CN113322255B

CN113322255B - Cation-coated metal-nucleic acid nano probe and preparation method and application thereof

Info

Publication number: CN113322255B
Application number: CN202110560427.7A
Authority: CN
Inventors: 李乐乐; 熊才长; 赵健
Original assignee: National Center for Nanosccience and Technology China
Current assignee: National Center for Nanosccience and Technology China
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2022-08-16
Anticipated expiration: 2041-05-21
Also published as: CN113322255A

Abstract

The invention provides a cation-coated metal-nucleic acid nano probe, a preparation method and application thereof. The invention also provides a preparation method of the cation-coated metal-nucleic acid nanoprobe, which comprises the following steps: preparing a nucleic acid probe solution, forming an inner core with a metal-nucleic acid nano hybrid structure with drug molecules and metal ions, and then carrying out surface modification by using a cationic polymer to obtain the metal-nucleic acid nano probe coated by cations. The cation-coated metal-nucleic acid nano probe has good stability, tumor cell killing capacity, sensing performance, specificity and endosome escape capacity, and is simple and efficient to prepare and extremely high in application value.

Description

Cation-coated metal-nucleic acid nano probe and preparation method and application thereof

Technical Field

The invention belongs to the technical field of analytical chemistry, and particularly relates to a cation-coated metal-nucleic acid nanoprobe and a preparation method and application thereof.

Background

DNA probes are a class of functional nucleic acids that specifically recognize a target DNA or RNA using the base complementary pairing principle. The high specificity and programmability of DNA probes has led to their widespread use in the field of RNA sensing. The molecular beacon is an oligonucleotide probe commonly used for RNA sensing, when a target molecule is lacked, a fluorescent group and a quenching group modified at two ends of the molecular beacon are close to each other, and a fluorescent signal is quenched due to fluorescence resonance energy transfer; after the target RNA is added, the molecular beacon and the target RNA are hybridized through base pairing, the spatial configuration of the molecular beacon is changed, and the fluorescence and quenching groups are far away, so that the fluorescence signal is recovered. According to the change of the fluorescence signal intensity, the sensitive and accurate detection of the target RNA is realized. However, negatively charged DNA probes are difficult to enter into cells and are easily degraded by intracellular nucleases, making it difficult to continuously monitor the dynamic changes of the target RNA.

The metal-nucleic acid nano hybrid structure has the function of efficiently delivering drug molecules and nucleic acid and good biocompatibility, so that the metal-nucleic acid nano hybrid structure becomes a possible intracellular RNA sensor. CN111110846A discloses a metal-nucleic acid nanoparticle and a preparation method and application thereof, wherein metal ions and nucleic acid are combined through coordination to form the nanoparticle with a spherical structure, so that the nucleic acid with functions can enter cells to play a role, and drug molecules or fluorescent tracer molecules can be encapsulated, so that the drugs and the nucleic acid play a synergistic treatment role, and meanwhile, the nanoparticle is monitored in real time. However, the preparation method is not easy to maintain the specific spatial configuration of the DNA probe, and reduces the sensing capability of the target RNA, so that the development of the DNA probe into a nano probe with the intracellular RNA sensing function still has a space for further improvement.

At present, the DNA probes generally have the problems of difficult intracellular delivery, unstable structure and poor sensing capability. How to provide a DNA probe which can be efficiently delivered into cells, has a stable structure and strong sensing capability is a problem to be solved urgently.

Disclosure of Invention

Aiming at the defects and practical requirements of the prior art, the invention provides a cation-coated metal-nucleic acid nano probe and a preparation method and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a cation-coated metal-nucleic acid nanoprobe, which comprises a drug molecule, a nucleic acid probe, an inner core formed by metal ions through coordination and having a metal-nucleic acid nano-hybrid structure, and an outer layer formed by coating a cationic polymer.

In the invention, the drug molecules, the nucleic acid probes and the metal ions form an inner core with a metal-nucleic acid nano hybrid structure, so that the drug molecules and the nucleic acid probes are delivered into cells at the same time, the drug molecules are ensured to play the drug effect, and the nucleic acid probes play the sensing function, thereby realizing the real-time monitoring of RNA; the outer layer coated by the cationic polymer is formed on the surface of the inner core, so that the surface of the nano probe carries positive charges, the escape capacity of an endosome is improved, the retention time in the body is longer, and the detection on the cytoplasmic target RNA is more sensitive and accurate.

Preferably, the drug molecule comprises doxorubicin hydrochloride.

Preferably, the nucleic acid probe comprises a DNA probe and/or an RNA probe, preferably a DNA probe.

