CN113304165B

CN113304165B - Application of monomeric compound Ciliaoside A in preparation of hepatitis B treatment drug

Info

Publication number: CN113304165B
Application number: CN202110802618.XA
Authority: CN
Inventors: 陈娟; 黄爱龙; 程胜桃; 任放
Original assignee: Chongqing Medical University
Current assignee: Chongqing Medical University
Priority date: 2021-07-15
Filing date: 2021-07-15
Publication date: 2022-07-22
Anticipated expiration: 2041-07-15
Also published as: CN113304165A

Abstract

The invention discloses an application of a monomeric compound Ciliatoside A in preparing a medicament for treating hepatitis B. The invention verifies that the monomeric compound Ciliatoside A has the anti-HBV function for the first time in vitro and in vivo, and can obviously inhibit HBsAg, HBV RNAs and HBV DNA levels in liver cancer cells such as HepG2.2.15, HepG2-NTCP and the like; further in vivo experiments show that the compound can obviously inhibit indexes such as mouse serum, liver tissue HBV DNA and the like. Therefore, the invention provides the application of the monomer compound Ciliaoside A in preparing the hepatitis B treatment medicine, and provides a new choice for treating hepatitis B.

Description

Application of monomeric compound Ciliatoside A in preparation of hepatitis B treatment drug

Technical Field

The invention relates to the technical field of biomedicine, in particular to application of a monomeric compound Ciliatoside A in preparing a medicament for treating hepatitis B.

Background

Viral hepatitis is classified as a type B infectious disease in China, and among the viruses causing hepatitis, Hepatitis B Virus (HBV) is the most common one. HBV belongs to the hepadnaviridae and is the smallest DNA virus currently known to infect humans. Although one has had a safe and effective vaccine available for more than 30 years, HBV infection remains a major world health burden. Hepatitis b is defined as persistent infection of the hepatitis b virus for more than 6 months, with hepatitis b becoming a worldwide epidemic with about 2.57 billion hepatitis b infected people worldwide and about 887,000 people dying from HBV infection each year, as counted by the world health organization. At present, the drugs for treating hepatitis B are mainly nucleoside analogs and interferon, and the nucleoside analogs can obviously reduce viremia, but are easy to cause drug resistance after long-term administration. Interferon cannot be widely used clinically due to its low reactivity and poor tolerance. Moreover, the two medicines are difficult to realize the 'functional cure' of hepatitis B, namely, hepatitis B surface antigen is eliminated within a limited course of treatment. Therefore, the development of a curative medicament for hepatitis B is still a problem to be solved urgently.

In the course of the human struggling against diseases for a long time, traditional Chinese medicines play a very important role, and are reported to treat various diseases. The components of the traditional Chinese medicine are very complex, and the separation is realized effectively by utilizing the modern mature separation technologyThe separation of the components can develop a wider visual field for exploring Chinese medicine treasury for human beings. By using methods such as ultra-high performance liquid chromatography, electrospray ionization flight mass spectrometry analysis, nuclear magnetic resonance identification and the like, the inventor separates high-purity monomer compound Ciliatoside A (C6, C for short) from crude extracts of traditional Chinese medicines₃₆H₄₀O₁₉). Currently, studies report that Ciliatoside A is isolated from a plant of the family Acanthaceae and has anti-inflammatory effects in vitro. However, no report has been made on the antiviral action of Ciliatoside A.

Disclosure of Invention

In view of the defects of the prior art, the invention aims to provide the application of the monomeric compound Ciliaoside A in preparing the medicine for treating hepatitis B, and the invention discovers and verifies the monomeric compound Ciliaoside A (C6, C for short) for the first time₃₆H₄₀O₁₉) Has obvious anti-HBV function and is expected to be developed into a curative drug for hepatitis B.

To achieve the above and other related objects, the present invention provides, in a first aspect, the use of the monomeric compound cilatoside a as an active ingredient for the manufacture of a medicament for the treatment of hepatitis b.

