CN113308530A - Blood tsRNA marker for herpes zoster, preparation and application - Google Patents

Abstract

Aiming at the defects of high cost, long detection time and the like of the current herpes zoster diagnosis method, the invention discloses a blood tsRNA marker tRF-Pro-AGG-007 of herpes zoster, the sequence of which is shown as SEQ ID NO. 1; SEQ ID NO. 1: GGCTCGTTGGTCTAGGGGTATGATTCTCGGT are provided. The blood tsRNA marker shows a remarkable correlation with herpes zoster, the expression in a herpes zoster patient is remarkably lower than that of a normal healthy person, the blood tsRNA marker can be used for detecting the herpes zoster, and compared with the current herpes zoster diagnosis method, the blood tsRNA marker can obviously reduce the detection cost.

Description

Blood tsRNA marker for herpes zoster, preparation and application

Technical Field

The invention relates to the technical field of biological diagnosis of herpes zoster, in particular to a blood tsRNA marker of herpes zoster, preparation and application thereof.

Background

Varicella-Zoster Virus (VZV) is well known to be the direct cause of Herpes Zoster (Herpes Zoster). After the initial infection, varicella-zoster virus will colonize the dorsal root ganglion of the spinal nerve or the cranial nerve. When the immunity of the human body is reduced, it is reactivated again, continuously migrates along nerves to peripheral nerve fibers, finally presents herpes on the skin with pain, and more serious develops postherpetic neuralgia, seriously affects the life quality of patients and increases the medical burden. Early diagnosis and early treatment are effective measures to avoid the serious dangers and complications of the disease, and therefore, accurate diagnosis and targeted intervention treatment at the early stage of herpes zoster becomes extremely important.

To date, diagnosis of VZV infection is typically accomplished by skin rash, with relatively few other diagnostic measures. Researchers have searched the diagnostic value of viral DNA content of different body fluids on herpes zoster by quantitative analysis of VZV DNA in saliva and circulating blood; researchers have also analyzed the correlation of different disease degrees with the VZV DNA content in circulating blood; also, VZV can be cultured from skin lesions, but these methods are expensive, long in detection time, not readily available, and low in sensitivity. Thus, there are difficulties in the current definitive diagnosis of herpes zoster.

Disclosure of Invention

Aiming at the defects of high cost, long detection time and the like of the current herpes zoster diagnosis method, the invention aims to provide the blood tsRNA marker of the herpes zoster, which shows obvious correlation with the herpes zoster, can be used for detecting the herpes zoster and can obviously reduce the detection cost compared with the current herpes zoster diagnosis method.

The invention provides the following technical scheme:

a blood tsRNA marker of herpes zoster is tRF-Pro-AGG-007, and the sequence of the blood tsRNA marker is shown as SEQ ID NO. 1;

SEQ ID NO.1：GGCTCGTTGGTCTAGGGGTATGATTCTCGGT。

the blood tsRNA marker provided by the invention is lower than a healthy person in the significance of expression in the plasma of a herpes zoster patient.

The blood tsRNA marker is used as a detection target to prepare a herpes zoster diagnostic reagent.

A detection reagent for detecting the blood tsRNA marker is a specific primer, a probe or a chip for detecting the blood tsRNA marker according to claim 1.

Preferably, the upstream primer sequence of the specific primer is shown as SEQ ID NO.2, and the downstream primer sequence is shown as SEQ ID NO. 3:

SEQ ID NO.2：F：5’GATCGGCTCGTTGGTCTAGG 3’；

SEQ ID NO.3：R：5’GACGTGTGCTCTTCCGATCTAC 3’。

the application of the detection reagent in preparing herpes zoster diagnosis reagents.

A diagnostic kit for herpes zoster contains the detection reagent.

Preferably, the diagnostic kit is used for detecting the expression level of the blood tsRNA marker.