Preferably, the DNA probe comprises a molecular beacon responsive to an apoptosis-related mRNA in the cell, preferably a Bax mRNA.

Preferably, the metal ions comprise ferrous ions.

Preferably, the cationic polymer comprises poly-L-lysine (PLL).

In a second aspect, the present invention provides a method for preparing the cation-coated metal-nucleic acid nanoprobe of the first aspect, the method comprising:

mixing a nucleic acid probe solution with drug molecules and metal ions to form an inner core with a metal-nucleic acid nano hybrid structure, and then carrying out surface modification by using a cationic polymer to obtain the metal-nucleic acid nano probe coated by cations.

The preparation method has the advantages of simple operation, mature technology, high success rate, no need of complex instruments and equipment and harsh production environment, high production efficiency and promotion of production and popularization of products.

Preferably, the method for preparing the nucleic acid probe solution comprises:

and dissolving the oligonucleotide in an inorganic salt solution, heating and cooling to obtain the nucleic acid probe solution.

In the invention, the DNA probe is heated and annealed in the inorganic salt solution to help the DNA probe to form a corresponding molecular structure, and the molecular structure of the prepared DNA probe is more stable.

Preferably, the inorganic salt solution includes a sodium chloride solution and a magnesium chloride solution.

Preferably, the concentration of sodium chloride in the inorganic salt solution is 0.5 to 5mM, for example, 0.5mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM, 4.5mM, or 5mM, preferably 1 mM.

Preferably, the concentration of magnesium chloride in the inorganic salt solution is 0.5 to 10mM, and may be, for example, 0.5mM, 1mM, 2mM, 3mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, or 10mM, and preferably 2 mM.

Preferably, the heating temperature is 93-98 deg.C, such as 93 deg.C, 93.5 deg.C, 94 deg.C, 94.5 deg.C, 95 deg.C, 95.5 deg.C, 96 deg.C, 96.5 deg.C, 97 deg.C, 97.5 deg.C or 98 deg.C.

Preferably, the heating time is 5-10 min, for example, 5min, 5.5min, 6min, 6.5min, 7min, 7.5min, 8min, 8.5min, 9min, 9.5min or 10 min.

Preferably, the final concentration of the nucleic acid probe solution is 5 to 100. mu.M, and may be, for example, 5. mu.M, 10. mu.M, 20. mu.M, 30. mu.M, 40. mu.M, 50. mu.M, 60. mu.M, 70. mu.M, 80. mu.M, 90. mu.M, or 100. mu.M.

Preferably, the method of forming an inner core having a metal-nucleic acid nanohybrid structure includes:

supplementing an inorganic salt solution into the nucleic acid probe solution, adding a drug molecule solution and a ferrous ion solution, heating to obtain a mixed solution, centrifuging, and carrying out heavy suspension precipitation with water to obtain the inner core with the metal-nucleic acid nano hybrid structure.

In the invention, by doping metal ions into the inner core, the inner core has better biocompatibility and stronger capacity of delivering drugs and nucleic acid, and can also help the probe to maintain relative stability in an in vivo environment; the low-temperature and salt-containing environment is maintained in the preparation process, the prepared metal-nucleic acid nano hybrid structure has a proper particle size, the corresponding functions of the nucleic acid probe can be exerted, and the damage to the specific space structure of the probe caused by overhigh temperature can be avoided.

Preferably, the concentration of sodium chloride in the inorganic salt solution is 0.38 to 5.8mM, for example, 0.38mM, 0.5mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM, 4.5mM, 5mM, 5.5mM or 5.8mM, preferably 1.16 mM.

Preferably, the concentration of magnesium chloride in the inorganic salt solution is 0.76 to 4.64mM, and may be, for example, 0.76mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM, 4.5mM, or 4.64mM, preferably 2.32 mM.

Preferably, the final concentration of the drug molecule in the mixed solution is 0.1 to 0.5mM, and may be, for example, 0.1mM, 0.2mM, 0.3mM, 0.4mM, or 0.5mM, and is preferably 0.25 mM.

Preferably, the ferrous ion solution comprises a ferrous chloride solution, and the final concentration of ferrous chloride in the mixed solution is 0.2-1 mM, and may be, for example, 0.2mM, 0.3mM, 0.4mM, 0.5mM, 0.6mM, 0.7mM, 0.8mM, 0.9mM or 1mM, and is preferably 0.75 mM.