The chemical formula of Ciliatoside A is C₃₆H₄₀O₁₉The chemical structural formula is as follows:

further, the hepatitis B therapeutic agent has at least one of the following functions: inhibiting the HBsAg level in the liver cancer cell, inhibiting the HBV RNAs level in the liver cancer cell, and inhibiting the HBV DNA level in the liver cancer cell.

Further, the liver cancer cell is at least one selected from HepG2.2.15 and HepG2-NTCP cell.

Furthermore, the hepatitis B therapeutic drug necessarily comprises the monomeric compound Ciliatoside A, and the monomeric compound Ciliatoside A is taken as an effective component of the function.

Furthermore, in the hepatitis B therapeutic drug, the effective component exerting the functions can be only a monomeric compound Ciliatoside A, and other molecules capable of playing similar functions can also be contained.

Further, the monomeric compound Ciliaoside A is the only effective component or one of the effective components of the hepatitis B therapeutic drug.

Furthermore, the hepatitis B therapeutic drug can be a single-component substance or a multi-component substance.

Furthermore, the form of the hepatitis B therapeutic drug is not particularly limited, and the drug can be in the form of various substances such as solid, liquid, gel, semifluid, aerosol and the like.

Further, the hepatitis b therapeutic agent is mainly directed to mammals such as rodents, primates and the like.

The invention provides a medicament for treating hepatitis B, which comprises a safe and effective dose of a monomeric compound Ciliatoside A.

Further, the monomeric compound Ciliatoside A is the only effective component or one of the effective components of the hepatitis B therapeutic drug.

Furthermore, the pharmaceutical preparation for treating hepatitis B also comprises a pharmaceutically acceptable carrier and/or an auxiliary material.

Furthermore, the medicinal preparation for treating hepatitis B necessarily comprises the monomeric compound Ciliaoside A, and the monomeric compound Ciliaoside A is taken as an effective component of the function.

Furthermore, in the pharmaceutical preparation for treating hepatitis B, the active ingredient having the aforementioned function may be only the monomeric compound Ciliatoside A, and may also include other molecules having similar functions.

Further, the monomeric compound Ciliatoside A is used as one of the effective components or the only effective component of the pharmaceutical preparation for treating hepatitis B.

Furthermore, the medicinal preparation for treating hepatitis B can be a single-component substance or a multi-component substance.

Furthermore, the form of the pharmaceutical preparation for treating hepatitis B is not particularly limited, and can be in the form of various substances such as solid, liquid, gel, semifluid, aerosol and the like.

Furthermore, the pharmaceutical preparation for treating hepatitis B is mainly aimed at mammals, such as rodents, primates and the like.

In a third aspect, the invention provides a method of treating hepatitis b by administering to a subject the monomeric compound cilatoside a.

Further, the subject may be a mammal or a mammalian hepatitis b cell. The mammal is preferably a rodent, artiodactyla, perissodactyla, lagomorpha, primate, or the like. The primate is preferably a monkey, ape or human. The hepatitis b cell may be an isolated hepatitis b cell.

Further, the subject may be a patient suffering from hepatitis b or an individual in whom treatment of hepatitis b is desired. Alternatively, the subject is a hepatitis b cell of a hepatitis b patient or an individual expected to treat hepatitis b.

Further, the monomeric compound cilatoside a may be administered to a subject before, during, or after receiving hepatitis b therapy.

The invention provides a pharmaceutical composition for treating hepatitis B, which comprises a safe and effective dose of a monomeric compound Ciliaoside A, at least one other hepatitis B treatment drug and the balance of pharmaceutically acceptable carriers and/or auxiliary materials.

Further, the hepatitis b therapeutic drug combination may be in any one of the following forms:

the monomer compound Ciliatoside A and other hepatitis B treating medicine are prepared into independent preparation in the same or different dosage forms and different or same administration routes.

When the other therapeutic agent for hepatitis B is an antibody, a parenteral administration type is generally employed. When other hepatitis B treatment drugs are chemical drugs, the administration forms can be rich, and the drug can be administered in the gastrointestinal tract or can be administered in the parenteral tract. Known routes of administration for each chemical are generally recommended.

