CN113332297A - Application of compound 25-HL in preparing medicament for treating skin injury - Google Patents
Application of compound 25-HL in preparing medicament for treating skin injury Download PDFInfo
- Publication number
- CN113332297A CN113332297A CN202110685009.0A CN202110685009A CN113332297A CN 113332297 A CN113332297 A CN 113332297A CN 202110685009 A CN202110685009 A CN 202110685009A CN 113332297 A CN113332297 A CN 113332297A
- Authority
- CN
- China
- Prior art keywords
- ointment
- wound
- compound
- skin
- medicament
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/575—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/44—Oils, fats or waxes according to two or more groups of A61K47/02-A61K47/42; Natural or modified natural oils, fats or waxes, e.g. castor oil, polyethoxylated castor oil, montan wax, lignite, shellac, rosin, beeswax or lanolin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Dermatology (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of a compound 25-HL in preparing a medicine for treating skin injury, belonging to the technical field of biology. The invention discovers that the compound 25-HL (25-hydroxymanosterol) can cause weakening of macrophage M1-like polarization in skin injury and concomitant enhancement of polarization to M2-like phenotype, namely, the inflammation can be promoted to be converted to a repair phenotype, and meanwhile, the expression of related genes up-regulated by the 25-HL can promote epithelialization, angiogenesis and myofibroblast-induced wound contraction to accelerate the healing of epidermis and dermis and promote tissue repair. Therefore, the compound 25-HL has the effect of promoting wound healing and can be used for preparing the medicine for treating skin injury. The invention provides a new medicine for treating skin injury.
Description
Technical Field
The invention relates to the technical field of biology, in particular to application of a compound 25-HL in preparation of a medicine for treating skin injury.
Background
Wound repair is a complex, highly regulated physiological and biochemical process by the body. Three major phases are involved, the inflammatory response phase, the cell proliferation phase and the tissue remodeling phase. It is a highly coordinated, ordered, integrated and networked process. The entire wound healing process is accompanied by an inflammatory response, not just in the initial phase of wound healing. Both too strong and too weak inflammatory responses are detrimental to wound repair. Therefore, a patient's strong immune resistance is critical to the efficacy and quality of wound tissue repair. Lymphocytes, macrophages and neutrophils appear in a certain order at different stages of wound repair and are all important cells involved in the inflammatory process of wound tissue repair.
SREBP has been shown to exert an effect on immune cells through the production of cholesterol pathway intermediates, cholesterol itself and cholesterol-derived oxysterol. A common aspect of the foregoing mechanisms is that sterols mediate the effect of SREBP on immune function by altering membrane lipid composition affecting signaling or stress response or by binding to specific cellular receptors. Recent studies have shown that SREBP2 forms a trivalent complex with SCAP and NLRP3 that relies primarily on translocation of its endoplasmic reticulum to the golgi apparatus for optimal inflammasome assembly to regulate activation of inflammatory factors and production of interleukin-1 (IL-1). Inhibition of SREBP activity in macrophages leads to increased expression of certain genes encoding proteins that promote inflammatory repair by acting on endothelial cells and myofibroblasts and possibly through additional mechanisms. Local inhibition of SREBP activity can accelerate wound healing under steady state and chronic inflammatory conditions. Acceleration of epidermal and dermal healing by promoting epithelialization, angiogenesis and myofibroblast-induced wound contraction is effected by a transcriptional mechanism that is independent of its role in cholesterol metabolism.
Betulin (Betulin) is an inhibitor of the currently known SREBP. The molecular formula of betulin is: c30H50O2With pentacyclic structure and hydroxyl groups at C3 and C28, mainly present in shrubs and trees, are the main extracts of birch bark (up to 30% of dry weight). Betulinol can promote the mutual binding effect of SCAP and insight by combining SCAP, specifically inhibit SCAP-SREBP2 activation, thereby leading SREBP to be retained on endoplasmic reticulum, blocking the maturation of SREBP, and down-regulating the synthesis genes of cholesterol and fatty acid, thereby reducing the level of cell lipid. Betulin canEffectively reduces endogenous n-SREBP-1 and n-SREBP-2, and inhibits SREBP activity under the condition of not activating LXR. At the same time, betulin does not accelerate degradation of HMGCR. Betulin reduces cholesterol and TG levels and increases insulin sensitivity to improve hyperlipidemia, and it can also prevent atherosclerosis in LDLR gene knockout mice, and has a broad anti-tumor effect, and in addition, betulin is also an effective drug for accelerating wound healing because local inhibition of SREBP activity can accelerate wound healing under steady-state and chronic inflammatory conditions.