Preferably, the step of vortexing is further included after the drug molecule solution and the ferrous ion solution are added, and the vortexing time is 1-30 s, and may be 1s, 5s, 10s, 15s, 20s, 25s or 30s, for example.

Preferably, the heating temperature is 45-60 ℃, for example, 45 ℃, 46 ℃, 47 ℃, 48 ℃, 49 ℃, 50 ℃, 51 ℃, 52 ℃, 53 ℃, 54 ℃, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃ or 60 ℃, and the heating time is 1-4 h, for example, 1h, 1.5h, 2h, 2.5h, 3h, 3.5h or 4 h.

Preferably, the rotation speed of the centrifugation is 6010-18407 g, such as 6010g, 7000g, 8000g, 9000g, 10000g, 11000g, 12000g, 13000g, 14000g, 15000g, 16000g, 17000g, 18000g or 18407g, the time of the centrifugation is 1-15 min, such as 1min, 2min, 3min, 4min, 5min, 6min, 7min, 8min, 9min, 10min, 11min, 12min, 13min, 14min or 15min, and the number of the centrifugation is 1-5 times, such as 1 time, 2 times, 3 times, 4 times or 5 times.

Preferably, the centrifugation further comprises a step of washing the precipitate with water.

Preferably, the method of surface modification comprises:

stirring the inner core with the metal-nucleic acid nano hybrid structure in a cationic polymer solution, centrifuging, and resuspending the precipitate by using water.

Preferably, the concentration of the cationic polymer solution is 1 to 5mg/mL, for example, 1mg/mL, 1.5mg/mL, 2mg/mL, 2.5mg/mL, 3mg/mL, 3.5mg/mL, 4mg/mL, 4.5mg/mL, or 5mg/mL, preferably 2.5 mg/mL.

Preferably, the stirring time is 1-6 h, for example, 1h, 1.5h, 2h, 2.5h, 3h, 3.5h, 4h, 4.5h, 5h, 5.5h or 6 h.

Preferably, the particle size of the inner core with the metal-nucleic acid nano hybrid structure is 80-200 nm, such as 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm or 200 nm.

Preferably, the particle size of the cation-coated metal-nucleic acid nanoprobe is 80-200 nm, for example, 80nm, 90nm, 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, 160nm, 170nm, 180nm, 190nm or 200 nm.

As a preferred technical scheme, the preparation method of the cation-coated metal-nucleic acid nanoprobe comprises the following steps:

(1) preparation of nucleic acid probe solution:

dissolving oligonucleotide in 0.5-5 mM sodium chloride solution and 0.5-10 mM magnesium chloride solution, heating at 93-98 ℃ for 5-10 min, and cooling to obtain 5-100 mu M nucleic acid probe solution;

(2) preparing an inner core having a metal-nucleic acid nano-hybrid structure:

supplementing a sodium chloride solution with the concentration of 0.38-5.8 mM and a magnesium chloride solution with the concentration of 0.76-4.64 mM into the nucleic acid probe solution, adding a drug molecule solution, performing vortex for 1-30 s, adding a ferrous chloride solution, performing vortex for 1-30 s, heating at 45-60 ℃ for 1-4 h to obtain a mixed solution, wherein the final concentration of the drug molecules in the mixed solution is 0.1-0.5 mM, the final concentration of the ferrous chloride is 0.2-1 mM, centrifuging at 6010-18407 g for 1-15 min, washing the precipitate with water, repeating for 1-5 times, and re-suspending with water to obtain an inner core with a metal-nucleic acid nano hybrid structure and the particle size of 80-200 nm;

(3) surface modification:

stirring the inner core with the metal-nucleic acid nano hybrid structure in a cationic polymer solution with the concentration of 1-5 mg/mL for 1-6 h, centrifuging for 1-15 min under the condition of 6010-18407 g, washing the precipitate with water, repeating for 1-5 times, and re-suspending with water to obtain the metal-nucleic acid nano probe coated with the cations with the particle size of 80-200 nm.

In a third aspect, the present invention provides the use of the cation-coated metal-nucleic acid nanoprobe of the first aspect and/or the method of the second aspect for preparing a intracellular RNA sensing device.

In the invention, the cation-coated metal-nucleic acid nano probe can play a sensing function of the probe while playing a drug treatment effect, so that RNA related to a drug action signal can be monitored in real time; the preparation method is scientific and efficient, has low requirements on the level of technical personnel, and has wide application prospect.

Preferably, the RNA comprises any one of mRNA, miRNA or siRNA or a combination of at least two thereof, preferably an apoptosis-related Bax mRNA.

