that the bar protein is expressed; if only one test band appears, it indicates that no bar protein is expressed.

The results are shown in FIG. 6, and it can be seen that the bar gene was successfully expressed at the protein level.

Example 4: analysis of flanking sequence of transgenic maize NY1 and transformant-specific PCR

1. Analysis of flanking sequences

Extracting genome DNA of transgenic corn in two leaf periods, cloning a flanking sequence of a ZmNF-YA13 gene insertion site by using an anchored PCR method by using the DNA as a template to obtain a corn genome DNA sequence (shown in SEQ ID NO. 1) of about 800bp, designing a primer NP3 on the basis of the sequence for PCR verification, wherein the size of a target fragment is 1081bp, carrying out BLAST comparison analysis on the sequence in a corn database (http:// www.maizegdb.org /), and indicating that the flanking sequence is positioned on a corn No.1 chromosome and the ZmNF-YA13 gene is integrated on the corn No.1 chromosome.

According to the bioinformatics analysis and prediction of the flanking sequence, the other side sequence of the insertion site is obtained, and a primer NP4 is designed to carry out PCR amplification by using the DNA of the transgenic maize NY1 genome as a template in combination with a vector sequence, so that a fragment of about 500bp is obtained. About 500bp flanking sequence (shown in SEQ ID NO. 2) is obtained after sequencing analysis.

2. Transformant specific PCR assay

Specific PCR detection of transformants was performed by designing a specific primer pair NP3 on the TVSP terminator sequence and the left maize genomic sequence, and a specific primer pair NP4 (see FIG. 7) on the NOS terminator sequence and the right maize genomic sequence.

The primers were designed as follows:

primer name	Upstream primer sequence	Sequence of downstream primer	Size of product
				NP3	GCCACTCGGTCCATCAAAAC	GGCATGACGTGGGTTTCT	1081bp
NP4	CGGTCTTGCGATGATTAT	CAAGGCTGGGAAGGCACT	500bp

As can be seen from FIG. 8, the maize transformant NY1 amplified the band of interest, while the negative control (wild-type WT) did not. The results indicate that the foreign gene has integrated into the maize genome and is capable of stable inheritance. Meanwhile, the primer pair NP3 and NP4 can be used as a specific primer of the corn transformant NY1 to specifically identify the corn transformant NY 1.

Example 5: liquid culture experiment of transgenic corn NY1

1. Low nitrogen liquid culture experiment for corn

7500 μ M (normal nitrogen) and 750 μ M (low nitrogen) nitrogen concentration nutrient solutions were prepared, respectively. Selecting and transferring 30 transgenic corn plants and wild plants which are cultured normally for 20 days in 1/2hoagland nutrient solution and have consistent sizes into the nutrient solution with the two concentrations, culturing for 4w until obvious nitrogen deficiency symptoms appear, harvesting, keeping ventilation for 24h, replacing the nutrient solution every three days, and adjusting the pH value of the nutrient solution to 6.0 every day. And after the harvested corn seedlings are taken out of the nutrient solution, repeatedly cleaning the corn seedlings by using single distilled water to remove the nutrient solution remained on the surfaces of the plants, sucking water on the surfaces of the corn seedlings, harvesting the overground parts and the roots of the corn seedlings, and weighing the fresh weight of the corn seedlings respectively.

As can be seen from FIG. 9, it was found that the amount of NO was 7500. mu.M₃ ^-Under the concentration, the fresh weight of the overground part and the root of the transgenic corn is obviously higher than that of the wild type; at 750. mu.M NO₃ ^-At concentrations, the fresh weight of the upper part of the transgenic maize was significantly higher than the wild type. Therefore, the over-expression of the ZmNF-YA13 gene can improve the absorption of nitrogen nutrition of the corn.

2. Low potassium liquid culture experiment for corn

100 mu M (low potassium) and 3000 mu M (normal potassium) potassium ion concentration nutrient solutions are prepared respectively. And selecting 1/2hoagland nutrient solution, normally culturing 30 transgenic corn plants and wild plants with the same size for 20 days, and transferring the transgenic corn plants and the wild plants into the nutrient solution with the two concentrations. Culturing for 4w until obvious potassium deficiency symptoms appear (the leaves are yellow, the bottom leaves begin to appear symptoms first, the leaves start to spread downwards from the leaf tips, and the leaf tips are burned), and then harvesting. Keeping 24h ventilation, changing the nutrient solution every three days, and adjusting the pH value of the nutrient solution to 6.0 every day. And after the harvested corn seedlings are taken out of the nutrient solution, repeatedly cleaning the corn seedlings by using single distilled water to remove the nutrient solution remained on the surfaces of the plants, sucking water on the surfaces of the corn seedlings, harvesting the overground parts and the roots of the corn seedlings, and weighing the fresh weight of the corn seedlings respectively.