And (II) the monomer compound Ciliaoside A and other hepatitis B treatment medicaments are prepared into a compound preparation, and when the monomer compound Ciliaoside A and other hepatitis B treatment medicaments are administered by the same administration route and are applied simultaneously, the monomer compound Ciliaoside A and other hepatitis B treatment medicaments can be prepared into the form of the compound preparation.

In a fifth aspect, the present invention provides a method for treating hepatitis b by administering to a subject an effective amount of the monomeric compound cilatoside a and administering to the subject an effective amount of another hepatitis b treatment drug and/or performing another hepatitis b treatment to the subject.

Further, an effective dose of the monomeric compound cilatoside a and at least one other hepatitis b therapeutic agent may be administered simultaneously or sequentially.

The monomeric compound Ciliaoside A is the first hepatitis B treating medicine discovered by the invention, and the medicine can at least play a role in adding curative effects in the combined use of the monomeric compound Ciliaoside A and other hepatitis B treating medicines except the monomeric compound Ciliaoside A, so that the treatment effect on the hepatitis B is further enhanced.

Further, other therapeutic agents for hepatitis b include, but are not limited to: antibody drugs, chemical drugs or targeted drugs, etc.

Further, the monomeric compound cilatoside a may be administered gastrointestinal or parenteral, and the other therapeutic agents for hepatitis b may be administered gastrointestinal or parenteral. For antibody drugs, parenteral administration is generally employed.

In a sixth aspect, the invention provides the use of the monomeric compound cilatoside a in the preparation of a substance which acts as any one or more of:

the application of the compound in preparing a substance for inhibiting the level of HBsAg in liver cancer cells, the application in preparing a substance for inhibiting the level of HBV RNAs in the liver cancer cells and the application in preparing a substance for inhibiting the level of HBV DNA in the liver cancer cells.

As described above, the application of the monomeric compound Ciliatoside A in preparing the hepatitis B therapeutic drug has the following beneficial effects:

the invention discovers and verifies the anti-HBV effect of the monomeric compound Ciliatoside A for the first time, and in vitro experiments prove that the monomeric compound Ciliatoside A can obviously inhibit the levels of HBsAg, HBV RNAs and HBV DNA in liver cancer cells such as HepG2.2.15, HepG2-NTCP and the like; further in vivo experiments show that the monomeric compound Ciliatoside A can obviously inhibit indexes such as mouse serum and liver tissue HBV DNA and the like. Therefore, the invention discovers for the first time that the monomeric compound Ciliatoside A has obvious anti-HBV effect, is expected to be developed into a curative medicament for hepatitis B and has wide application prospect in the aspect of hepatitis B treatment.

Drawings

FIG. 1 shows the molecular structural formula of the monomeric compound Ciliatoside A (abbreviated as C6) of the present invention.

FIG. 2 is a graph showing the results of the MTT assay for C6 cytotoxicity in the examples of the present invention.

FIG. 3 shows that C6 inhibits secretion of EC from supernatant HBsAg in example of the present invention₅₀The value is obtained.

FIG. 4 shows the measurement of HBsAg and HBeAg secretion levels in HepG2.2.15 cells by ELISA in the examples of the present invention.

FIG. 5 shows the detection of intracellular HBsAg levels by Western blotting in the examples of the present invention.

FIG. 6 is a graph showing the effect of Real-time PCR detection C6 on HBV RNA in the present example.

FIG. 7 is a graph showing the results of Northern blotting performed to verify the effect of C6 on HBV RNA in the examples of the present invention.

FIG. 8 is a graph showing the effect of quantitative PCR detection of C6 in HepG2.2.15 cells on HBV DNA in the examples of the present invention.

FIG. 9 is a graph showing the results of detecting the effect of C6 on the secretion levels of HBsAg and HBeAg in HepG2-NTCP cells in the examples of the present invention.

FIG. 10 shows the Real-time PCR assay for HBV RNA levels after C6 treatment in the examples of the present invention.