The invention has the following beneficial effects:

the blood tsRNA marker tRF-Pro-AGG-007 has the expression significance lower than that of a healthy patient in the plasma of a herpes zoster patient, has significant correlation with herpes zoster, can be used as a marker for diagnosing herpes zoster, is applied to the preparation of herpes zoster diagnostic reagents and diagnostic kits, is used for detecting herpes zoster, has the defects of high cost, long detection time and the like compared with the current herpes zoster diagnostic method, can obviously reduce the detection cost and improve the detection efficiency.

Drawings

FIG. 1 is a graph of tRF-Pro-AGG-007 differential expression in groups N, A and B.

FIG. 2 is a standard curve for tRF-Pro-AGG-007.

FIG. 3 is an amplification curve for tRF-Pro-AGG-007.

FIG. 4 is a melting curve of tRF-Pro-AGG-007.

FIG. 5 is a standard curve of housekeeping gene U6.

FIG. 6 is an amplification curve of housekeeping gene U6.

FIG. 7 shows a melting curve of housekeeping gene U6.

P <0.001 in figure 1.

Detailed Description

The following further describes the embodiments of the present invention.

The starting materials used in the present invention are commercially available or commonly used in the art, unless otherwise specified, and the methods in the following examples are conventional in the art, unless otherwise specified.

The blood tsRNA marker of herpes zoster is tRF-Pro-AGG-007, and the sequence of the blood tsRNA marker is as follows:

SEQ ID NO.1：GGCTCGTTGGTCTAGGGGTATGATTCTCGGT。

1. case screening

1.1 patients with herpes zoster are defined as the appearance of typical herpes in the skin, distributed along the nerve, with burning or neuralgia. Patients with postherpetic neuralgia (PHN) are defined as patients who develop herpes zoster and who have a duration of pain of at least more than 1 month. The normal healthy subjects were outpatient contemporaneous healthy physical examiners. All subjects signed informed consent.

1.2 select 75 patients with herpes zoster who were hospitalized at the first hospital pain department in Jiaxing city between 12 months 2018 and 12 months 2019, divided into three groups, N, a and B:

n groups are normal healthy groups, and 25 parts of blood plasma;

group A is patients who have herpes zoster but do not develop postherpetic neuralgia in the later period, and the blood plasma is 25 parts;

group B is patients who have herpes zoster but later develop postherpetic neuralgia, and the blood plasma is 25 parts;

wherein 5 of each set was used for NGS analysis and 20 of the remaining sets were used for qRT-PCR analytical validation.

1) Patients with herpes zoster have included the following criteria (to be met at the same time):

(1) before eruption, general symptoms such as slight hypodynamia, low fever, inappetence and the like exist, the patient feels scorching or neuralgia, and has obvious pain sensation sensitivity when touching, and eruption can also occur without prodromal symptoms;

(2) clustered and clustered blisters appear on the skin with pathological changes and are distributed in a belt shape along peripheral nerves on one side;

(3) may have obvious neuralgia, which can be dull pain, twitching pain or jumping pain, often accompanied by burning sensation, mostly paroxysmal, and also can be continuous accompanied by local lymph node swelling;

(4) a targeted treatment associated with herpes zoster is effective;

(5) american Society of Anesthesiologists (ASA) grades i, ii;

(6) the informed consenter is signed and subsequent phone visits are accepted.

2) Exclusion criteria (any condition is met):

(1) fever and other systemic or local infections;

(2) those with sympathetic system diseases;

(3) those treated with drugs or other physical therapy;

(4) those with mental disorders;

(5) misdiagnosed patients (such as angina pectoris, intercostal neuralgia, cholelithiasis, cholecystitis, appendicitis, etc.);

(6) other conditions (e.g., contact dermatitis, erysipelas, insect dermatitis, impetigo, bullous pemphigoid, etc.);

(7) patients diagnosed with herpes zoster were excluded from follow-up treatment.