As can be seen from FIG. 10, the temperature was 3000. mu. M K⁺And 100 μ M K⁺At the concentration, the fresh weight of the transgenic corn is obviously higher than that of the wild type. Therefore, the over-expression of the ZmNF-YA13 gene can improve the absorption of potassium nutrition of corn.

Example 6: expression analysis of nitrogen transport related genes (ZmNRTT 1.1, ZmNRTT 2.1, ZmNRTT 2.2) in ZmNF-YA13 gene transferred corn

1. Extraction of corn root RNA

See example 2 for methods.

2. Obtaining of Single-stranded cDNA

See example 2 for methods.

3. Real-time quantitative fluorescent PCR reaction

Using cDNA diluted by 10 times as template for fluorescent quantitative PCR, the reaction system is as follows:

PCR amplification is carried out by adopting a two-step method:

reaction conditions are as follows:

by using 2-^ΔΔCTThe method of (1), wherein EF-1-alpha is used as an internal reference gene. Setting the expression level of wild corn root nitrogen transport related genes (ZmNRT1.1, ZmNRT2.1 and ZmNRT2.2) as 1, and calculating the relative expression level of each nitrogen transport related gene (ZmNRT1.1, ZmNRT2.1 and ZmNRT2.2) of corn root with ZmNF-YA13 gene. Each template contained three replicates, and both wild-type and transgenic maize lines contained three biological replicates. The significance analysis was performed using the method of T-test.

As can be seen from FIG. 11, compared with the wild type, the expression level of ZmNF-YA13 gene-transferred maize root nitrogen transport related genes (ZmNRTT 1.1, ZmNRTT 2.1, ZmNRTT 2.2) is significantly improved. Therefore, the increase of the expression level of the gene related to root nitrogen transport of the transgenic line is supposed to promote the improvement of the nitrogen absorption capacity of the corn.

Finally, it should be noted that: it will be apparent to those skilled in the art from this disclosure that many changes and modifications can be made, or equivalents modified, in the embodiments of the invention without departing from the scope of the invention. Therefore, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention shall still fall within the protection scope of the technical solution of the present invention, unless the contents of the technical solution of the present invention are departed.

SEQUENCE LISTING

<110> university of Large Community

<120> method for cultivating corn with efficient nutrient utilization and herbicide tolerance and application