FIG. 11 is a graph showing the detection of HBV RNA and HBV DNA levels in HepG2-NTCP cells 10d after C6 treatment in example of the present invention.

FIG. 12 is a flow chart showing the treatment of mice in the examples of the present invention.

FIG. 13 is a graph showing the results of detecting the effect of C6 on the serum level of HBsAg and HBV DNA in the examples of the present invention.

FIG. 14 is a graph showing the results of detecting the effect of C6 on the level of HBV RNA in liver tissue in the examples of the present invention.

FIG. 15 is a graph showing the effect of C6 on HBV DNA levels in liver tissue in the present example.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

By using methods such as ultra-high performance liquid chromatography, electrospray ionization flight mass spectrometry analysis, nuclear magnetic resonance identification and the like, the inventor of the invention separates a high-purity monomer compound Ciliatoside A (C6, C for short) from a crude extract of a traditional Chinese medicine (a acanthaceae plant)₃₆H₄₀O₁₉) The molecular structural formula is shown in figure 1. The retrieval and comparison show that the monomer compound Ciliaoside A extracted by the invention has the same chemical structural formula with the compound Ciliaoside A in the existing research report, so the extraction method is not repeated herein. The current research reports that Ciliatoside A can be separated from acanthaceae plants and has anti-inflammatory effect in vitro; however, no report has been made on the antiviral action of Ciliatoside A.

The invention discovers and verifies the anti-HBV effect of the monomeric compound Ciliatoside A through in vitro experiments and in vivo experiments for the first time, so that the monomeric compound Ciliatoside A can be used for treating hepatitis B, and a new choice is provided for treating hepatitis B.

Based on the above, the invention provides a monomer compound Ciliaoside A used as an active ingredient for preparing a medicament for treating hepatitis B. Generally, the hepatitis B treatment drug comprises a safe and effective dose of the monomeric compound Ciliatoside A, and also comprises one or more pharmaceutically acceptable carriers or auxiliary materials according to the requirements of different drug dosage forms.

By "pharmaceutically acceptable" it is meant that the molecular entities and compositions do not produce adverse, allergic, or other untoward reactions when properly administered to an animal or human.

The "pharmaceutically acceptable carrier or adjuvant" should be compatible with, i.e. able to be blended with, the monomeric compound cilatoside a without substantially reducing the effectiveness of the pharmaceutical composition in the usual way. Specific examples of some substances that can serve as pharmaceutically acceptable carriers or adjuvants are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethylcellulose and methylcellulose; powdered tragacanth; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyhydric alcohols such as glycerol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; a colorant; a flavoring agent; tableting agents, stabilizers; an antioxidant; a preservative; pyrogen-free water; isotonic saline solution; and phosphate buffer, and the like. These materials are used as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouth feel or odor in the case of oral administration.

In the present invention, unless otherwise specified, the pharmaceutical formulation is not particularly limited, and may be prepared into injections, oral liquids, tablets, capsules, pills, sprays and the like, and may be prepared by a conventional method. The choice of the pharmaceutical dosage form should be matched with the mode of administration.

In addition, the invention also provides a hepatitis B therapeutic drug combination and an application method, and the hepatitis B therapeutic drug combination can be any one of the following forms:

the monomer compound Ciliaoside A and other chronic hepatitis B treating medicine are prepared separately in the same or different preparation forms and through different administration routes. When in use, several medicines can be used simultaneously or sequentially. When administered sequentially, the other drug should be administered to the body during the period in which the first drug is still effective in the body.

When the other therapeutic agent for hepatitis B is an antibody, a parenteral administration type such as intravenous injection, intravenous drip or arterial infusion is generally used. The usage and the dosage can refer to the prior art.

When other hepatitis B treating medicines are chemical medicines, the administration forms can be rich, and the medicines can be administered in the gastrointestinal tract or parenteral tract. Known routes of administration for each chemical are generally recommended.