RNA extraction and quality detection

2.1 RNA extraction of samples

1) The reagents used were as follows:

TRIzol LS Reagent(Invitrogen life technologies)；

chloroform Shanghai chemical Co., Ltd;

isopropyl alcohol Shanghai chemical Co., Ltd;

100% ethanol (Shanghai chemical Co., Ltd.);

75% ethanol (configured with DEPC treated water);

glacial acetic acid (chemical agents of national drug group, ltd.);

rnase-free water;

RNase-free glycogen (Invitrogen life technologies).

2) Homogenate

Plasma samples were removed from a-70 ℃ freezer, thawed and centrifuged at 12,000 Xg for 10 minutes at 4 ℃ to remove any impurities that may be present, 250ul of plasma fluid was transferred to a 1.5ml centrifuge tube, 750. mu.l of TRIzol LS Reagent was added, and the tube was shaken vigorously by hand until well mixed.

3) Two-phase separation

After homogenization, the sample is incubated at 15 to 30 ℃ for 5 minutes so that the nucleic acid-protein complex is completely dissociated. 0.2ml of chloroform was added to 750. mu.l of the sample homogenized with TRIzol LS Reagent, and the tube cap was closed. After manually shaking the tube vigorously for 15 seconds, the tube is incubated at 15 to 30 ℃ for 2 to 3 minutes. Centrifugation was carried out at 12,000 Xg for 15 minutes at 4 ℃. After centrifugation, the mixed liquid will be separated into a lower red phenol chloroform phase and an upper colorless aqueous phase. The RNA was partitioned in the aqueous phase in its entirety. The volume of the aqueous phase was about 60% of the TRIzol LS Reagent added during homogenization.

4) RNA precipitation

The aqueous phase was transferred to a fresh centrifuge tube and 500. mu.l isopropanol was added and mixed to precipitate the RNA therein. After mixing, incubation was carried out at 15 to 30 ℃ for 10 minutes, and then centrifugation was carried out at 12,000 Xg at 4 ℃ for 10 minutes. At this point the invisible RNA pellet before centrifugation will form a gelatinous pellet at the bottom and on the side walls of the tube.

5) RNA cleaning

The supernatant was removed and 750. mu.l of a sample homogenized with TRIzol LS Reagent was washed with RNA pellet by adding at least 1ml of 75% ethanol. After shaking, the mixture was centrifuged at 7,500 Xg for 5 minutes at 4 ℃.

6) Re-solubilization of RNA pellets

The ethanol solution was removed, the RNA pellet was air dried for 5-10 minutes, and dried by vacuum centrifugation. Note that the RNA pellet is not completely dried, otherwise the solubility of the RNA is greatly reduced. Partially lysed RNA sample A_260/280The ratio will be less than 1.6. When RNA was dissolved, RNase-free water was added and the mixture was repeatedly blown with a gun several times, followed by incubation at 55 to 60 ℃ for 10 minutes. The RNA solution obtained was stored at-70 ℃.

2.2RNA quality detection

1) The reagents used were as follows

TE: 10mM, Tris-HCl pH 8, 1mM EDTA (Tris-HCl, EDTA Huamei bioengineering Co.);

0.2M MOPS, pH 7.0(MOPS Huamei bioengineering Co.);

0.02M sodium acetate (sodium acetate Shanghai chemical Co., Ltd.);

0.01M EDTA (EDTA Huamei bioengineering Co.);

shanghai Chemicals, Formaldehyde, Inc.;

formaldehyde loading dye liquor (Ambion);

gold View dye Shanghai Saiban Gene technology, Inc.;

agarose Bioengineering Ltd.

2) Ultraviolet absorption measurement method

Use of

ND-1000 measures RNA concentration and purity, before the measurement, uses DEPC water for dissolving RNA to adjust zero, the operation method is as follows:

(1) dripping 1ul of DEPC water or RNA sample to the surface of the measuring base;

(2) the liquid drops can automatically form a liquid column between the upper base and the lower base and automatically complete the determination, and various parameters of the RNA concentration and the quality can automatically generate files in a computer;

(3) after one-time measurement is finished, wiping off sample liquid on the surfaces of the upper base and the lower base by using soft lens wiping paper, and then measuring a next sample;