<130> 20210514

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 513

<212> DNA

<213> Artificial sequence

<400> 1

tttgtccata gcatgaagtt cctccaccat catcatcaag ccacttgatc aaaagcccag 60

atcaacacat gtcttgataa ttctataatg atatgatcca ctccatgtta tcacatggcc 120

ttcttggttc atcaatctca acatagcttg atcttcaccg ttgctttatg tccatcggtg 180

ctaagtcctt gctcttgctt caccgccacg cggtccctca cacatgagcc tttgacttgc 240

ccttcacact agccactcgg tccatcaaaa ccaagccata tctcttgatc ttctccatat 300

agccacatga caccatgtca tgtcttcata tgcaatgagc tcctttatca cactagttga 360

gcatctccat atcaccaagc cacatcacca ccatggctaa aataactcac actagtgtac 420

ctgtggacta atcacctgtg tatctcaaca taaacactta ttagtccata taagttgtca 480

atcaattacc aaaaccaaac agggtctcac aat 513

<210> 2

<211> 500

<212> DNA

<213> Artificial sequence

<400> 2

catacctgtt cgttgccgga gaaggatacg acgaagacct gggcatctag agacgacata 60

ggtagtatat cgctagatat atagggaaag agcacgcaag cggagaaaga agccagccgg 120

agcagctcca aaccgagagg cacccgcacc aggcgtcagt ccgagaaagg cgagagaata 180

tgagtgcctt cccagccttg gacccgccga agcgacacac caccacaacc aactccgtag 240

catataccga ctgttgccac gctacgggcc ttggttgtcc agtatctcag atttggactc 300

ctcatcgaca agataaccta agcgtggcag gcgccaccat gtcgtcctcg acggcacaca 360

cggacaaagg ccaggagtat gaccgactcg ccccataccc acgtcgacga gcgtccgtcg 420

gctcgtggct gcgatcgtgg gcaggggcag caggttgggg aggaaaacaa cgtgaaggcc 480

aggaagacga acgggacgtc 500

<210> 3

<211> 822

<212> DNA

<213> Artificial sequence

<400> 3

atgcttcttc cctcttcgtc ttccgcttcc gcttccgctt ccgcttccaa aggtaactcc 60

tttgggaaaa ccgttaacga tcatctgagg tcaactttga gttttgataa caagcaacct 120

ccatttgcaa gtcaaaactt tgactacggt caaacaatag cttgcatttc atacccgtac 180

aatcgttcta gatcaggaga tgtttgggca gcctatgagt cacgcaccag cactgccact 240

gtgttccgtt cccaaattgc tggtgggggt tcatccacaa gaattccctt gcctttggaa 300

ttagcagaga atgaacccat atatgtgaat cccaaacaat atcacgggat acttcgcaga 360

agacagttac gtgccaagtt agaggttcag aacaagctag tcagagcccg aaagccttac 420

cttcatgagt ctaggcatct tcatgcaatg aagagggcac gaggttccgg tggacgattc 480

ctcaacacta agcagctcca gcagtctcac accgccctca ccaggtccac caccacaagt 540

ggcacaagct cctcaggctc aactcatctg cggcttggtg gtggcgcagc cgcagctgga 600

gatcgatctg tgctggcacc caaaacaatg gtctcacaag acagtagcaa gaaggccgtt 660

tcttcagccc tcgccttcac tgcgactcca atgctgcgca gagatgacgg cttcttgcag 720

cacccaagcc atcttttcag tttttctggt cattttgggc aggcaagcgc gcaagctggc 780

gttcataatg gaagtcagca tagggttcca gttatgagat ga 822

<210> 4

<211> 552

<212> DNA

<213> Artificial sequence

<400> 4

atgagcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcg 60

gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg 120

caggaaccgc aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc 180

gtcgccgagg tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc 240

aacgcctacg actggacggc cgagtcgacc gtgtacgtct ccccccgcca ccagcggacg 300

ggactgggct ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag 360

agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc 420

ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac 480

gtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc 540

accgagattt ga 552

<210> 5

<211> 5915

<212> DNA

<213> Artificial sequence

<400> 5

cgccgaattg ctctagcatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt 60

gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa ggcgattaag 120

ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgccaagct 180

aattcgcttc aagacgtgct caaatcacta tttccacacc cctatatttc tattgcactc 240

ccttttaact gttttttatt acaaaaatgc cctggaaaat gcactccctt tttgtgtttg 300

tttttttgtg aaacgatgtt gtcaggtaat ttatttgtca gtctactatg gtggcccatt 360

atattaatag caactgtcgg tccaatagac gacgtcgatt ttctgcattt gtttaaccac 420

gtggatttta tgacatttta tattagttaa tttgtaaaac ctacccaatt aaagacctca 480

tatgttctaa agactaatac ttaatgataa caattttctt ttagtgaaga aagggataat 540

tagtaaatat ggaacaaggg cagaagattt attaaagccg cggtaagaga caacaagtag 600

gtacgtggag tgtcttaggt gacttaccca cataacataa agtgacatta acaaacatag 660

ctaatgctcc tatttgaata gtgcatatca gcatacctta ttacatatag ataggagcaa 720

actctagcta gattgttgag cagatctcgg tgacgggcag gaccggacgg ggcggtaccg 780

gcaggctgaa gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc ttgaagccgg 840

ccgcccgcag catgccgcgg ggggcatatc cgagcgcctc gtgcatgcgc acgctcgggt 900

cgttgggcag cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc agggacttca 960

gcaggtgggt gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg gagacgtaca 1020