And (II) when the monomer compound Ciliatoside A and other chronic hepatitis B therapeutic drugs are prepared into a compound preparation and administered by the same administration route and applied at the same time, the monomer compound Ciliatoside A and other chronic hepatitis B therapeutic drugs can be prepared into the form of the compound preparation.

It should be noted that the combination in the present invention refers to a reasonable combination, and should be based on the principle of improving the therapeutic effect and/or reducing the adverse reaction. When used in combination, drug interactions shall include those that affect pharmacokinetics and those that affect pharmacodynamics. When the drugs are used in combination, the drug types are reduced as much as possible, adverse drug reactions caused by drug interaction are reduced, the influence on the curative effect of the drugs or the increase in toxicity is avoided, and adverse results are avoided.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, the invention may be practiced using any method, device, and material that is similar or equivalent to the methods, devices, and materials described in examples herein, in addition to those described in prior art practice and the description herein.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

In the following examples, the monomeric compound Ciliatoside A is abbreviated as C6.

The specific experimental process of the invention is as follows:

1. drug treatment

1.1 drug toxicity test (MTT test)

Will be 1.5X 10⁴HepG2.2.15 cells were seeded in 96-well plates and, 24 hours later, C6 (stock concentration 20mM) was diluted in duplicate (200, 100, 50, 25, 12.5, 6.25, 3.1, 1.6. mu.M) with drug-free control, pure medium blank, 3 duplicate wells per concentration. After treating cells for 72 hours at the series of drug concentrations, 10. mu.l of 5mg/ml MTT reagent was added to each well and incubated for 4 hours in the dark. Discarding supernatant, adding 100 μ l DMSO into each well, shaking, mixing, detecting OD value at 490nm wavelength, and calculating CC₅₀The value is obtained.

1.2 detection of the Effect of C6 on HBsAg secretion in cells of the Stable replication model HepG2.2.15

1.2.1, 12X 10⁴HepG2.2.15 cells were seeded in twenty-four well plates and after 24 hours solutions of 50, 25, 12.5, 6.25, 3.1, 1.6, 0.78, 0.39, 0. mu. M C6 were prepared, 500. mu.l of each well. 72After hours, cell supernatants were collected, HBsAg was detected by ELISA, and C6 concentrations (2.5. mu.M, 5. mu.M) effective in inhibiting HBsAg levels were selected for subsequent experiments.

1.2.2, 24X 10⁴HepG2.2.15 cells were seeded in a twelve-well plate, and after 24 hours, 0, 2.5 and 5. mu. M C6 solutions were prepared, 25nM Entecavir (ETV) was used as a control, 1ml of the above solutions was added to each well, cell supernatants were collected after 3d, 6d and 9d of drug treatment, respectively, and HBsAg and HBeAg were detected by ELISA.

1.3, detecting the influence of C6 on intracellular HBsAg and HBV RNA in HepG2.2.15 cells of a stable replication model

Will be 24X 10⁴HepG2.2.15 cells are inoculated in a twelve-well plate, after 24 hours, 0, 2.5 and 5 mu M C6 solutions are prepared, 25nM ETV is used as a reference, 1ml of the solution is respectively added into each well, cell proteins and intracellular RNA are respectively extracted after 3d, 6d and 9d of drug treatment, the intracellular HBsAg level is detected by western blotting, and the 3.5-kb RNA and total HBV RNAs level are detected by real-time PCR and Northern blotting.

1.4 detection of antiviral efficacy of C6 in HBV-infected cell model HepG2-NTCP

22 x 10 of⁴HepG2-NTCP cells were plated on twelve-well plates, and after 24 hours the infection medium (10% FBS, 1% P/S, 2% DMSO, 1% L-glutamine) was changed and incubated in the infection medium for 24 hours before infecting the virus. Preparation of 1X 10³Geq/cell virus suspension (containing 5% PEG8000), after 24 hours and 3 times of PBS washing, different concentrations of C6 solution were prepared to treat the cells 10 d.