Compared with the prior art, the invention has the following beneficial effects:

(1) the invention assembles the drug molecules, the nucleic acid probe and the metal ions in the same nanoparticle, can be delivered into cells together, simultaneously exerts the efficacy of the drug molecules and the sensing function of the probe, has the killing effect on tumor cells, and has good specificity on the sensing function; the inner core contains inorganic salt ions, which is helpful for increasing the biocompatibility of the nano nucleic acid probe and improving the stability of the nano nucleic acid probe in vivo; the shell is formed by coating the cationic polymer, so that the endosome escape capacity of the nano nucleic acid probe is increased, the nano nucleic acid probe stays in a body for a longer time, and the effect is more durable;

(2) the preparation method of the metal-nucleic acid nano probe coated by the cations is simple and efficient, energy-saving and environment-friendly, and the metal-nucleic acid nano probe is always prepared in a low-temperature and salt-containing environment, and the prepared inner core with the metal-nucleic acid nano hybrid structure is appropriate in particle size, uniform in size and uniform in element distribution, is beneficial to the exertion of the efficacy of the nano nucleic acid probe, can also increase the stability of the probe, and has higher application value.

Drawings

Fig. 1A is a transmission electron microscope picture (scale bar 200nm) of an inner core having a metal-nucleic acid nano-hybrid structure prepared in example 1 of the present invention;

fig. 1B is a transmission electron microscope picture (scale bar: 200nm) of the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 4 of the present invention;

FIG. 2 is a diagram showing the results of an element distribution test in example 8 of the present invention;

FIG. 3 is a photograph showing the results of the hydrated particle size test in example 8 of the present invention;

FIG. 4 is a photograph showing the results of the potential test in example 8 of the present invention;

fig. 5 is a result picture of a sensing performance test in embodiment 8 of the present invention;

fig. 6 is a picture of a result of a test of endosome escape capability in embodiment 8 of the present invention;

FIG. 7 is a picture showing the results of the tumor killing ability test in example 8 of the present invention;

FIG. 8 is a photograph showing the scanning result of the confocal laser scanning microscope in the specificity test in example 8 of the present invention;

FIG. 9A is a photograph showing the results of measurement of the fluorescence intensity value of Cy5.5 in the specificity test in example 8 of the present invention;

FIG. 9B is a photograph showing the results of relative fluorescence intensity in the specificity test in example 8 of the present invention.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and that no limitation of the invention is intended.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Raw materials:

doxorubicin hcl was purchased from Shanghai Macklin (Shanghai Macklin Biochemical Co.);

the PLL, the thio-modified DNA probe with two ends respectively marked with a fluorescent dye Cy5.5 and the thio-modified DNA probe with two ends respectively marked with the fluorescent dye Cy5.5 and a quenching group BHQ-3 are from the company of Biotechnology engineering, Ltd;

MCF-7 breast cancer cells are from American Type Culture Collection (ATCC);

Lyso-Tacker Green was purchased from assist saint biol Ltd;

hoechst is available from solibao life science ltd;

MTT assay reagents were purchased from shanghai bi yunnan biotechnology limited.

Example 1

The present example provides an inner core having a metal-nucleic acid nano-hybrid structure formed by doxorubicin hydrochloride, a DNA probe, and ferrous ions through coordination.

The preparation method of the inner core with the metal-nucleic acid nano hybrid structure comprises the following steps:

(1) preparation of nucleic acid probe solution:

dissolving the DNA probe in a sodium chloride solution with the concentration of 1mM and a magnesium chloride solution with the concentration of 2mM, heating in a metal bath at 95 ℃ for 5min, and naturally cooling to obtain a DNA probe solution with the final concentration of 38 mu M;

the DNA probe is a sulfo-modified DNA probe, and the sequence of the DNA probe is shown in SEQ ID No. 1.

SEQ ID No.1：GTCACTTGTCAAAGTAGAAAAGGGCGACAAGTGAC。

(2) Preparing an inner core having a metal-nucleic acid nano-hybrid structure:

and supplementing 38 mu L of sodium chloride solution with the concentration of 1.16mM and 36 mu L of magnesium chloride solution with the concentration of 2.32mM into 100 mu L of the DNA probe solution, adding 2 mu L of adriamycin hydrochloride solution with the concentration of 10mM, vortexing for 10s, adding 4 mu L of ferrous chloride solution with the concentration of 15mM, vortexing for 10s, heating for 2h in a metal bath at 50 ℃ to obtain a mixed solution, carrying out centrifugation for 10min at 15871g, washing precipitates with water, repeating for 3 times, and then carrying out heavy suspension with water to obtain the inner core with the metal-nucleic acid nano hybrid structure.