Disclosure of Invention
The invention aims to provide application of a compound 25-HL in preparing a medicament for treating skin injury.
The purpose of the invention is realized by the following technical scheme:
the invention determines that the inhibition of the 25-HL on the SREBP activity can accelerate the healing of the skin wound by comparing the healing speed of the skin wound of the mouse treated by the control group and the 25-HL, the histological analysis of the skin wound, the immunohistochemical analysis of the skin wound, the gene expression condition analysis of the wound tissue and the like. 25-HL causes attenuation of macrophage M1-like polarization in skin wounds, and concomitant enhancement of polarization to M2-like phenotype, i.e., can promote transformation of inflammation to repair phenotype, and can up-regulate expression of certain genes to promote epithelialization, angiogenesis and myofibroblast-induced wound contraction to accelerate healing of epidermis and dermis and promote tissue repair by 25-HL treatment. Therefore, the compound 25-HL or the pharmaceutically acceptable salt or ester thereof can be used for preparing the medicines for treating the skin injury.
The compound 25-HL (25-hydroxymanosterol) is a derivative of lanosterol, is a novel SREBP inhibitor, and has the following structural formula:
a medicament for treating skin injury, comprising said compound 25-HL or a pharmaceutically acceptable salt or ester thereof, and further comprising a pharmaceutically acceptable carrier or excipient thereof.
The medicament for treating skin injury can be an ointment, which comprises the compound 25-HL and a carrier ointment. Preferably, the mass ratio of the compound 25-HL to the carrier ointment is 1: 9. Preferably, the carrier ointment consists of vaseline and sunflower seed oil, and the mass ratio of the vaseline to the sunflower seed oil is preferably 1: 1.
When the medicine for treating skin injury is an ointment, the medicine is prepared by a method comprising the following steps: mixing vaseline and oleum Helianthi at a mass ratio of 1: 1 to obtain carrier ointment, and mixing 25-HL powder and carrier ointment at a mass ratio of 1: 9 to obtain ointment for treating skin injury.
The skin lesions include: physical injury such as incised wound, contused wound, burn, frostbite, burn, mechanical injury and chemical injury.
The invention has the beneficial effects that: the present invention provides a novel inhibitor of SREBP, which has a function of promoting wound healing. The invention provides a new medicine for treating skin injury.
Drawings
FIG. 1 is a graph showing the results of wound healing in mouse skin. Two symmetrical holes were drilled on both sides of the midline of the skin on the back of the mice with a 5 mm diameter punch, and the application of the corresponding drugs was started the next day after the treatment of the wounds (after 24 hours), and the corresponding drugs were applied twice by cotton swab dipping at fixed time points every day while the changes in the wounds were recorded.
(A) Respectively smearing carrier ointment and 25-HL ointment on the left and right wounds on the back of a KM mouse, and taking representative time-shift pictures of the wounds after healing for 7 days;
(B) smearing carrier ointment and Betulin (Betulin) ointment on left and right wounds on the back of a KM mouse respectively, and taking representative time-lapse pictures of wound healing for 7 days;
(C) wound area recovery within 7 days for control and 25-HL groups (n ═ 6, p <0.0001by two-way ANOVA);
(D) wound area recovery within 7 days for control and Betulin (Betulin) groups (n ═ 6, p <0.0001by two-way ANOVA).
FIG. 2 is a graph of the results of immunohistochemical analysis of skin wounds in mice.