1.5, detecting antiviral efficacy of C6 in constructed recombinant cccDNA mouse model

1.5.1 construction of recombinant cccDNA mouse model

Several male C57BL/6 mice were selected with a body weight close (20 + -2.0 g), each mouse injected with 4. mu.g each of plasmid Cre and prcccDNA using high pressure water dynamic tail vein. One week later orbital bleeds were used to detect serum HBV DNA levels.

1.5.2 recombinant cccDNA mouse model drug treatment and index detection

Successfully constructed mice were randomly divided into a control group (Vehicle), a treatment group (C6) and a combination group (C6+ ETV). Intraperitoneal injection of 0.5mg/kg of C6 and normal saline, intragastric administration of entecavir, once every two days, orbital blood collection every four days, serum separation, and serum HBV DNA and HBsAg level detection. The mice were sacrificed after 20 days of drug treatment, the liver was taken to make tissue slices to detect the level of HBsAg, and the liver tissue was ground to detect the level of HBV RNAs and HBV DNA.

2. HBV virology index detection

2.1 drug toxicity testing (MTT test)

Mixing 1.5X 10⁴HepG2.2.15 cells and 1.5X 10⁴HepG2-NTCP cells were seeded in 96-well plates, treated for 72 hours at serial drug concentrations, 10. mu.l of 5mg/ml MTT reagent was added to each well, incubated for 4 hours in the dark, the supernatant was discarded, and 100. mu.l DMSO was added to each well. After oscillating and mixing uniformly, detecting the absorbance value at 490nm wavelength and calculating CC₅₀The value is obtained.

2.2 ELISA experiments

Detection of the effect of C6 on HBV antigen secretion in HepG2.2.15 and HepG2-NTCP cells: collecting cell supernatant after C6 treatment, centrifuging for 2,000g × 3min to remove cell debris, and detecting OD values of HBsAg and HBeAg in cell culture supernatant at 450nm according to the operation instruction of enzyme linked immunosorbent assay kit (Shanghai Kehua).

2.3 Western blotting experiment

After washing the cells with PBS, RIPA (containing PI) lysate was added to lyse the cells, protein concentration was determined by BCA method, and 30. mu.g of protein was used for SDS-PAGE gel electrophoresis. After the membrane was blocked with 5% skim milk, anti-HBs antibody (Novus, 1: 2000) was incubated overnight at 4 ℃. After incubation of the corresponding secondary antibodies at room temperature, ECL chemiluminescent reagents were added dropwise to the membranes and exposed to light in the dark.

2.4 extraction of cellular HBV RNA

PBS washes the cell for 2 times, adds 1ml Trnzol lysis liquid, after mixing, adds 200 μ l chloroform, after vortex, centrifuges at 13,000rpm x 10min 4 deg.C, absorbs the supernatant, adds in isopyknol, centrifuges at 13,000rpm x 10min 4 deg.C to precipitate, after removing the supernatant, adds 75% ethanol to wash the precipitate, after centrifuges at 13,000rpm x 10min 4 deg.C, removes the supernatant and dries the RNA precipitate, adds in water to dissolve, after measuring the concentration, uses the TIANGGEN company Fast kingRT Kit to reverse transcribe RNA to synthesize cDNA.

2.5 extraction of HBV DNA from mouse serum

Using the viral genomic DNA extraction kit (TIANGEN), an enzyme-free EP tube was prepared, 20. mu.l of proteinase K was added thereto, and 10. mu.l of serum was added to each tube and the total volume was adjusted to 200. mu.l with physiological saline. Finally, 200 mul of Carrier RNA working solution is added, vortex mixing is carried out, and the mixture is placed in a water bath at 56 ℃ for 15 min. After washing through a series of centrifugal adsorption columns, 20. mu.l of enzyme-free water was added. The extracted DNA was placed at-40 ℃ or used for PCR assay.

2.6 extraction of HBV DNA and HBV RNA from mouse liver tissue

Mouse livers were isolated and tissue blocks ground in liquefied nitrogen and approximately 20mg of tissue was weighed into 1.5ml centrifuge tubes for DNA and RNA extraction, respectively.