(4) measurement results (EXCEL and JPEG files automatically generated by computer attached to the laboratory report folder):

I. concentration determination

A reading at 260nm of 1 indicates 40ng RNA/ul. The formula for calculating the RNA concentration of the sample is as follows: A260X 40 ng/ul;

the specific calculation is as follows:

RNA was dissolved in 20 μ l DEPC water and 1ul was taken for assay, resulting in a 260-65.003:

the concentration of RNA is 65.003X 40ng/ul 2600.12 ng/ul;

after taking 1ul for measurement, the remaining sample RNA was 19. mu.l, and the total amount of remaining RNA was: 19 mu l X2600.12 ng/ul ═ 49.4 mu g;

II. Purity detection

The ratio of A260/A280 of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

Even if the ratio is outside this range, the RNA sample can be used in common experiments such as Northern hybridization, RT-PCR and RNase protection.

3) Denaturing agarose gel electrophoresis

(1) Gel 1g agarose was dissolved in 72ml water, cooled to 60 ℃ and 10ml 10 × MOPS running buffer and 18ml 37% formaldehyde solution (12.3M) were added, the 10 × MOPS running buffer being shown in Table 1 below:

TABLE 1.10 XMOPS running buffer

And pouring a gel plate, and reserving a sample adding hole to add at least 25 mu l of solution. Taking down the comb after gelation, putting the gel plate into an electrophoresis tank, and adding sufficient 1 XMOPS electrophoresis buffer solution until the surface of the gel is covered by several millimeters;

(2) preparation of RNA samples

Mu.g of RNA was taken, 1 volume of formaldehyde loading dye solution was added, and EB was added to the formaldehyde loading dye solution to a final concentration of 10. mu.g/ml. Heating to 70 ℃ and incubating for 5 minutes to denature the sample;

(3) loading the sample into a gel hole, and performing electrophoresis at a voltage of 5-6V/cm until the bromophenol blue indicator enters gel for at least 2-3 cm;

(4) observing and taking pictures under ultraviolet transmission light

The bands of 28S and 18S ribosomal RNA are very bright and dense (the size depends on the type of species used to extract the RNA), and the density of the upper band is approximately 2 times that of the lower band. It is also possible to observe a smaller, slightly diffused band, which consists of low molecular weight RNA (tRNA and 5S ribosomal RNA). Between the 18S and 28S ribosomal bands, a diffuse piece of EB staining material is typically seen, possibly consisting of mRNA and other heteroRNAs. If DNA contamination occurs during RNA preparation, it will occur above the 28S ribosomal RNA band, i.e., a higher molecular weight diffuse migrating species or band. Degradation of RNA is manifested as a dispersion of bands of ribosomal RNA.

Pretreatment of RNA and cDNA Synthesis

3.1 reagents

rtStar^TMtRF&tiRNA Pretreatment Kit(Cat#AS-FS-005,Arraystar)；

rtStar^TMFirst-Strand cDNA Synthesis Kit(3’and 5’adaptor)(Cat#AS-FS-003,Arraystar)。

3.23' terminal deacetylation treatment

a) The deacetylation reaction solution was prepared according to the following table 2:

TABLE 2 deacetylation reaction solution

Input RNA	≤5μg
		Deacylation Reaction buffer (5X)	3uL
RNase inhibitors	1μL
		Nuclease-free water	xμL
Total volume/sample	15μL

b) Vortex mixing and incubation at 37 ℃ for 40 min;

c) add 19 u L Deacylation Stop Buffer, vortex mixing, room temperature incubation for 5 minutes, Stop the deacetylation reaction.

3.3 removal of 3 '-cP and addition of 5' -P

d) Placing the reaction solution in the previous step on ice, and sequentially adding the reagents in the following table 3:

TABLE 3 reagents to be added

e) Vortex mixing and incubation at 37 ℃ for 40 min;

f) the reaction was terminated by incubation at 70 ℃ for 5 minutes;

g) the RNA was re-extracted.