Example 2

The difference from example 1 is only that the DNA probe in this example is a thio-modified DNA probe with one end labeled with a fluorescent dye, cy5.5, and the rest of the raw materials and the preparation method are the same as example 1.

Example 3

The difference from example 1 is only that the DNA probe in this example is a thio-modified DNA probe with two ends labeled with a fluorescent dye cy5.5 and a quenching group BHQ-3, respectively, and the rest of the raw materials and the preparation method are the same as example 1.

Example 4

This example provides a cation-coated metal-nucleic acid nano fluorescent probe, which is formed by coating a cationic polymer on the surface of an inner core having a metal-nucleic acid nano hybrid structure prepared in example 1, and the preparation process is as follows:

stirring the inner core with the metal-nucleic acid nano hybrid structure in a PLL solution with the concentration of 2.5mg/mL for 4h by using an electric magnetic stirrer, centrifuging for 10min at 15871g, washing the precipitate with water, repeating for 3 times, and then re-suspending with water to obtain the metal-nucleic acid nano fluorescent probe coated with the cations.

Example 5

The only difference from example 4 is that the inner core having a metal-nucleic acid nano-hybrid structure prepared in example 2 was used instead of the inner core having a metal-nucleic acid nano-hybrid structure prepared in example 1, and the rest of the raw materials and the preparation method were the same as example 4.

Example 6

The only difference from example 4 is that the inner core having a metal-nucleic acid nano-hybrid structure prepared in example 3 was used instead of the inner core having a metal-nucleic acid nano-hybrid structure prepared in example 1, and the rest of the raw materials and the preparation method were the same as example 4.

Example 7

The difference from example 4 is only that, in this example, the DNA probe in the core having the metal-nucleic acid nano hybrid structure is a thio-modified DNA probe with two ends respectively labeled with a fluorescent dye cy5.5 and a quenching group BHQ-3, the sequence of the thio-modified DNA probe is shown in SEQ ID No.2, and the rest of the raw materials and the preparation method are the same as those of example 4.

SEQ ID No.2：GTCACTTGTCAAAGTAGTTTTCGGCGACAAGTGAC。

Example 8

In this embodiment, the detection of a part of the cores with metal-nucleic acid nano hybrid structures prepared in embodiments 1 to 3 and a part of the metal-nucleic acid nano fluorescent probes coated with cations prepared in embodiments 4 to 7 includes morphology detection, element distribution test, hydrated particle size test, potential test, sensing performance test, inclusion escape capability test, tumor killing capability test and specificity test.

Topography testing

The morphology test of the inner core with the metal-nucleic acid nano hybrid structure prepared in the example 1 and the cation-coated metal-nucleic acid nano fluorescent probe prepared in the example 4 is carried out, and the steps are as follows:

the prepared product is ultrasonically dispersed by deionized water, the dispersed liquid is dropped on a carbon supporting film, and a transmission electron microscope is adopted to observe the appearance of a sample after the dispersed liquid is naturally dried, and the result is shown in figures 1A and 1B.

As can be seen from the figure, the inner core with the metal-nucleic acid nano hybrid structure prepared in example 1 and the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 4 are both spherical nanoparticles, the particle size is 80-200 nm, and the fact that doxorubicin hydrochloride, the DNA probe and ferrous ions successfully complete self-assembly through coordination is proved.

Elemental distribution test

The core with the metal-nucleic acid nano hybrid structure prepared in example 1 was subjected to an element distribution test, comprising the following steps:

ultrasonically dispersing the prepared product by using deionized water, dripping the dispersed liquid on a carbon supporting film, naturally drying the carbon supporting film, and then performing element distribution analysis and linear scanning by using a high-angle annular dark field scanning transmission electron microscope-energy dispersion X-ray spectrometer, wherein the result is shown in figure 2.

As can be seen from the figure, the elements Fe, P and N are uniformly distributed on the surface of the nano-particles, which shows that the Fe element and the nucleic acid are well combined together, so that the nano-particles have better biocompatibility and stability.

Hydrated particle size test

The hydrated particle size test was performed on the inner core having the metal-nucleic acid nano-hybrid structure prepared in example 1 and the cation-coated metal-nucleic acid nano-fluorescent probe prepared in example 4, and the procedure was as follows:

the prepared product was ultrasonically dispersed and diluted with deionized water, placed in a particle size measuring dish, and tested using a laser particle sizer, with the results shown in fig. 3.