cggtcgactc ggccgtccag tcgtaggcgt tgcgtgcctt ccaggggccc gcgtaggcga 1080

tgccggcgac ctcgccgtcc acctcggcga cgagccaggg atagcgctcc cgcagacgga 1140

cgaggtcgtc cgtccactcc tgcggttcct gcggctcggt acggaagttg accgtgcttg 1200

tctcgatgta gtggttgacg atggtgcaga ccgccggcat gtccgcctcg gtggcacggc 1260

ggatgtcggc cgggcgtcgt tctgggctca tggtagatcc cccgttcgta aatggtgaaa 1320

attttcagaa aattgctttt gctttaaaag aaatgattta aattgctgca atagaagtag 1380

aatgcttgat tgcttgagat tcgtttgttt tgtatatgtt gtgttgagaa ttaattctcg 1440

aggtcctctc caaatgaaat gaacttcctt atatagagga agggtcttgc gaaggatagt 1500

gggattgtgc gtcatccctt acgtcagtgg agatatcaca tcaatccact tgctttgaag 1560

acgtggttgg aacgtcttct ttttccacga tgctcctcgt gggtgggggt ccatctttgg 1620

gaccactgtc ggtagaggca tcttgaacga tagcctttcc tttatcgcaa tgatggcatt 1680

tgtaggagcc accttccttt tccactatct tcacaataaa gtgacagata gctgggcaat 1740

ggaatccgag gaggtttccg gatattaccc tttgttgaaa agtctcaatt gccctttggt 1800

cttctgagac tgtatctttg atatttttgg agtagacaag tgtgtcgtgc tccaccatgt 1860

tatcacatca atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc 1920

tcctcgtggg tgggggtcca tctttgggac cactgtcggc agaggcatct tcaacgatgg 1980

cctttccttt atcgcaatga tggcatttgt aggagccacc ttccttttcc actatcttca 2040

caataaagtg acagatagct gggcaatgga atccgaggag gtttccggat attacccttt 2100

gttgaaaagt ctcaattgcc ctttggtctt ctgagactgt atctttgata tttttggagt 2160

agacaagtgt gtcgtgctcc accatgttga cctgcaggca tgcaagcttg catgcctgca 2220

gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 2280

taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 2340

atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 2400

gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 2460

ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 2520

caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 2580

gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 2640

ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt agatataaaa 2700

tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 2760

aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 2820

ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 2880

cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 2940

ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 3000

gcggcctcct cctcctctca cggcaccggc agctacgggg gattcctttc ccaccgctcc 3060

ttcgctttcc cttcctcgcc cgccgtaata aatagacacc ccctccacac cctctttccc 3120

caacctcgtg ttgttcggag cgcacacaca cacaaccaga tctcccccaa atccacccgt 3180

cggcacctcc gcttcaaggt acgccgctcg tcctcccccc ccccccctct ctaccttctc 3240

tagatcggcg ttccggtcca tggttagggc ccggtagttc tacttctgtt catgtttgtg 3300

ttagatccgt gtttgtgtta gatccgtgct gctagcgttc gtacacggat gcgacctgta 3360

cgtcagacac gttctgattg ctaacttgcc agtgtttctc tttggggaat cctgggatgg 3420

ctctagccgt tccgcagacg ggatcgattt catgattttt tttgtttcgt tgcatagggt 3480

ttggtttgcc cttttccttt atttcaatat atgccgtgca cttgtttgtc gggtcatctt 3540