3.4 Demethylation treatment

h) All reagents except Demethyl laser and Reverse Transcriptase were thawed, vortex mixed, and placed on ice. The two enzymes were removed from the refrigerator prior to use and centrifuged briefly for use;

i) the demethylation reaction solution was prepared according to the following table 4:

TABLE 4 demethylation reaction solution

Nuclease-free water	xμL
		Demethylation Reaction buffer (5X)	10μL
Demethylases	5μL
		RNase inhibitors	1μL
Input RNA	≤5μg
		Total volume/sample	50μL

j) Carrying out demethylation reaction:

incubating in a 37 ℃ Water bath for 2 hours, then adding 40. mu.l of nucleic-free Water and 10. mu.l of methylation Stop Buffer (5X), terminating the Demethylation reaction;

k) the RNA was re-extracted.

3.5 connecting 3' joints

L) the following reagents of Table 5 were added sequentially to 200. mu.L RNase-free PCR tubes:

TABLE 5 reagents to be added

Nuclease-free water	variable
		Sample RNA	0.5-3μL
3’Adaptor	0.5μL
		RNA Spike-in	0.5μL
Total volume	3.5μL

m) incubation for 2 minutes at 70 ℃ in a thermocycler, then transfer the PCR tube to ice;

n) adding the following reagents of Table 6:

TABLE 6 reagents to be added

3’Ligation Reaction Buffer(2X)	5μL
		3’Ligation Enzyme Mix	1.5μL
Total volume	10μL

o) incubation in a thermocycler at 25 ℃ for 1 hour;

note that: prolonged incubation and reduced incubation temperature (18 h; 16 ℃) may increase the efficiency of ligation of methylated modified RNAs such as piRNA, but at the same time tandem products may also be formed.

3.6 hybridization of Reverse Transcription Primer (Reverse Transcription Primer)

This step is critical to inhibit the formation of linker dimers. The reverse transcription primer can hybridize to the excess 3' adaptor, thereby converting the single-stranded DNA adaptor into a double-stranded DNA molecule. The double-stranded DNA molecule is not a substrate of T4 RNA Ligase 1, so that the redundant 3 'adaptor is not connected with the 5' adaptor;

note that: if the initial amount of total RNA is 100ng, the reverse transcription primer is diluted 1:2 with non-enzymatic water.

p) adding the reagents of the following Table 7 to the PCR tube of step o:

TABLE 7 reagents to be added

Nuclease-free water	2.3μL
		Reverse Transcription Primer	0.5μL
Total volume	12.8μL

q) incubation in a thermocycler at 75 ℃ for 5min, at 37 ℃ for 15min and at 25 ℃ for 15min in sequence.

3.7 connecting 5' joints

r) resuspending the 5' linker in 20. mu.L of enzyme-free water;

note that: if the initial amount of total RNA is 100ng, the 5' linker is diluted 1:2 with non-enzymatic water;

s) Add 0.6N μ L of 5' linker to a separate nuclease-free 200 μ L PCR tube. (N is the number of samples treated in the experiment) was incubated for 2 minutes at 70 ℃ in a thermocycler and then immediately cooled on ice;

note that: the remaining 5' resuspension linker was stored in a-80 ℃ freezer. To avoid RNA degradation, please use the linker within 30 minutes after linker denaturation;

t) adding the following reactants in the table 8 into the PCR tube in the step q in sequence, and mixing fully:

TABLE 8 reactants to be added

5′Adaptor(denatured)	0.5μL
		5′Ligation Reaction Buffer	0.5μL
5′Ligation Enzyme Mix	1.2μL
		Total volume	μL

u) incubation at 25 ℃ for 1 hour with a thermocycler.

3.8 reverse transcription reaction

v) add the following reactions of Table 9 in nuclease-free 200 μ L PCR tubes:

TABLE 9 reactants to be added

Adaptor Ligated RNA	15μL
		First-Strand Synthesis Reaction Buffer	4μL
RNase Inhibitor	0.5μL
		Reverse Transcriptase	0.5μL
Total volume	20μL

w) incubation for 1 hour at 50 ℃ in a thermocycler followed by immediate cooling on ice and the reaction product can be used directly in the PCR amplification reaction.