As can be seen from the figure, the hydrated particle diameters of the core having a metal-nucleic acid nano-hybrid structure prepared in example 1 and the cation-coated metal-nucleic acid nano-fluorescent probe prepared in example 4 were 156nm and 187nm, respectively, which indicates that the particle diameter of the core having a metal-nucleic acid nano-hybrid structure was increased after surface modification.

Potential testing

The potential test was performed on the inner core having the metal-nucleic acid nano-hybrid structure prepared in example 1 and the cation-coated metal-nucleic acid nano-fluorescent probe prepared in example 4, and the procedure was as follows:

the prepared product was ultrasonically dispersed with deionized water, diluted, placed in a potential measuring dish, and tested using a laser particle sizer, with the test results shown in fig. 4.

As can be seen from the figure, the potential of the inner core with the metal-nucleic acid nano-hybrid structure prepared in example 1 is-23.77 mV, which indicates that the DNA probe is combined with ferrous ions, and the potential of the metal-nucleic acid nano-fluorescent probe coated with cations prepared in example 4 is 13.9mV, which indicates that the inner core with the metal-nucleic acid nano-hybrid structure is successfully coated with the cationic polymer PLL after surface modification.

Sensing performance testing

The sensing performance test of the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 6 comprises the following steps:

placing the prepared product in a PBS solution, shaking at a constant temperature of 37 ℃ for 24h, centrifuging and collecting supernatant, quantifying the content of the DNA probe in the supernatant by an ultraviolet-visible spectrophotometer, and adding an identification substrate Bax mRNA (DNA sequence simulation substrate) of the nucleic acid probe, wherein the sequence is shown as SEQ ID No.3 (SEQ ID No. 3: TTGTCGCCCTTTTCTACTTT, corresponding to Bax mRNA 383-402 bp).

1mL of cation-coated metal-nucleic acid nano fluorescent probe solution with the concentration of 50nM and Bax mRNA solution with the concentration of 20nM are incubated at 37 ℃ for 15min in a metal bath, and a fluorescence spectrophotometer is used for testing, and a control group without Bax mRNA solution is set, and the result is shown in FIG. 5.

As can be seen from the figure, the DNA probe released by the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 6 in the PBS solution can recognize the substrate Bax mRNA and generate a fluorescent signal, which indicates that the metal-nucleic acid nano fluorescent probe with the cation coating can sense the target RNA.

Test of escape capacity of endosome

MCF-7 Breast cancer cells in Dulbecco's Modified Eagle Medium (DMEM) at 1X 10 ⁵ Cell/well culture Density seeded in 35mm Petri dishes at 37 deg.CCO ₂ The culture was performed in an incubator and the medium was supplemented with 100 units/mL aqueous penicillin G, 4.5mg/mL glucose, 4mM L-glutamine, 10% FBS and 100. mu.g/mL streptomycin. After 24h incubation, the medium was removed and fresh cell culture medium (DNA probe concentration 500nM) containing the cation-coated metal-nucleic acid nanofluorescent probe prepared in example 5 was added, and further incubated for 3h and 6h, the medium was removed, the treated cells were washed with PBS solution to remove free nanoparticles, lysosomes were stained using Lyso-Ttter Green, nuclei were stained using Hoechst, and the results were measured using a confocal laser scanning microscope, as shown in FIG. 6.

As can be seen from the figure, the metal-nucleic acid nano fluorescent probe coated with cations prepared in example 5 can be taken up by cells and enter the interior of the cells, and is not co-located with endosomes, which indicates that the nano fluorescent probe can realize endosome escape, thereby prolonging the retention time in the cells and achieving better treatment effect.

Tumor killing ability test

MCF-7 Breast cancer cells in Dulbecco's Modified Eagle Medium (DMEM) at 1X 10 ⁴ Cell/well culture Density seeded in 96-well plates, CO at 37 ℃ ₂ The culture was performed in an incubator and the medium was supplemented with 100 units/mL aqueous penicillin G, 4.5mg/mL glucose, 4mM L-glutamine, 10% FBS and 100. mu.g/mL streptomycin. After 24h incubation, the medium was removed and fresh cell culture medium containing different concentrations of the metal-nucleic acid nanofluorescent probes with cationic coating prepared in example 4, where the probe concentration was scaled to the equivalent concentration of DOX, was added separately. After another 24h incubation, the treated cells were washed with PBS solution to remove free nanoparticles, then 100. mu.L of fresh medium containing 0.5% MTT was added, incubation was continued for 4h, the supernatant was gently aspirated, 150. mu.L DMSO was added to each well, shaken for 10min, and MTT assay was performed using a plate reader. The conversion steps of DOX equivalent concentration are as follows:

preparing a group of DOX solutions with concentration gradient and testing fluorescence intensity (excitation wavelength is 480nm, and maximum emission wavelength is 596nm) to obtain a DOX fluorescence intensity-concentration standard curve. Adding DOX into the system when synthesizing the cation-coated metal-nucleic acid nano fluorescent probe, wherein the adding volume is marked as V1, the concentration is marked as C1, collecting supernate and washing liquid after centrifugation in the synthesis reaction and surface modification processes, the volume after combination is marked as V2, testing the DOX fluorescence intensity in the solution, and determining the concentration of the DOX in the solution according to a standard curve and marking as C2. The final product dispersion liquid integrated as V3, the DOX equivalent concentration in the product is: c3 ═ C1 × V1-C2 × V2)/V3. The product was taken at volume V4 and dispersed in a cell culture broth at volume V5, with a DOX equivalent concentration of V4 ═ C3 × V4/V5. The results are shown in FIG. 7.

As can be seen from the figure, the survival rate of the cells after the culture medium containing the metal-nucleic acid nano fluorescent probe coated with the cations prepared in example 4 is low, which indicates that the nano fluorescent probe has a killing effect on tumor cells and the drug molecules can exert the efficacy.

Specificity test

MCF-7 Breast cancer cells in Dulbecco's Modified Eagle Medium (DMEM) at 1X 10 ⁵ Cell/well culture Density seeded in 35mm Petri dishes at 37 ℃ CO ₂ The culture was performed in an incubator and the medium was supplemented with 100 units/mL aqueous penicillin G, 4.5mg/mL glucose, 4mM L-glutamine, 10% FBS and 100. mu.g/mL streptomycin. After 24h incubation, the medium was removed and fresh cell culture medium (DNA probe concentration 500nM) containing the cation-coated metal-nucleic acid nanofluorescent probes prepared in examples 6 and 7, respectively, was added, and the incubation was continued for 6h, the medium was removed, the treated cells were washed with PBS solution to remove free nanoparticles, the nuclei were stained using Hoechst, and the results were measured using confocal laser scanning microscope, as shown in FIG. 8.

As can be seen from the figure, compared with the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 7 containing the DNA probe with the mutant sequence, the cells cultured by using the cation-coated metal-nucleic acid nano fluorescent probe prepared in example 6 have enhanced fluorescent signals, which indicates that the DNA probe released in the cells can sense and emit fluorescent signals to target Bax RNA, and has good specificity, and no corresponding signals are generated when the sequence is mutated.

In addition, the appropriate amount of PBS solution washing treated cells were analyzed by flow cytometry, and the results are shown in FIG. 9A and FIG. 9B. As can be seen from FIGS. 9A and 9B, the fluorescence signal of the cells cultured with the metal-nucleic acid nanophosphoric probe containing the cation coating prepared in example 6 was enhanced 2.9-fold compared to that of example 7, which further confirms the above-mentioned conclusion.

In conclusion, the invention provides a cation-coated metal-nucleic acid nanoprobe, which has uniform size, uniform element distribution, good biocompatibility and endosome escape capacity, a killing function on tumor cells, RNA sensing performance and good specificity; the preparation method of the nano probe is scientific, efficient, energy-saving and environment-friendly, promotes the popularization and use of related products, and has extremely high application value.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> national center for Nano science

<120> cation-coated metal-nucleic acid nano probe and preparation method and application thereof

<130> 2021

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 35

<212> DNA

<213> Artificial sequence

<400> 1

gtcacttgtc aaagtagaaa agggcgacaa gtgac 35

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<400> 2

gtcacttgtc aaagtagttt tcggcgacaa gtgac 35

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

ttgtcgccct tttctacttt 20

Claims

1. The cation-coated metal-nucleic acid nanoprobe is characterized by comprising a drug molecule doxorubicin hydrochloride, a molecular beacon responded by a nucleic acid probe Bax mRNA and an inner core with a metal-nucleic acid nano hybrid structure formed by ferrous ions through coordination, and an outer layer formed by coating poly-L-lysine;

the cation-coated metal-nucleic acid nano probe is prepared by a preparation method comprising the following steps of:

supplementing a sodium chloride solution and a magnesium chloride solution into a nucleic acid probe solution, adding a drug molecule solution and a ferrous ion solution, heating at 45-55 ℃ for 1-4 h to obtain a mixed solution, centrifuging, and carrying out heavy suspension precipitation by using water to obtain the inner core with the metal-nucleic acid nano hybrid structure; and performing surface modification by using poly-L-lysine to obtain the metal-nucleic acid nano probe coated by the cations.