(A) Representative images of hematoxylin-eosin staining on day 7 after skin trauma in mice (n ═ 3 independent experimental mice, back skin of mice were smeared with vehicle ointment and 25-HL ointment, respectively);
(B) representative images of immunohistochemical staining of CD31 on wound sections on day 7 after skin trauma in mice (n ═ 3 independent experimental mice, back skin of mice smeared with vehicle ointment and 25-HL ointment, respectively);
(C) representative images of wound sections SMA immunohistochemical staining on day 7 after skin trauma in mice (n ═ 3 independent experimental mice, back skin of mice were smeared with vehicle ointment and 25-HL ointment, respectively);
(D) representative images of hematoxylin-eosin staining on day 7 after skin trauma in mice (n ═ 3 independent experimental mice, back skin of mice were smeared with vehicle ointment and betulin ointment, respectively);
(E) representative images of immunohistochemical staining of CD31 on wound sections on day 7 after skin trauma in mice (n-3 independent experimental mice, with vehicle ointment and betulin ointment applied to the skin of the back of the mice, respectively);
(F) representative images of SMA immunohistochemical staining of wound sections on day 7 after skin trauma in mice (n ═ 3 independent experimental mice, back skin of mice were smeared with vehicle ointment and betulin ointment, respectively).
FIG. 3 is a graph showing the gene expression in the skin tissue of a mouse wound.
(A) qRT-PCR analysis of cholesterol pathway-related gene expression in day 7 control and wound tissue of mice coated with 25-HL ointment (n-4 independent experimental mice);
(B) qRT-PCR analysis of the expression of inflammation-related genes in the day 7 control group and in the wound tissue of mice coated with 25-HL ointment (n-4 independent experimental mice);
(C) qRT-PCR analysis of macrophage polarization-related gene expression in day 7 control group and mice wound tissue smeared with 25-HL ointment (n-4 independent experimental mice);
(D) qRT-PCR analysis of the expression of tissue repair-related genes in the day 7 control group and in the wound tissue of mice smeared with 25-HL ointment (n-4 independent experimental mice);
*p<0.05，**p<0.01，***p<0.001，****p<0.0001，by two-way ANOVA。
FIG. 4 is a graph showing the gene expression in the skin tissue of the wound of a mouse.
(A) qRT-PCR analysis of cholesterol pathway-related gene expression in wound tissue of day 7 control group and mice applied with betulin ointment (n-4 independent experimental mice);
(B) qRT-PCR analysis of the expression of inflammation-related genes in wound tissue of day 7 control group and mice applied with betulin ointment (n-4 independent experimental mice);
(C) qRT-PCR analysis of macrophage polarization-related gene expression in day 7 control group and mice wound tissue smeared with betulin ointment (n-4 independent experimental mice);
(D) qRT-PCR analysis of the expression of tissue repair-related genes in the day 7 control group and the wound tissue of mice applied with betulin ointment (n-4 independent experimental mice);
*p<0.05，**p<0.01，***p<0.001，****p<0.0001，by two-way ANOVA。
Detailed Description
The following examples are intended to further illustrate the invention but should not be construed as limiting it. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1
First, experiment method
1. Preparation of experimental ointment
Mixing vaseline and sunflower seed oil at a mass ratio of 1: 1 to prepare carrier ointment. For the preparation of SREBP inhibitor pharmaceutical ointment, Betulin (Betulin) powder and 25-HL powder were mixed with carrier ointment at a mass ratio of 1: 9, respectively. The powders were mixed into the ointment using a T10 digital disperser (IKA) until the ointment was thoroughly mixed and stored at 4 ℃.
2. Wound treatment
NaS with the concentration of 5% is prepared2And (3) solution. Mice were anesthetized with isoflurane prior to surgical procedures. The mice were then shaved for their back hair using a razor and dipped in 5% NaS using cotton2Wiping the skin on the back of the mouse with the solution, staying for about 5 minutes, and adding NaS2The solution can be wiped off to remove hair thoroughly (to avoid the influence of the ointment on the left and right sides, the hair on the midline of the back is retained for blocking). Two holes, which are symmetrical, were drilled on both sides of the midline of the skin on the back of the mouse using a 5 mm diameter punch.
3. Smearing ointment
30 mice were divided into two groups of 15 mice each. The betulin group and 25-HL group were tested separately. The following day after treatment of the wound (after 24 hours), application of the drug was started and the corresponding drug was dipped twice with a cotton swab at fixed time points each day.