Note that: if PCR amplification is not intended immediately, the thermal cycler is incubated at 70 ℃ for 15 minutes to terminate the RT reaction. The samples were then stored in a-20 ℃ freezer.

NGS high throughput sequencing and analysis

4.1 high throughput sequencing

Before sequencing experiments, we extracted and determined the purity and concentration of total RNA samples using NanoDrop ND-1000. The total RNA sample is pretreated to remove some RNA modification constructed by the interfering RNA-seq library. The total RNA from each sample was then ligated into 3 'and 5' small RNA adapters in sequence. Then, cDNA was synthesized and amplified using RT primers and amplification primers from Illumina. Subsequently, the 160bp PCR amplified fragment of-134-. Finally, the completed library was quantified using an Agilent 2100 bioanalyzer. The library was then denatured, diluted to a loading of 1.3ml and a loading concentration of 1.8 pM. The diluted library was loaded into the kit. Sequencing was performed for 50 cycles on the Illumina NextSeq 500 system using the NextSeq 500/550V2 Kit according to the manufacturer's instructions.

4.2 analysis of biological information

The original Illumina read was first processed to generate three sets of cDNA libraries of 5 samples each. When the quality control of experimental samples is carried out, one sample in the N groups is found to have larger difference in the groups, and the sample is determined to be removed after being considered. Thereafter, the sequencing reads were trimmed at the 5 'and 3' ends with cutadapt, respectively, and the non-reads (length <14nt or length >40nt) were discarded and recorded in FASTA format. Abundance of tRNA-derived fragments was assessed by their sequencing counts, normalized to the total alignment read per million (CPM), and sequences with CPM below 20 were excluded from analysis.

4.3 data analysis

We screened for differentially expressed tRNA-derived fragments under conditions of Fold change >1.5, P < 0.05. At the same time, we use the Off-Line base Caller software v1.8 for image analysis and calling. Analysis plots of Principal Component Analysis (PCA), Venn plots, hierarchical clustering, scatter plots, and volcano plots were performed in the R language for statistical analysis and mapping of the expressed tRNA-derived fragments. Calculations were performed using SPSS 25.0. Normality of data distribution was tested using the KolmogorovSmirnov (KS). Normally distributed variables were compared using one-way analysis of variance, and values were expressed as means ± Standard Deviation (SD). For the abnormally distributed variables, a Mann Whitney U test was used for comparison, and the non-normally distributed variables were expressed in median (interquartile range). All P values were two-sided and P <0.05 was statistically significant.

Further analysis of the deeply sequenced NGS data revealed that there was a difference in tRF-Pro-AGG-007 fragment expression in the plasma of subjects in the healthy physical examiner group and the shingles patient group, with the results shown in table 10.

Table 10 NGS data analysis results of tRF-Pro-AGG-007 (n ═ 5)

Group of

tRF name

Type (B)

Length (nt)

Fold Change

log2FC

P value

Up/Down

A vs N

tRF-Pro-TGG-007

tRF-5c

31

0.034682352

-4.84965445

0.000357534

down

B vs N

tRF-Pro-TGG-007

tRF-5c

31

0.057147678

-4.12916132

0.000621901

down

As can be seen from the above table, the patients with herpes zoster but who did not develop postherpetic neuralgia later, i.e., group a, had a P value of 0.000357534, less than 0.05, which was significantly different from that of the normal healthy patients, i.e., group N. Patients with herpes zoster and later development of postherpetic neuralgia, i.e., group B had a P value of 0.000621901, less than 0.05, significantly different from that of the normal healthy group, i.e., group N. Namely, the expression of the tsRNA marker tRF-Pro-AGG-007 in the plasma of patients with herpes zoster is remarkably different from that of normal healthy people, and the patients with herpes zoster is obviously lower than that of the normal healthy people.