ttcatgcttt tttttgtctt ggttgtgatg atgtggtctg gttgggcggt cgttctagat 3600

cggagtagaa ttaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 3660

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 3720

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 3780

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 3840

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 3900

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 3960

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 4020

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 4080

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 4140

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 4200

ttacttctgc aggtcgactc tagaggatcc aacagcccca tgcttcttcc ctcttcgtct 4260

tccgcttccg cttccgcttc cgcttccaaa ggtaactcct ttgggaaaac cgttaacgat 4320

catctgaggt caactttgag ttttgataac aagcaacctc catttgcaag tcaaaacttt 4380

gactacggtc aaacaatagc ttgcatttca tacccgtaca atcgttctag atcaggagat 4440

gtttgggcag cctatgagtc acgcaccagc actgccactg tgttccgttc ccaaattgct 4500

ggtgggggtt catccacaag aattcccttg cctttggaat tagcagagaa tgaacccata 4560

tatgtgaatc ccaaacaata tcacgggata cttcgcagaa gacagttacg tgccaagtta 4620

gaggttcaga acaagctagt cagagcccga aagccttacc ttcatgagtc taggcatctt 4680

catgcaatga agagggcacg aggttccggt ggacgattcc tcaacactaa gcagctccag 4740

cagtctcaca ccgccctcac caggtccacc accacaagtg gcacaagctc ctcaggctca 4800

actcatctgc ggcttggtgg tggcgcagcc gcagctggag atcgatctgt gctggcaccc 4860

aaaacaatgg tctcacaaga cagtagcaag aaggccgttt cttcagccct cgccttcact 4920

gcgactccaa tgctgcgcag agatgacggc ttcttgcagc acccaagcca tcttttcagt 4980

ttttctggtc attttgggca ggcaagcgcg caagctggcg ttcataatgg aagtcagcat 5040

agggttccag ttatgagatg accggtttgc gaaccatagc tggtgatcca ggcgtctagg 5100

gtcaacttcg ctgtggtgtc ttagtctctc aggcaattca tccttggctt aatttctggc 5160

tttttattag aaggtaccaa aatgtgttcc ataccgttgt ggccacagag cccataaacc 5220

agggggtttg atggttggca ctcctaccca aactattgtt gcagtggtgt ttgttagaat 5280

aaaccttgac tattattctg tacaatttgc ctttatcttg tactgccaac agcgagctcg 5340

aatttccccg atcgttcaaa catttggcaa taaagtttct taagattgaa tcctgttgcc 5400

ggtcttgcga tgattatcat ataatttctg ttgaattacg ttaagcatgt aataattaac 5460

atgtaatgca tgacgttatt tatgagatgg gtttttatga ttagagtccc gcaattatac 5520

atttaatacg cgatagaaaa caaaatatag cgcgcaaact aggataaatt atcgcgcgcg 5580

gtgtcatcta tgttactaga tcgggaattc gtaatcatgt catagctgtt tcctgtgtga 5640

aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa gtgtaaagcc 5700

tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact gcccgctttc 5760

cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc ggggagaggc 5820

ggtttgcgta ttggagcttg agcttggatc agattgtcgt ttcccgcctt cagtttaaac 5880

tatcagtgtt tgacaggata tattggcggg taaac 5915

<210> 6

<211> 2020

<212> DNA

<213> Artificial sequence

<400> 6

agcttgcatg cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag ataatgagca 60

ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt gtttgaagtg 120

cagtttatct atctttatac atatatttaa actttactct acgaataata taatctatag 180

tactacaata atatcagtgt tttagagaat catataaatg aacagttaga catggtctaa 240

aggacaattg agtattttga caacaggact ctacagtttt atctttttag tgtgcatgtg 300

ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt ttattagtac 360

atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt acatctattt 420

tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt ttttatttaa 480

taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa taccctttaa 540

gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc cagcctgtta 600

aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg cgtcgggcca 660

agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg agagttccgc 720

tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga gcggcagacg 780

tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct acgggggatt 840

cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata gacaccccct 900

ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca accagatctc 960

ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct cccccccccc 1020

ccctctctac cttctctaga tcggcgttcc ggtccatggt tagggcccgg tagttctact 1080

tctgttcatg tttgtgttag atccgtgttt gtgttagatc cgtgctgcta gcgttcgtac 1140

acggatgcga cctgtacgtc agacacgttc tgattgctaa cttgccagtg tttctctttg 1200

gggaatcctg ggatggctct agccgttccg cagacgggat cgatttcatg attttttttg 1260

tttcgttgca tagggtttgg tttgcccttt tcctttattt caatatatgc cgtgcacttg 1320

tttgtcgggt catcttttca tgcttttttt tgtcttggtt gtgatgatgt ggtctggttg 1380

ggcggtcgtt ctagatcgga gtagaattaa ttctgtttca aactacctgg tggatttatt 1440

aattttggat ctgtatgtgt gtgccataca tattcatagt tacgaattga agatgatgga 1500

tggaaatatc gatctaggat aggtatacat gttgatgcgg gttttactga tgcatataca 1560

gagatgcttt ttgttcgctt ggttgtgatg atgtggtgtg gttgggcggt cgttcattcg 1620

ttctagatcg gagtagaata ctgtttcaaa ctacctggtg tatttattaa ttttggaact 1680

gtatgtgtgt gtcatacatc ttcatagtta cgagtttaag atggatggaa atatcgatct 1740

aggataggta tacatgttga tgtgggtttt actgatgcat atacatgatg gcatatgcag 1800

catctattca tatgctctaa ccttgagtac ctatctatta taataaacaa gtatgtttta 1860

taattatttt gatcttgata tacttggatg atggcatatg cagcagctat atgtggattt 1920

ttttagccct gccttcatac gctatttatt tgcttggtac tgtttctttt gtcgatgctc 1980

accctgttgt ttggtgttac ttctgcaggt cgactctaga 2020

<210> 7

<211> 270

<212> DNA

<213> Artificial sequence

<400> 7

gaatttcccc gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc 60

cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg taataattaa 120

catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata 180

catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc 240

ggtgtcatct atgttactag atcgggaatt 270

<210> 8

<211> 273

<212> PRT

<213> Artificial sequence

<400> 8

Met Leu Leu Pro Ser Ser Ser Ser Ala Ser Ala Ser Ala Ser Ala Ser

1 5 10 15

Lys Gly Asn Ser Phe Gly Lys Thr Val Asn Asp His Leu Arg Ser Thr

20 25 30

Leu Ser Phe Asp Asn Lys Gln Pro Pro Phe Ala Ser Gln Asn Phe Asp

35 40 45

Tyr Gly Gln Thr Ile Ala Cys Ile Ser Tyr Pro Tyr Asn Arg Ser Arg

50 55 60

Ser Gly Asp Val Trp Ala Ala Tyr Glu Ser Arg Thr Ser Thr Ala Thr

65 70 75 80

Val Phe Arg Ser Gln Ile Ala Gly Gly Gly Ser Ser Thr Arg Ile Pro

85 90 95

Leu Pro Leu Glu Leu Ala Glu Asn Glu Pro Ile Tyr Val Asn Pro Lys

100 105 110

Gln Tyr His Gly Ile Leu Arg Arg Arg Gln Leu Arg Ala Lys Leu Glu

115 120 125

Val Gln Asn Lys Leu Val Arg Ala Arg Lys Pro Tyr Leu His Glu Ser

130 135 140

Arg His Leu His Ala Met Lys Arg Ala Arg Gly Ser Gly Gly Arg Phe

145 150 155 160

Leu Asn Thr Lys Gln Leu Gln Gln Ser His Thr Ala Leu Thr Arg Ser

165 170 175

Thr Thr Thr Ser Gly Thr Ser Ser Ser Gly Ser Thr His Leu Arg Leu

180 185 190

Gly Gly Gly Ala Ala Ala Ala Gly Asp Arg Ser Val Leu Ala Pro Lys

195 200 205

Thr Met Val Ser Gln Asp Ser Ser Lys Lys Ala Val Ser Ser Ala Leu

210 215 220

Ala Phe Thr Ala Thr Pro Met Leu Arg Arg Asp Asp Gly Phe Leu Gln

225 230 235 240

His Pro Ser His Leu Phe Ser Phe Ser Gly His Phe Gly Gln Ala Ser

245 250 255

Ala Gln Ala Gly Val His Asn Gly Ser Gln His Arg Val Pro Val Met

260 265 270

Arg

<210> 9

<211> 345

<212> DNA

<213> Artificial sequence

<400> 9

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg tagaggcatc ttgaacgata gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctca 345