4. Wound recording
The diameter of the wound of the mouse is measured once every day at a fixed time by a digital caliper, the data is recorded in an Excel format (the major diameter and the minor diameter are measured respectively because the wound is not a regular circle, and the wound area is calculated according to the oval area calculation rule), meanwhile, the wound of the mouse is photographed once every day, and a mark of 2 cm is used as a reference point in all the photographs.
Second, experimental results
Dividing 30 female KM mice of 12 weeks old into two groups, each group comprises 15 mice, 25-HL group (group A) is coated with vehicle ointment of control group (left side) and 25-HL ointment (right side); the betulin group (group B) was applied with the vehicle ointment of the control group (left side) and the betulin ointment (right side). The skin wounds of the experimental mice are measured, calculated and photographed every day, and the statistical results show that (figures 1A and 1B), 25-HL and betulin are used as the SREBP inhibitor, the SREBP inhibitor has a promoting effect on the healing of the skin wounds, the wound recovery speed of the SREBP inhibitor coated with the 25-HL and betulin ointment is higher than that of the carrier ointment of the control group, the sizes of the wound apertures of the control group and the experimental group are obviously different in the later period of the wound healing, and the wounds of the experimental group are obviously smaller than those of the control group. The results of the measurement and calculation of the wound area of the skin show that the wound recovery rate of the mice coated with the 25-HL and the betulin ointment is faster than that of the control group (fig. 1C and 1D), and the promotion effect of the 25-HL and the betulin on the wound healing process is proved.
Example 2
To investigate the role of 25-HL in the process of skin wound tissue formation, the skin around the wound was excised and stained for histological sections, and hematoxylin-eosin staining and CD31 and SMA immunohistochemical staining were performed, respectively, on the seventh day after the trauma of the experimental mice in example 1.
Histological analysis showed that wound healing and re-epithelialization were faster with 25-HL and betulin treated wounds compared to the control group (fig. 2A and 2D). CD31 is a transmembrane glycoprotein and is a ligand of CD38, and plays an important role in thrombus formation and angiogenesis. CD31 is expressed in large amounts in vascular endothelial cells, slightly weakly in macrophages and platelets, and occasionally in lymphocytes (particularly peripheral T cells and mantle B cells), neutrophils, osteoclasts, and plasma cells. Immunohistochemical staining of the endothelial marker CD31 showed that at day 7, the tissue formation zone had extensive staining with CD31 and a portion of the CD31 positive region began to form elongated and branched structures resembling the capillary system in wounds treated with 25-HL and betulin (fig. 2B and 2E). In contrast, the wound tissue sections of the mouse control group were stained positive for CD31 only at the wound margins on day 7, with some positive cells staining as singlet, indicating that they are in the initial stage of angiogenesis (fig. 2B and 2E), i.e. 25-HL and betulin accelerate angiogenesis and maturation. Another event defining granulation tissue formation is myofibroblast-mediated wound contraction. Smooth muscle actin Staining (SMA) markers myofibroblasts in healing skin tissue (SMA)+) Staining of wound tissue sections treated with 25-HL and betulin showed (fig. 2C and 2F) that most of the myofibroblasts were spindle-shaped, similar to mature myofibroblasts, and oriented parallel to the direction of migration of the miglating cells, which ultimately contributed to the contraction of the horizontal wound. In contrast, a portion of the myofibroblasts of the control mice were roundedShape, orientation was more arbitrary, indicating that myofibroblasts differentiated more primitive (fig. 2C and 2F).
The above results indicate that inhibition of SREBP function by 25-HL and betulin accelerates epidermal and dermal healing by promoting epithelialization, angiogenesis and myofibroblast-induced wound contraction.
Example 3
Since effective skin wound healing depends on the balance and transformation from inflammatory response to reparative macrophage phenotype, this example performed qRT-PCR experiments on wound tissue at the seventh day after the trauma of experimental mice in example 1 to analyze gene expression in control and skin tissue coated with SREBP inhibitor 25-HL and betulin.