5. Synthetic cDNA for real-time quantitative PCR validation

Further clinical plasma samples were subjected to quantitative analysis of tRF-Pro-AGG-007 using qRT-PCR technique to verify the data analysis results of the above NGS, and qRT-PCR verification was performed on 60 clinical samples (the remaining samples except the NGS analysis in 75 samples), wherein the results are shown in FIG. 1 for 20 of N, 20 of A and 20 of B.

As can be seen from figure 1, tRF-Pro-AGG-007 was significantly down-regulated in both group a and group B compared to group N, < 0.001. This result indicates that tRF-Pro-AGG-007 could be used as a biomarker for the diagnosis of herpes zoster disease.

The specific qRT-PCR procedure is as follows.

5.1 reagent: 2X PCR master mix (Arraystar);

the instrument comprises the following steps: clean benches (Shanghai Boxun industries, Inc. medical facilities);

primer design software: primer 5.0;

QuantStudio^TM5Real-time PCR System(Applied Biosystems)。

5.2 design of primers

The sequence of the upstream primer of the specific primer of the used tRF-Pro-AGG-007 is shown as SEQ ID NO.2, and the sequence of the downstream primer is shown as SEQ ID NO. 3:

SEQ ID NO.2：F：5’GATCGGCTCGTTGGTCTAGG 3’；

SEQ ID NO.3：R：5’GACGTGTGCTCTTCCGATCTAC 3’。

the annealing temperature is 60 ℃, and the length of the product is 55 bp.

The sequence of the upstream primer of the used reference gene U6 is shown as SEQ ID NO.4, and the sequence of the downstream primer is shown as SEQ ID NO. 5:

SEQ ID NO.4：F:5’GCTTCGGCAGCACATATACTAAAAT 3’；

SEQ ID NO.5：R:5’CGCTTCACGAATTTGCGTGTCAT 3’。

the annealing temperature is 60 ℃, and the product length is 89 bp.

5.3 preparation of gradient diluted DNA template for Standard Curve drawing

In the real-time quantitative PCR, the sample loading amount of each sample was 2. mu.l, but the cDNA content in a volume of 2. mu.l of each sample was not completely the same due to the influence of RNA concentration quantitative errors, RNA reverse transcription efficiency errors, and the like, and to correct this difference, a housekeeping gene U6 (the expression amount was substantially constant between different samples) was used as an internal reference.

1) For each gene to be measured (i.e., tRF-Pro-AGG-007) and housekeeping gene (i.e., reference gene U6), a cDNA template determined to express the gene was selected for PCR reaction, and the reaction system is shown in Table 11;

TABLE 11 PCR reaction System

2×Master Mix	5μl
		PCR specific primer F of 10uM	0.5μl
PCR specific primer R of 10uM	0.5μl
		cDNA	2μl
Adding water to the total volume of	10μl

Mixing the solution at the bottom of the flick tube, centrifuging briefly at 5000rpm, setting PCR reaction: at 95 ℃ for 10 min; 40 PCR cycles (95 ℃, 10 sec; 60 ℃, 60 sec (fluorescence collection));

2) carrying out 2% agarose gel electrophoresis on the PCR product and 100bp DNA Ladder, staining by ethidium bromide, and detecting whether the PCR product is a single specificity amplification band;

3) PCR products were diluted in 10-fold gradients: the concentration of the PCR product was set to 1, and the dilution was:

1×10^-1，1×10^-2，1×10^-3，1×10^-4，1×10^-5，1×10^-6，1×10^-7，1×10^-8，1×10^-9several gradients of DNA.

5.4 performing Realtime PCR reaction

4) All cDNA samples were prepared in a Realtime PCR reaction system. The system configuration is shown in table 12 below:

TABLE 12 Realtime PCR reaction System

2×Master Mix	5μl
		PCR specific primer F of 10uM	0.5μl
PCR specific primer R of 10uM	0.5μl
		Adding water to the total volume of	8μl

The solution was mixed by flicking the bottom of the tube and centrifuged briefly at 5000 rpm;

5) sample application

(1) Add 8ul of the mixture to each well of the 384-PCR plate;

(2) then adding corresponding 2 mul cDNA;

(3) carefully sticking a Sealing Film on the Sealing Film, and centrifuging and mixing for a short time;

(4) placing the prepared PCR plate on ice before setting up the PCR program;

6) the 384-PCR plate was placed on a Realtime PCR instrument for PCR:

(1) all the indexes were carried out according to the following procedures: at 95 ℃ for 10 min; 40 PCR cycles (95 ℃, 10 sec; 60 ℃, 60 sec (fluorescence collection));

(2) in order to establish the melting curve of the PCR product, after the amplification reaction is finished, the temperature is controlled according to the formula (95 ℃, 10 seconds, 60 ℃, 60 seconds, 95 ℃, 15 seconds); and slowly heated from 60 ℃ to 99 ℃ (instrument auto-Ramp Rate 0.05 ℃/sec).

5.5 results and calculations

The target gene and housekeeping gene of each sample were subjected to Realtime PCR reaction. According to the drawn gradient dilution DNA standard curve, the concentration results of the target genes and housekeeping genes of each sample are directly generated by a machine. The corrected relative content of the gene in each sample is obtained by dividing the concentration of the target gene by the concentration of the housekeeping gene, wherein the standard curve, the amplification curve and the dissolution curve of tRF-Pro-AGG-007 are respectively shown in FIGS. 2, 3 and 4, and the standard curve, the amplification curve and the dissolution curve of the housekeeping gene U6 are respectively shown in FIGS. 5, 6 and 7.

Sequence listing

<110> Host Hospital of Jiaxing City

<120> blood tsRNA marker of herpes zoster, preparation and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212> DNA

<213> DNA sequence of tRF-Pro-AGG-007 (DNA sequence of tsRNA)

<400> 1

ggctcgttgg tctaggggta tgattctcgg t 31

<210> 2

<211> 20

<212> DNA

<213> DNA sequence (primer) of upstream primer of tRF-Pro-AGG-007

<400> 2

gatcggctcg ttggtctagg 20

<210> 3

<211> 22

<212> DNA

<213> DNA sequence (primer) of downstream primer of tRF-Pro-AGG-007

<400> 3

gacgtgtgct cttccgatct ac 22

<210> 4

<211> 25

<212> DNA

<213> DNA sequence (primer) of upstream primer of U6 Gene

<400> 4

gcttcggcag cacatatact aaaat 25

<210> 5

<211> 23

<212> DNA

<213> DNA sequence (primer) of downstream primer of U6 Gene

<400> 5

cgcttcacga atttgcgtgt cat 23

Claims (7)

1. A blood tsRNA marker of herpes zoster is characterized in that blood marker tsRNA is tRF-Pro-AGG-007, and the sequence of the blood marker tsRNA is shown as SEQ ID NO. 1;

SEQ ID NO.1：GGCTCGTTGGTCTAGGGGTATGATTCTCGGT。

2. use of a blood tsRNA marker according to claim 1 as a detection target in the preparation of a diagnostic reagent for herpes zoster.

3. A detection reagent for detecting the blood tsRNA marker of claim 1, wherein the detection reagent is a specific primer, probe or chip for detecting the blood tsRNA marker of claim 1.

4. The detection reagent according to claim 3, wherein the upstream primer sequence of the specific primer is shown as SEQ ID No.2, and the downstream primer sequence is shown as SEQ ID No. 3:

SEQ ID NO.2：F：5’GATCGGCTCGTTGGTCTAGG 3’；

SEQ ID NO.3：R：5’GACGTGTGCTCTTCCGATCTAC 3’。

5. use of the detection reagent according to claim 3 or 4 for the preparation of a diagnostic reagent for herpes zoster.

6. A diagnostic kit for herpes zoster, which comprises the detection reagent according to claim 3 or 4.

7. The diagnostic kit of claim 6, wherein the diagnostic kit is used to detect the expression level of the blood tsRNA marker of claim 1.

Images