2. A method for preparing the cation-coated metal-nucleic acid nanoprobe of claim 1, comprising:

(1) supplementing inorganic salt solutions into a nucleic acid probe solution, wherein the inorganic salt solutions comprise a sodium chloride solution and a magnesium chloride solution;

(2) adding a drug molecule solution and a ferrous ion solution, heating for 1-4 h at 45-55 ℃ to obtain a mixed solution, centrifuging, and carrying out heavy suspension precipitation with water to obtain the inner core with the metal-nucleic acid nano hybrid structure;

(3) and performing surface modification by using poly-L-lysine to obtain the metal-nucleic acid nanoprobe coated by the cations.

3. The method of claim 2, wherein the method of preparing the nucleic acid probe solution comprises:

dissolving oligonucleotide in inorganic salt solution containing sodium chloride and magnesium chloride, heating and cooling to obtain the nucleic acid probe solution.

4. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 3, wherein the concentration of sodium chloride in the inorganic salt solution containing sodium chloride and magnesium chloride is 0.5 to 5 mM.

5. The method of claim 3, wherein the concentration of sodium chloride in the inorganic salt solution containing sodium chloride and magnesium chloride is 1 mM.

6. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 3, wherein the concentration of magnesium chloride in the inorganic salt solution containing sodium chloride and magnesium chloride is 0.5 to 10 mM.

7. The method of preparing a cation coated metal-nucleic acid nanoprobe according to claim 3, wherein the concentration of magnesium chloride in the inorganic salt solution containing sodium chloride and magnesium chloride is 2 mM.

8. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 3, wherein the heating temperature is 93-98 ℃.

9. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 3, wherein the heating time is 5-10 min.

10. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 3, wherein the final concentration of the nucleic acid probe solution is 5 to 100. mu.M.

11. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the concentration of sodium chloride in the inorganic salt solution of step (1) is 0.38 to 5.8 mM.

12. The method of preparing a cation coated metal-nucleic acid nanoprobe according to claim 11, wherein the concentration of sodium chloride in the inorganic salt solution of step (1) is 1.16 mM.

13. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the concentration of magnesium chloride in the inorganic salt solution of step (1) is 0.76 to 4.64 mM.

14. The method of preparing a cation coated metal-nucleic acid nanoprobe according to claim 13, wherein the concentration of magnesium chloride in the inorganic salt solution of step (1) is 2.32 mM.

15. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the final concentration of the drug molecule in the mixed solution of the step (2) is 0.1-0.5 mM.

16. The method of claim 15, wherein the final concentration of the drug molecule in the mixed solution of step (2) is 0.25 mM.

17. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the ferrous ion solution comprises a ferrous chloride solution, and the final concentration of the ferrous chloride in the mixed solution is 0.2-1 mM.

18. The method of claim 2, wherein the ferrous ion solution comprises a ferrous chloride solution, and the final concentration of ferrous chloride in the mixed solution is 0.75 mM.

19. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the method further comprises a step of vortexing after the drug molecule solution and the ferrous ion solution are added, and the vortexing time is 1-30 s.

20. The method for preparing the cation coated metal-nucleic acid nanoprobe according to claim 2, wherein the rotation speed of the centrifugation in the step (2) is 6010-18407 g, the time of the centrifugation is 1-15 min, and the number of the centrifugation is 1-5.

21. The method for preparing a cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the centrifugation in step (2) further comprises a step of washing the precipitate with water.

22. The method of preparing the cation coated metal-nucleic acid nanoprobe according to claim 2, wherein the surface modification method comprises:

23. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 22, wherein the concentration of the cation polymer solution is 1-5 mg/mL.

24. The method of claim 22, wherein the cationic polymer solution is at a concentration of 2.5 mg/mL.

25. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 22, wherein the stirring time is 1-6 h.

26. The method for preparing the cation-coated metal-nucleic acid nanoprobe according to claim 2, wherein the particle size of the inner core having the metal-nucleic acid nano hybrid structure is 80 to 200 nm.

27. The method according to claim 2, wherein the particle size of the cation-coated metal-nucleic acid nanoprobe is 80 to 200 nm.

28. Use of the method of making the cation coated metal-nucleic acid nanoprobe of claim 1 and/or the cation coated metal-nucleic acid nanoprobe of claim 2 for making an intracellular RNA sensing device.