2.6.1 extraction of HBV DNA from liver tissue

0.5ml of a lysis solution (10mM Tris-HCl pH8.0, 1mM EDTA, 1% NP-40, 2% sucrose) was added to the centrifuge tube, homogenized, incubated at 37 ℃ for 15min, and centrifuged at 15000g for 5 min. The supernatant was transferred and 40U/ml DNaseI and 10mM MgCl were added₂After incubation at 37 ℃ for 4h, 200. mu.l of 35% PEG8000 (containing 1.5mol/L NaCl), centrifuged at 11,000 g.times.10 min at 4 ℃ after 1h in ice bath, the supernatant discarded, and 0.5ml of proteinase K digest (0.5% SDS, 150mM NaCl, 25mM Tris-HCl pH8.0, 10mM EDTA) and 0.5mg/ml proteinase K (promega) were added overnight in a 45 ℃ water bath. The next day, phenol chloroform extraction, 70% ethanol precipitation, TE buffer solution to dissolve HBV DNA.

2.6.2 extraction of HBV RNA from liver tissue

About 20mg of the ground tissue was taken, 1ml of Trnzol lysate was added, and a small disperser (T10 basic) was used

) Assisted lysis, mixing, adding 200 μ l chloroform, vortex, centrifuging at 13,000rpm × 10min 4 deg.C, sucking supernatant, adding equal volume of isopropanol, centrifuging at 13,000rpm × 10min 4 deg.C for precipitation, removing supernatant, washing precipitate with 75% ethanol, centrifuging at 13,000rpm × 10min 4 deg.C, removing precipitateThe supernatant was removed and the RNA precipitate was dried, dissolved in water, and after concentration measurement, cDNA was synthesized by reverse transcription of RNA using Fast Kit RT Kit from TIANGEN.

2.7、Real-time PCR

Detection of HBV DNA: after extracting HBV DNA, a reaction system was prepared and reaction conditions were set according to SYBR Green (Roche, Germany) instructions, HBV DNA primers, F: CCTAGTAGTCAGTTATGTCAAC and R is TCTATAAGCTGGAGGAGTGCGA. Each sample was provided with 3 replicate wells, and each set of experiments was replicated 3 times.

Detecting HBV RNA, namely cDNA synthesized by reverse transcription of RNA, preparing a reaction system and setting reaction conditions according to SYBR Green (Bio-Rad) instructions, wherein HBV 3.5-kb RNA primer is F: CTCTTCCAGCCTTCCTTCCT, R: AGCACTGTGTTGGCGTACAG, total HBV RNAs primer is F: ACCGACCTTGAGGCATACTT, and R: GCCTACAGCCTCCTAGTACA. Each sample was provided with 3 replicate wells, and each set of experiments was replicated 3 times.

3. Statistical method

SPSS 19.0 software is adopted for statistics, pairing t test is adopted for comparison between two groups, one-factor variance analysis is adopted for comparison between multiple groups, and P <0.05 is taken as difference, so that statistical significance is achieved.

4. Results of the study

4.1 detection of cytotoxicity

As shown in FIG. 2, MTT assay showed C6 in HepG2.2.15 and HepG2-NTCP cells_C50Values greater than 200 μ M indicate that C6 is not significantly cytotoxic in both cell lines.

4.2 testing of the Effect of C6 on antigen secretion in HepG2.2.15 cells

The HBsAg secretion level was measured by treating HepG2.2.15 cells at a series of concentrations C6, and the EC50 value was calculated to be 3.36. mu.M, and the results are shown in FIG. 3. As shown in fig. 3, after 3d, 6d, and 9d of drug treatment, cell supernatants were collected and tested for HBsAg and HBeAg levels by ELISA, and the results of the experiment showed that C6 decreased HBsAg and HBeAg levels in the supernatant in a time-dependent and concentration-dependent manner as compared to the control (fig. 4).