<210> 10

<211> 682

<212> DNA

<213> Artificial sequence

<400> 10

gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 60

cgacgttgta aaacgacggc cagtgccaag ctaattcgct tcaagacgtg ctcaaatcac 120

tatttccaca cccctatatt tctattgcac tcccttttaa ctgtttttta ttacaaaaat 180

gccctggaaa atgcactccc tttttgtgtt tgtttttttg tgaaacgatg ttgtcaggta 240

atttatttgt cagtctacta tggtggccca ttatattaat agcaactgtc ggtccaatag 300

acgacgtcga ttttctgcat ttgtttaacc acgtggattt tatgacattt tatattagtt 360

aatttgtaaa acctacccaa ttaaagacct catatgttct aaagactaat acttaatgat 420

aacaattttc ttttagtgaa gaaagggata attagtaaat atggaacaag ggcagaagat 480

ttattaaagc cgcggtaaga gacaacaagt aggtacgtgg agtgtcttag gtgacttacc 540

cacataacat aaagtgacat taacaaacat agctaatgct cctatttgaa tagtgcatat 600

cagcatacct tattacatat agataggagc aaactctagc tagattgttg agcagatctc 660

ggtgacgggc aggaccggac gg 682

<210> 11

<211> 183

<212> PRT

<213> Artificial sequence

<400> 11

Met Ser Pro Glu Arg Arg Pro Ala Asp Ile Arg Arg Ala Thr Glu Ala

1 5 10 15

Asp Met Pro Ala Val Cys Thr Ile Val Asn His Tyr Ile Glu Thr Ser

20 25 30

Thr Val Asn Phe Arg Thr Glu Pro Gln Glu Pro Gln Glu Trp Thr Asp

35 40 45

Asp Leu Val Arg Leu Arg Glu Arg Tyr Pro Trp Leu Val Ala Glu Val

50 55 60

Asp Gly Glu Val Ala Gly Ile Ala Tyr Ala Gly Pro Trp Lys Ala Arg

65 70 75 80

Asn Ala Tyr Asp Trp Thr Ala Glu Ser Thr Val Tyr Val Ser Pro Arg

85 90 95

His Gln Arg Thr Gly Leu Gly Ser Thr Leu Tyr Thr His Leu Leu Lys

100 105 110

Ser Leu Glu Ala Gln Gly Phe Lys Ser Val Val Ala Val Ile Gly Leu

115 120 125

Pro Asn Asp Pro Ser Val Arg Met His Glu Ala Leu Gly Tyr Ala Pro

130 135 140

Arg Gly Met Leu Arg Ala Ala Gly Phe Lys His Gly Asn Trp His Asp

145 150 155 160

Val Gly Phe Trp Gln Leu Asp Phe Ser Leu Pro Val Pro Pro Arg Pro

165 170 175

Val Leu Pro Val Thr Glu Ile

180

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

aactcctttg ggaaaaccgt 20

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence

<400> 13

ttgcgggact ctaatcataa aaacc 25

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence

<400> 14

accatcgtca accactacat cg 22

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

gctgccagaa acccacgtca t 21

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

gccactcggt ccatcaaaac 20

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence

<400> 17

ggcatgacgt gggtttct 18

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence

<400> 18

cggtcttgcg atgattat 18

<210> 19

<211> 18

<212> DNA

<213> Artificial sequence

<400> 19

caaggctggg aaggcact 18

Claims

1. A gene of a transcription factor ZmNF-YA13 for improving the efficient utilization of plant nutrients is coded, and is characterized in that the amino acid sequence of the transcription factor ZmNF-YA13 is shown as SEQ ID NO. 8.

2. A recombinant expression vector comprising the gene of claim 1.

3. The recombinant expression vector according to claim 2, wherein the recombinant expression vector comprises an exogenous T-DNA sequence, wherein the exogenous T-DNA comprises the transcription factor ZmNF-YA13 gene and herbicide-tolerant glufosinate-ammonium bar, the nucleotide sequence of the transcription factor ZmNF-YA13 gene is shown as SEQ ID No.3, and the nucleotide sequence of the herbicide-tolerant glufosinate-ammonium bar is shown as SEQ ID No. 4.

4. The recombinant expression vector of claim 3, wherein the exogenous T-DNA sequence comprises a transcription factor ZmNF-YA13 gene expression cassette for efficient nutrient utilization and a herbicide-tolerant glufosinate gene expression cassette;

the transcription factor ZmNF-YA13 gene expression frame consists of a corn ZmNubi promoter, a corn transcription factor ZmNF-YA13 gene and a nos terminator;

the herbicide-tolerant glufosinate-ammonium expression box consists of a CaMV35S promoter, a herbicide-tolerant glufosinate-ammonium gene bar and a TVSP terminator.

5. The recombinant expression vector according to claim 3 or 4, wherein the nucleotide sequence of the exogenous T-DNA is shown in SEQ ID No. 5.

6. A recombinant strain comprising the recombinant expression vector of any one of claims 2-5.

7. Use of the gene of claim 1, the recombinant expression vector of any one of claims 2 to 5, the recombinant strain of claim 6 for increasing nutrient utilization in plants.

8. A method for improving nutrient utilization and herbicide tolerance of corn is characterized in that the gene and herbicide tolerance glufosinate-ammonium gene bar of claim 1 are constructed on an expression vector pTF101 by an agrobacterium-mediated method, the expression vector pTF101 is transferred into a corn genome, and transgenic corn with high nutrient utilization efficiency and herbicide tolerance is obtained by screening.

9. The method of claim 8, wherein the exogenous T-DNA of the expression vector is inserted in a single copy into chromosome 1 of the maize genome.

10. A method for breeding a nutrient-efficient and herbicide-tolerant glufosinate plant, comprising crossing the transgenic corn plant obtained by the method of claim 8 or 9 with a corn breeding material to obtain a nutrient-efficient and herbicide-tolerant progeny.