TABLE 1 primers used for qRT-PCR
| Gene | Upstream primer | Downstream primer |
| Dhcr24 | CTCTGGGTGCGAGTGAAGG | TTCCCGGACCTGTTTCTGGAT |
| Ldlr | GAAGGCAGCTACAAGTGTGAG | GGGGAGCAGACTGGTGTACT |
| Cxcl10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
| Il1b | AGCTTCCTTGTGCAAGTGTCT | GACAGCCCAGGTCAAAGGTT |
| NOS2 | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC |
| Retnla | CCAATCCAGCTAACTATCCCTCC | ACCCAGTAGCAGTCATCCCA |
| Arg1 | TTTTTCCAGCAGACCAGCTT | AGAGATTATCGGAGCGCCTT |
| Chil3 | CAGGTCTGGCAATTCTTCTGAA | GTCTTGCTCATGTGTGTAAGTGA |
| Mrc1 | CTCTGTTCAGCTATTGGACGC | CGGAATTTCTGGGATTCAGCTTC |
| Cd163 | ATCCTCGGGGGTCATTCAGA | GCCTGGGCTCTTGTTCCATT |
| Vegfa | CTGTGCAGGCTGCTGTAACG | GTTCCCGAAACCCTGAGGAG |
| Tgfb1 | TTTTTCCAGCAGACCAGCTT | AGAGATTATCGGAGCGCCTT |
| 18s | AGTCCCTGCCCTTTGTACACA | CGATCCGAGGGCCTCACTA |
On day 7 after skin trauma, mouse skin tissue samples were taken and subjected to qPCR analysis, and the results showed that wound tissue cells treated with 25-HL and betulin had reduced expression of cholesterol pathway genes (Dhcr24, Ldlr) compared to the control group (fig. 3A and 4A), and that expression of the standard SREBP target gene Dhcr24 in wound cells was relatively reduced, thereby confirming inhibition of SREBP function. Wound tissue cells treated with 25-HL and betulin had reduced expression of inflammatory genes (Cxcl10, Il1B, NOS2) compared to the control group (fig. 3B and 4B). Consistent with the reduction in classical inflammatory responses, the expression of M (IL-4) genes, such as Retnla, Arg1, Chil3, Mrc1 and Cd163, of macrophages in wound tissue cells treated with 25-HL and betulin was increased compared to the control group, i.e. macrophages in wound tissue treated with 25-HL and betulin exhibited more M2-like repair phenotype (fig. 3C and 4C). These results support that treatment with 25-HL and betulin promotes expression of Vegfa (vascular endothelial growth factor a) and Tgfb1 (transforming growth factor β 1) in wound tissue cells, and the proteins encoded by these genes promote inflammatory repair by acting on endothelial cells and myofibroblasts and possibly through additional mechanisms (fig. 3D and 4D). Taken together, the inhibitor of SREBP, 25-HL, shifts the balance from inflammation to reparative polarization. These results confirm the function of 25-HL in regulating macrophage polarization balance and opening therapeutic pathways that promote wound healing, including healing of chronic inflammation-related wounds.
To summarize: although an early transient inflammatory response is essential for skin wound healing, a long lasting inflammatory response inhibits the healing process. The invention determines that the inhibition of the 25-HL on the SREBP activity can accelerate the healing of the skin wound by comparing the healing speed of the skin wound of the mouse treated by the control group and the 25-HL, the histological analysis of the skin wound, the immunohistochemical analysis of the skin wound, the gene expression condition analysis of the wound tissue and the like, and has great significance for treating unhealed or chronic inflammatory wound. 25-HL causes attenuation of macrophage M1-like polarization in skin wounds, and concomitant enhancement of polarization to the M2-like phenotype, i.e., can promote transformation of inflammation to a repair phenotype, while expression of certain genes upregulated by 25-HL treatment can promote epithelialization, angiogenesis and myofibroblast-induced wound contraction to accelerate healing of epidermis and dermis, promoting tissue repair.