4.3 and HepG2.2.15 intracellular detection of the influence of C6 on intracellular HBsAg and HBV RNA

And extracting protein after cell lysis, and detecting the expression level of the HBsAg by western blotting. The results show (figure 5) that C6 decreased intracellular HBsAg levels time-dependently and concentration-dependently. The intracellular HBV RNA is detected by Real-PCR, C6 reduces the intracellular total HBV RNA in a time-dependent and concentration-dependent manner, the RNA level is 3.5-kb (figure 6), and the PCR result is verified by Northern blotting (figure 7).

4.4 testing the Effect of C6 on the level of HBV DNA in HepG2.2.15 cells

The result of quantitative PCR detection of HBV DNA extracted from cells shows that C6 can significantly inhibit HBV DNA level (FIG. 8).

4.5 detection of antiviral potency of C6 in HBV-infected cell model HepG2-NTCP

C6 processing HepG2-NTCP cell 10d, collecting cell supernatant to detect HBsAg and HBeAg, and collecting cell to detect HBV RNA and HBV DNA. The results show that C6 can significantly inhibit the supernatant HBsAg and HBeAg levels (FIG. 9) and the intracellular HBV RNA and HBV DNA levels (FIGS. 10-11).

4.6 verification of anti-HBV Effect of C6 in recombinant cccDNA mouse model

The mouse processing flow is shown in FIG. 12, and serum of the mouse is separated to detect HBsAg and HBV DNA. The results show (fig. 13) that compared with the control group, the C6 treated group and the combined drug group (C6+ ETV) can significantly inhibit the serum HBsAg and HBV DNA levels, wherein the combined drug group has a stronger inhibitory effect than the C6 single drug group. Further detecting the levels of HBV RNAs and HBV DNA in liver tissue, the experimental results show that the C6 treatment group and the combination group (C6+ ETV) can obviously inhibit the levels of HBV RNAs (figure 14) and HBV DNA (figure 15) in liver tissue. After ETV is combined, the inhibition effect is obviously enhanced.

In conclusion, the invention firstly verifies the anti-HBV effect of the monomeric compound Ciliatoside A in vitro and in vivo, and in vitro experiments prove that C6 can obviously inhibit the levels of HBsAg, HBV RNAs and HBV DNA in liver cancer cells such as HepG2.2.15, HepG2-NTCP and the like; further in vivo experiments show that C6 can obviously inhibit indexes such as mouse serum and liver tissue HBV DNA and the like. These results indicate that C6 has significant anti-HBV effect and is expected to be developed into a curative drug for hepatitis B.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Those skilled in the art can modify or change the above-described embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

SEQUENCE LISTING

<110> university of Chongqing medical science

<120> application of monomeric compound Ciliaoside A in preparation of hepatitis B treatment drugs

<130> PCQYK2110553-HZ

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial

<220>

<223> HBV DNA primer F

<400> 1

cctagtagtc agttatgtca ac 22

<210> 2

<211> 22

<212> DNA

<213> Artificial

<220>

<223> HBV DNA primer R

<400> 2

tctataagct ggaggagtgc ga 22

<210> 3

<211> 20

<212> DNA

<213> Artificial

<220>

<223> HBV 3.5-kb RNA primer F

<400> 3

ctcttccagc cttccttcct 20

<210> 4

<211> 20

<212> DNA

<213> Artificial

<220>

<223> HBV 3.5-kb RNA primer R

<400> 4

agcactgtgt tggcgtacag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial

<220>

<223> total HBV RNAs primer F

<400> 5

accgaccttg aggcatactt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial

<220>

<223> Total HBV RNAs primer R

<400> 6

gcctacagcc tcctagtaca 20

Claims

1. Use of monomeric compound Ciliatoside A in preparing medicine for treating hepatitis B.

2. Use according to claim 1, characterized in that: the hepatitis B therapeutic drug has at least one of the following functions: inhibiting the HBsAg level in the liver cancer cell, inhibiting the HBV RNAs level in the liver cancer cell, and inhibiting the HBV DNA level in the liver cancer cell.

3. Use according to claim 2, characterized in that: the liver cancer cell is at least one selected from HepG2.2.15 and HepG2-NTCP cell.