Sequence listing
<110> Wuhan university
Application of <120> compound 25-HL in preparation of medicine for treating skin injury
<160> 26
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctctgggtgc gagtgaagg 19
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttcccggacc tgtttctgga t 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gaaggcagct acaagtgtga g 21
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccaagtgctg ccgtcatttt c 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggctcgcagg gatgatttca a 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agcttccttg tgcaagtgtc t 21
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gttctcagcc caacaataca aga 23
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gtggacgggt cgatgtcac 19
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccaatccagc taactatccc tcc 23
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
agagattatc ggagcgcctt 20
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
caggtctggc aattcttctg aa 22
<210> 16
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gtcttgctca tgtgtgtaag tga 23
<210> 17
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ctctgttcag ctattggacg c 21
<210> 18
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cggaatttct gggattcagc ttc 23
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcctgggctc ttgttccatt 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
agagattatc ggagcgcctt 20
<210> 25
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
agtccctgcc ctttgtacac a 21
<210> 26
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
cgatccgagg gcctcacta 19
Claims (9)
1. Use of compound 25-HL or a pharmaceutically acceptable salt or ester thereof in the manufacture of a medicament for the treatment of skin damage, wherein: the structural formula of the compound 25-HL is as follows:
2. a medicament for treating skin lesions, comprising: comprising the compound 25-HL or a pharmaceutically acceptable salt or ester thereof as claimed in claim 1.
3. The medicament for treating skin lesion according to claim 2, characterized in that: also comprises a pharmaceutically acceptable carrier or excipient of the compound 25-HL.
4. A medicament for the treatment of skin lesions according to claim 3, characterized in that: the medicament is an ointment comprising compound 25-HL and a carrier ointment.
5. The medicament for treating skin lesion according to claim 4, characterized in that: the mass ratio of the compound 25-HL to the carrier ointment is 1: 9.
6. The medicament for treating skin lesion according to claim 4, characterized in that: the carrier ointment is composed of vaseline and sunflower seed oil.
7. The medicament for treating skin lesion according to claim 6, characterized in that: the mass ratio of the vaseline to the sunflower seed oil is 1: 1.
8. A medicament for the treatment of skin lesions according to any one of claims 4 to 7, characterized in that: prepared by a process comprising the steps of: mixing vaseline and oleum Helianthi at a mass ratio of 1: 1 to obtain carrier ointment, and mixing compound 25-HL powder and carrier ointment at a mass ratio of 1: 9 to obtain ointment for treating skin injury.
9. The use according to claim 1 or the medicament according to any one of claims 2 to 8, wherein: the skin injury includes physical injury, mechanical injury and chemical injury.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110685009.0A CN113332297B (en) | 2021-06-21 | 2021-06-21 | Application of compound 25-HL in preparation of medicine for treating skin injury |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110685009.0A CN113332297B (en) | 2021-06-21 | 2021-06-21 | Application of compound 25-HL in preparation of medicine for treating skin injury |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113332297A true CN113332297A (en) | 2021-09-03 |
| CN113332297B CN113332297B (en) | 2022-07-12 |
Family
ID=77478409
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110685009.0A Active CN113332297B (en) | 2021-06-21 | 2021-06-21 | Application of compound 25-HL in preparation of medicine for treating skin injury |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113332297B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060252733A1 (en) * | 2005-04-07 | 2006-11-09 | Novelix Pharmaceuticals, Inc. | Betulin, betulin derivatives, betulinic acid and betulinic acid derivatives as novel therapeutics in the treatment of disease of lipid and/or glucose metabolism |
| CN109833319A (en) * | 2017-11-29 | 2019-06-04 | 清华大学 | Application of the compound in prevention and treatment metabolic disease |
| CN110437140A (en) * | 2019-07-16 | 2019-11-12 | 中国人民解放军总医院 | It is a kind of inhibit SREBP-1 target spot compound and its application |
-
2021
- 2021-06-21 CN CN202110685009.0A patent/CN113332297B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060252733A1 (en) * | 2005-04-07 | 2006-11-09 | Novelix Pharmaceuticals, Inc. | Betulin, betulin derivatives, betulinic acid and betulinic acid derivatives as novel therapeutics in the treatment of disease of lipid and/or glucose metabolism |
| CN109833319A (en) * | 2017-11-29 | 2019-06-04 | 清华大学 | Application of the compound in prevention and treatment metabolic disease |
| CN110437140A (en) * | 2019-07-16 | 2019-11-12 | 中国人民解放军总医院 | It is a kind of inhibit SREBP-1 target spot compound and its application |
Non-Patent Citations (3)
| Title |
|---|
| ANTHONY KUSNADI等: ""The Cytokine TNF Promotes Transcription Factor SREBP Activity and Binding to Inflammatory Genes to Activate Macrophages and Limit Tissue Repair"，Anthony Kusnadi等，《Immunity》，第51卷，第2期，第241-257页", 《IMMUNITY》 * |
| CHUANSHENG GUO等: "Cholesterol Homeostatic Regulator SCAP-SREBP2 Integrates NLRP3 Inflammasome Activation and Cholesterol Biosynthetic Signaling in Macrophages", 《IMMUNITY》 * |
| IKUYA SAGIMORI等: ""Luciferase-based HMG-CoA reductase degradation assay for activity and selectivity profiling of oxy(lano)sterols"，Ikuya Sagimori等，《Bioorganic & Medicinal Chemistry》，第28卷，第3期，第1-8页", 《BIOORGANIC & MEDICINAL CHEMISTRY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113332297B (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Joshi et al. | Systematic investigation of ethanolic extract from Leea macrophylla: implications in wound healing | |
| RU2671492C2 (en) | Compositions containing berberine or analogs thereof for treating rosacea or red face related skin disorders | |
| WO2002036592A1 (en) | Remedies for arachidonic acid-induced skin diseases | |
| KR20150029031A (en) | Use of an oleogel containing triterpene for healing wounds | |
| Lalan et al. | Suppression of cytokine gene expression and improved therapeutic efficacy of microemulsion-based tacrolimus cream for atopic dermatitis | |
| JP2023139134A (en) | Fenoldopam topical formulations for treating skin disorders | |
| EP0831851B1 (en) | Use of pseudopterosins for promoting wound healing | |
| CN113332297B (en) | Application of compound 25-HL in preparation of medicine for treating skin injury | |
| Jablonska et al. | Comparative evaluation of skin atrophy in man induced by topical corticoids | |
| DE68910973T2 (en) | MEDICINAL COMPOSITION CONTAINING DEOXYRIBONUCLEOSIDES FOR HEALING Wounds. | |
| EP3275441B1 (en) | External medicine for diffuse plexiform neurofibroma | |
| Lee et al. | Enhanced skin penetration of berberine from proniosome gel attenuates pain and inflammation in a mouse model of osteoarthritis | |
| Marinho et al. | Lychnophora ericoides Mart.(Brazilian arnica) ethanol extract accelerates the skin wound healing process: Evidence for its mechanism of action | |
| CN114042032A (en) | Pharmaceutical preparation for realizing nucleic acid skin delivery and preparation method and application thereof | |
| CN108451952B (en) | A composition for treating skin immunological diseases and its preparation method | |
| Saifullah et al. | Development and optimization of film forming non-pressurized liquid bandage for wound healing by Box-Behnken statistical design | |
| CN115068407A (en) | Baricitinib gel and preparation method and application thereof | |
| TW201138850A (en) | Novel topical corticosteroid formulation | |
| US20190365705A1 (en) | Topical tocotrienol compositions and methods of increasing skin stem cells | |
| JP4767195B2 (en) | Nucleic acid skin preparation | |
| CN107550913B (en) | Application of 4- [9- (6-aminopurine) ] -2(S) -methyl hydroxybutyrate in preparing medicament for treating psoriasis and leucoderma | |
| JP7396585B2 (en) | Composition for suppressing TSLP gene expression, suppressing IL-33 gene expression, or promoting filaggrin production | |
| CN111821295A (en) | Application of (5R) -5-hydroxy triptolide in preparing medicine for treating and/or preventing skin inflammation | |
| CN114886938B (en) | Composite composition suitable for psoriasis and preparation method thereof | |
| WO2024027786A1 (en) | Cutibacterium acnes strain, and use, composition and drug thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |