CN113292656B

CN113292656B - Fusion protein of mesencephalon astrocyte-derived neurotrophic factor for preventing and treating obesity

Info

Publication number: CN113292656B
Application number: CN202010107989.1A
Authority: CN
Inventors: 何金汗; 李艳萍; 吴桐
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2020-02-21
Filing date: 2020-02-21
Publication date: 2022-10-25
Anticipated expiration: 2040-02-21
Also published as: CN113292656A

Abstract

The invention relates to a midbrain astrocyte-derived neurotrophic factor fusion protein for preventing and treating obesity, belonging to the technical field of biological medicines. The invention provides a midbrain astrocyte-derived neurotrophic factor fusion protein, which at least comprises the following two fragments: the amino acid sequence of mesencephalon astrocyte-derived neurotrophic factor and the amino acid sequence of immunoglobulin Fc fragment. The fusion protein has good stability and long half-life period, can be used for treating obesity, diabetes and other metabolic diseases, and has wide application prospect.

Description

Fusion protein of mesencephalon astrocyte-derived neurotrophic factor for preventing and treating obesity

Technical Field

The invention relates to a midbrain astrocyte-derived neurotrophic factor fusion protein for preventing and treating obesity, belonging to the technical field of biological medicines.

Background

With the development of social economy and the change of life styles of people, obesity becomes a serious global public health problem and is an important risk factor for the development of hypertension, diabetes, cardiovascular and cerebrovascular diseases and the like. The search for safe and effective fat-reducing and weight-losing methods is one of the hotspots of the current medical research.

The main cause of obesity development is long-term dysregulation of energy balance, including excessive intake and consumption, resulting in excess energy being stored in the adipose tissue in the form of triglycerides. Adipose tissue can be classified into white adipose tissue, brown adipose tissue, and beige adipose tissue. White adipose tissue stores and releases energy primarily in the form of triglycerides. Brown adipose tissue is effective in dissipating chemical energy in the form of heat. In addition, white adipocytes can be stimulated by factors such as cold and exercise to produce "white fat brownish" cells, which are then transformed into beige adipocytes. Research shows that the beige adipose tissue can increase heat production of an organism, improve energy metabolism of the organism, inhibit obesity formation and improve insulin resistance. Therefore, the method can induce or promote the generation of beige lipogenesis and provide a new idea for preventing and treating metabolic diseases such as obesity and the like. The production of beige adipose tissue is regulated by a variety of factors, of which secreted factors are an important class of regulatory factors. Research shows that various secretion factors, such as natriuretic peptide, BMP7/BMP4, FGF21, irisin and the like, can be secreted from corresponding organs, enter blood circulation and reach adipose tissues, and the generation of beige adipocytes is promoted.

Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a novel neurotrophic factor and is also a secreted protein. Recent researches show that MANF plays an important role in metabolic diseases such as obesity, diabetes and the like, and is a protein polypeptide drug with clinical application potential. However, as is well known, protein drugs are easily degraded by proteases in gastrointestinal tracts, and are only limited to injection administration, and because of the short half-life of protein polypeptide drugs in plasma, the protein polypeptide drugs often need to be repeatedly injected for a plurality of times every day in order to achieve effective treatment concentration, which undoubtedly brings inconvenience to clinical use.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the present invention aims to provide a fusion protein of a mesencephalon astrocyte-derived neurotrophic factor. The invention also aims to provide a preparation method and application of the fusion protein.

The invention provides a midbrain astrocyte-derived neurotrophic factor fusion protein, which at least comprises the following two fragments: the amino acid sequence of mesencephalon astrocyte-derived neurotrophic factor and the amino acid sequence of immunoglobulin Fc fragment.

Furthermore, the amino acid sequence of the midbrain astrocyte-derived neurotrophic factor is shown in SEQ ID No.1, or has homology of more than 50% with the SEQ ID No.1 and has the same or similar biological activity.

Preferably, the amino acid sequence of the mesencephalon astrocyte-derived neurotrophic factor is shown in SEQ ID No.1, or has more than 98% homology with SEQ ID No.1 and has the same or similar biological activity.

Further preferably, the amino acid sequence of the midbrain astrocyte-derived neurotrophic factor is represented by SEQ ID No.1, or is a natural sequence of a human-derived midbrain astrocyte-derived neurotrophic factor.

The midbrain astrocyte-derived neurotrophic factor (MANF) is expressed in animals from human to all levels, and the sequence of the MANF is highly conserved evolutionarily, and the human MANF amino acid sequence has 98 percent homology with mice, 82 percent homology with Xenopus laevis, 72 percent homology with zebra fish, 52 percent homology with drosophila and 50 percent homology with new rod nematodes. The following examples demonstrate the efficacy of the drug in an obese mouse model, and therefore specifically employ murine midbrain astrocyte-derived neurotrophic factor to prepare fusion proteins whose amino acid sequences are shown below:

in addition, other sources of MANF may be used to prepare fusion proteins, such as human MANF, as desired for the preparation of a medicament.

Further, the immunoglobulin is IgG.

Preferably, the immunoglobulin is IgG1.

Further preferably, the immunoglobulin is of human or murine origin.

Furthermore, the amino acid sequence of the immunoglobulin Fc segment is shown as SEQ ID No.2, or has homology of more than 80% with the SEQ ID No.2 and has the same or similar functions.

Further preferably, the amino acid sequence of the immunoglobulin Fc segment is shown as SEQ ID No.2, or is a natural sequence of human-derived IgG1.

The following examples demonstrate the efficacy of the drug in an obese mouse model, and therefore specifically employ the Fc fragment of murine immunoglobulin IgG1 to prepare fusion proteins, whose amino acid sequences are shown below:

in addition, for the preparation of drugs, other sources of immunoglobulin Fc fragments can be used as required to prepare fusion proteins, such as Fc fragment of human immunoglobulin IgG1, which has 80% homology with SEQ ID No. 2.

Further, the C-terminus of the midbrain astrocyte-derived neurotrophic factor is linked to the N-terminus of the immunoglobulin Fc fragment.

Preferably, the midbrain astrocyte-derived neurotrophic factor is linked to the immunoglobulin Fc fragment via a linker sequence, or both.

Further preferably, the connecting sequence is shown as SEQ ID No. 3.

Furthermore, the amino acid sequence of the fusion protein is shown as SEQ ID No. 4.

The invention provides polynucleotides encoding the fusion proteins.

Preferably, the sequence of the polynucleotide is shown in SEQ ID No. 5.

The invention provides a recombinant vector containing the polynucleotide.

Preferably, the vector is proEM.

The invention provides a host cell containing the recombinant vector.

Preferably, the host cell is a HEK293 cell.

The invention provides a preparation method of the fusion protein, which comprises the following steps: culturing the host cell to express the fusion protein, and then recovering the fusion protein.

The invention provides a composition, which is a preparation prepared by taking the fusion protein as an active ingredient and adding acceptable auxiliary materials or auxiliary ingredients.

Preferably, the preparation is an injection.

The invention provides application of the fusion protein and the composition in preparation of medicines or health products for inhibiting weight gain.

The invention provides application of the fusion protein and the composition in preparing medicines or health care products for inhibiting insulin resistance.

Among them, insulin resistance means that the efficiency of insulin to promote glucose uptake and utilization is reduced for various reasons, and at this time, the body secretes too much insulin for compensation to maintain the stability of blood sugar, causing hyperinsulinemia; insulin resistance is also a predisposing cause of metabolic syndrome and type II diabetes.

The invention provides application of the fusion protein and the composition in preparation of medicines or health-care products for treating and/or preventing metabolic diseases.

Preferably, the metabolic disease is obesity or type II diabetes.

The invention provides the MANF-Fc fusion protein by utilizing the Fc fusion protein technology, which obviously prolongs the half-life period of the MANF in vivo, enables the MANF to be well used for clinical treatment of metabolic diseases such as obesity, diabetes and the like, and has wide application prospect.

Drawings

FIG. 1 is a graph of the in vivo pharmacokinetics of MANF-Fc in test example 1;

FIG. 2 is a graph showing the change in body weight of ob/ob mice in test example 2;

FIG. 3 is a graph showing the results of the oral glucose tolerance test and the insulin tolerance test in test example 2;

FIG. 4 is a graph showing the expression of genes related to browning of white fat in ob/ob mice in test example 2;

FIG. 5 is a graph showing the change in body weight of mice with obesity induced by high lipid diet in test example 3;

FIG. 6 is a graph showing the results of the oral glucose tolerance test and the insulin tolerance test in test example 3;

FIG. 7 is a graph showing the results of agarose gel analysis of the MANF-Fc extracted plasmid in example 1;

FIG. 8 is a graph showing the results of SDS-PAGE analysis for the purification of MANF-Fc protein in example 1.

Detailed Description

The scheme of the invention will be explained with reference to the following examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to techniques or conditions described in literature in the art or according to the product specification. The reagents or instruments used are conventional products which are commercially available, and are not indicated by manufacturers.

EXAMPLE 1 preparation of the fusion protein MANF-Fc of the present invention

The MANF-Fc gene is synthesized by the whole gene, and the nucleotide sequence (SEQ ID No. 5) is as follows:

the 1-6 GAATTC of the sequence is enzyme cutting site EcoR I, the 7-17 CCGCCGCCACC is KOZAK sequence, the 1257-1262 TGATAA is stop codon, and the 1261-1266 AAGCTT is enzyme cutting site HindIII.

The MANF-Fc gene was then inserted into the expression vector proEM by double digestion, and the accuracy of the final expression vector was confirmed by digestion and sequencing.

The MANF-Fc plasmid was subsequently transferred to the DH 5. Alpha. Clone, as follows:

1. 80-100ng of the expression plasmid containing the MANF-Fc gene was aspirated and added to the prepared DH 5. Alpha. Competent cells.

2. Competent cells after plasmid addition were transformed by heat shock.

3. And adding the transformed competent cells into an LB liquid culture medium, placing the transformed competent cells into a shaker at 37 ℃, and performing shake culture at 200rpm for about 30min.

4. The cultured competent cells were taken out, and a part of the suspension was taken out and applied to a plate containing ampicillin, and the plate was placed in an incubator at 37 ℃ for overnight culture.

5. Single clones were picked from fresh plates and cultured in 2-5mL LB medium at 37 ℃ for 8h at 200 rpm.

6. The culture was inoculated into 200mL of LB medium at a ratio of 1/500, and cultured at 37 ℃ and 200rpm for 16 hours.

7. The cultured bacteria solution is collected and centrifuged, and the supernatant is removed.

Then extracting the transfection grade plasmid by a plasmid large extraction kit (particularly adopting a Qiagen transfection grade plasmid extraction kit):

1. the extracted MANF-Fc plasmid was analyzed on a 1% agarose gel and the results are shown in FIG. 7, where Lane M: DNA marker, lane 1: transfection grade plasmid.

2. Transfection-grade plasmid DNA plasmid quality determinations, the results are given in the following table:

detecting content	Transfection grade plasmid Standard	MANF-Fc plasmid detection results
			A260/A280	1.8-2.0	1.89
Endotoxin	Endotoxin<50EU/mg	The detection of the limulus reagent is carried out,<50EU/mg
			sterility testing	Is sterile	LB plate test, aseptic colony

Then the plasmid is transfected into a mammalian cell HEK293 by a transfection reagent for transient expression, and the specific operation is as follows:

reviving and passaging HEK293 cell

1. The water bath kettle is opened for 37 ℃ in advance; the medium was preheated at 37 ℃ in advance.

2. The frozen HEK293 cells were removed from the liquid nitrogen tank.

3. Immediately putting the frozen cells into a water bath kettle at 37 ℃, slightly shaking the frozen cells to quickly melt the frozen cells (about 1 min), and taking out the frozen cells.

4. The outer wall of the tube was sterilized with 75% ethanol, placed in a biosafety cabinet, transferred to a 15mL centrifuge tube containing 10mL of medium, centrifuged at 800rpm, and run for 5min.

5. Removing supernatant from centrifuged cells, re-suspending cells in fresh culture medium, transferring to culture flask, adding fresh culture medium, shaking to disperse cells uniformly, counting cells, detecting activity, and controlling density at 3-4 × 10 ⁵ cells/mL, viability>95％。

6. Placing in an incubator at 110rpm,37 ℃,5% CO ₂ And (5) culturing.

7. The cells are cultured for 2-3 days, and the density reaches 2.0 multiplied by 10 ⁶ cells/mL or soThe cells need to be passaged.

8. A portion of the culture is removed from the flask and discarded, and the flask is replenished with fresh medium and the remaining cell culture is diluted (the remaining cell culture depends on cell density, culture volume, density after dilution, etc.).

9. Placing in an incubator at 110rpm,37 ℃,5% ₂ And continuing culturing.

10. The cell density and the cell activity are detected every day when the cell density reaches 2 multiplied by 10 ⁶ cells were passaged around cell/mL.

MANF-Fc plasmid transfected HEK293 cell

1. HEK293 cells were suspension cultured to 500mL 1 day before transfection at a seeding density of 1X 10 ⁶ cells/mL, placed in an incubator at 110rpm,37 ℃,5% CO ₂ And (5) culturing.

2. The cell density of the transfected angel is controlled to be 1-1.5X 10 ⁶ About cells/mL.

3. DNA-transfection reagent mixture: DNA and transfection reagents were added to the transfection buffer and mixed well and incubated at 37 ℃.

4. Adding the DNA-transfection reagent mixture to the cells to be transfected, placing in an incubator at 110rpm,37 ℃,5% ₂ And (5) culturing.

5. Collecting: about 4-6 days after transfection, the cell culture is removed, centrifuged, and the supernatant or cells are collected.

And then purifying the MANF-Fc protein by affinity chromatography, which comprises the following steps: the cell culture fluid after 5 days of transfection culture is centrifuged, the supernatant is filtered by a 0.22um filter, dialyzed into 1 XPBS (phosphate buffer solution) at the temperature of 4 ℃, the pH value is 7.4, and the supernatant is purified by a Protein A column after the dialysis is finished, and the result is shown in figure 8, wherein Lane M is SDS-PAGE Protein Marker, lane 1 is the supernatant after centrifugation, lane 2 is the effluent after the supernatant is incubated with Protein A, and Lane 3-6 is the component eluted by 0.1M glycine. Purifying by Protein A affinity chromatography, wherein the target Protein MANF-Fc mainly exists in the eluate Lane 3-4, collecting the target Protein, dialyzing into 1 × PBS (pH7.8), filtering with 0.22um filter, and freezing at-80 deg.C.

MANF-Fc protein stability test (freeze-thaw experiment): taking a MANF-Fc protein frozen at-80 ℃, placing in an ice water bath for 5-10min until the protein is slowly thawed, placing in a refrigerator at 4 ℃ for 0.5h after thawing, and having no abnormal phenomenon, which indicates that the protein freeze-thaw experiment is normal.

The advantageous effects of the present invention are demonstrated by test examples below. The MANF-Fc used in the experimental examples was the fusion protein prepared according to example 1.

Test example 1 MANF-Fc half-Life assay in vivo

C57BL/6 mice were administered MANF-Fc (0.3 mg/kg) by subcutaneous injection, and the blood was collected from the tail vein at

days

1,4,7, 10, 13, 17, 21, and 25 after administration, and the expression level of MANF in the serum was measured by Western blot, and the results are shown in FIG. 1.

MANF alone has a very short half-life in vivo, and the presence of MANF in serum after injection is barely detectable by Western blot. However, the results in FIG. 1 show that after a single administration of MANF-Fc fusion protein, the concentration of MANF in the serum gradually increased, peaking by day 7 and then slowly decreased, and that higher concentrations of MANF were still detectable in the serum up to day 25 after administration, indicating a significant increase in the plasma half-life of the MANF-Fc fusion protein.

Test example 2 therapeutic Effect of MANF-Fc on ob/ob-obese mice

8-week-old ob/ob leptin deficient mice were divided into 2 groups, and administered with MANF-Fc fusion protein and control Fc protein (0.3 mg/kg) by subcutaneous injection once a week for a total of 3 administrations, respectively. The body weight of the mice was monitored daily after the administration, and the results are shown in fig. 2. The insulin sensitivity of the model mice was investigated after the last administration using an oral glucose tolerance test and an insulin tolerance test, and the results are shown in fig. 3. After the mice are sacrificed, subcutaneous adipose tissues are taken to detect the expressions of browning indexes UCP-1, cidea, dio2 and Pgc-1 alpha, and the result is shown in figure 4.

The results show that once weekly subcutaneous administration of MANF-Fc fusion protein can effectively control body weight gain in ob/ob mice, significantly reduce insulin resistance, and promote browning of white fat.

Test example 3 therapeutic Effect of MANF-Fc on High Fat Diet (HFD) -induced obese mice

After feeding C57BL/6 mice for 12 weeks on a High Fat Diet (HFD), they were randomly divided into 2 groups, and given the MANF-Fc fusion protein and the control Fc protein (0.3 mg/kg) by subcutaneous injection once a week for a total of 3 times. The body weight of the mice was monitored daily after the administration, and the results are shown in fig. 5. The insulin sensitivity of the model mice was examined using the oral glucose tolerance test and the insulin tolerance test after the last administration, and the results are shown in fig. 6.

The results show that once weekly subcutaneous administration of MANF-Fc fusion protein can effectively control the high fat diet induced weight gain in obese mice, significantly reducing insulin resistance.

It should be noted that the particular features, structures, materials, or characteristics described in this specification may be combined in any one or more embodiments in any suitable manner. Moreover, various embodiments and features of various embodiments described in this specification can be combined and combined by one skilled in the art without being mutually inconsistent.

Sequence listing

<110> Sichuan university Hospital in western China

<120> fusion protein of mesencephalon astrocyte-derived neurotrophic factor for preventing and treating obesity

<130> A200052K

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 157

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Leu Arg Pro Gly Asp Cys Glu Val Cys Ile Ser Tyr Leu Gly Arg Phe

1 5 10 15

Tyr Gln Asp Leu Lys Asp Arg Asp Val Thr Phe Ser Pro Ala Thr Ile

20 25 30

Glu Glu Glu Leu Ile Lys Phe Cys Arg Glu Ala Arg Gly Lys Glu Asn

35 40 45

Arg Leu Cys Tyr Tyr Ile Gly Ala Thr Asp Asp Ala Ala Thr Lys Ile

50 55 60

Ile Asn Glu Val Ser Lys Pro Leu Ala His His Ile Pro Val Glu Lys

65 70 75 80

Ile Cys Glu Lys Leu Lys Lys Lys Asp Ser Gln Ile Cys Glu Leu Lys

85 90 95

Tyr Asp Lys Gln Ile Asp Leu Ser Thr Val Asp Leu Lys Lys Leu Arg

100 105 110

Val Lys Glu Leu Lys Lys Ile Leu Asp Asp Trp Gly Glu Met Cys Lys

115 120 125

Gly Cys Ala Glu Lys Ser Asp Tyr Ile Arg Lys Ile Asn Glu Leu Met

130 135 140

Pro Lys Tyr Ala Pro Lys Ala Ala Ser Ala Arg Thr Asp

145 150 155

<210> 2

<211> 227

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu

1 5 10 15

Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr

20 25 30

Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys

35 40 45

Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val

50 55 60

His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe

65 70 75 80

Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly

85 90 95

Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val

115 120 125

Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser

130 135 140

Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu

145 150 155 160

Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro

165 170 175

Ile Met Asn Thr Asn Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val

180 185 190

Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu

195 200 205

His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser

210 215 220

Pro Gly Lys

225

<210> 3

<211> 8

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Leu Ile Glu Gly Arg Asp Met Asp

1 5

<210> 4

<211> 392

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Leu Arg Pro Gly Asp Cys Glu Val Cys Ile Ser Tyr Leu Gly Arg Phe

1 5 10 15

Tyr Gln Asp Leu Lys Asp Arg Asp Val Thr Phe Ser Pro Ala Thr Ile

20 25 30

Glu Glu Glu Leu Ile Lys Phe Cys Arg Glu Ala Arg Gly Lys Glu Asn

35 40 45

Arg Leu Cys Tyr Tyr Ile Gly Ala Thr Asp Asp Ala Ala Thr Lys Ile

50 55 60

Ile Asn Glu Val Ser Lys Pro Leu Ala His His Ile Pro Val Glu Lys

65 70 75 80

Ile Cys Glu Lys Leu Lys Lys Lys Asp Ser Gln Ile Cys Glu Leu Lys

85 90 95

Tyr Asp Lys Gln Ile Asp Leu Ser Thr Val Asp Leu Lys Lys Leu Arg

100 105 110

Val Lys Glu Leu Lys Lys Ile Leu Asp Asp Trp Gly Glu Met Cys Lys

115 120 125

Gly Cys Ala Glu Lys Ser Asp Tyr Ile Arg Lys Ile Asn Glu Leu Met

130 135 140

Pro Lys Tyr Ala Pro Lys Ala Ala Ser Ala Arg Thr Asp Leu Ile Glu

145 150 155 160

Gly Arg Asp Met Asp Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile

165 170 175

Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro

180 185 190

Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val

195 200 205

Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val

210 215 220

Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln

225 230 235 240

Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln

245 250 255

Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala

260 265 270

Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro

275 280 285

Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala

290 295 300

Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu

305 310 315 320

Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr

325 330 335

Lys Asn Thr Gln Pro Ile Met Asn Thr Asn Gly Ser Tyr Phe Val Tyr

340 345 350

Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe

355 360 365

Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys

370 375 380

Ser Leu Ser His Ser Pro Gly Lys

385 390

<210> 5

<211> 1266

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaattcccgc cgccaccatg tgggccacaa gaggactggc agtggctctg gctctgagcg 60

tgctgccaga ttctagggct ctgagaccag gcgattgcga agtctgcatc agctacctgg 120

gccggttcta ccaggacctg aaggacaggg acgtgacctt cagcccagct accatcgagg 180

aggagctgat caagttctgc agggaggcca gaggcaagga gaataggctc tgctactaca 240

tcggcgccac agacgacgcc gccaccaaga tcatcaacga ggtgtccaag cctctggccc 300

atcacatccc agtggagaag atttgcgaga agctgaagaa gaaggacagc cagatttgcg 360

agctgaagta cgacaagcag atcgacctga gcaccgtgga cctgaagaag ctgcgcgtga 420

aggagctgaa gaagatcctg gacgactggg gcgagatgtg taagggttgc gccgagaaga 480

gcgactacat ccggaagatc aacgagctga tgcccaaata cgcccctaag gccgctagcg 540

ccagaacaga cctgatcgag ggcagagaca tggacgtgcc tagggattgc ggttgcaagc 600

cttgcatttg caccgtgccc gaggtgtcaa gcgtgttcat cttccccccc aagcccaaag 660

acgtgctgac catcaccctg acccccaaag tgacttgcgt ggtggtggac atcagcaagg 720

acgaccccga ggtgcagttc tcttggttcg tggacgacgt ggaggtgcac acagctcaga 780

cccagcctag agaggagcag ttcaacagca ccttccggag cgtgtccgag ctgcccatca 840

tgcaccagga ttggctgaac ggcaaggagt tcaagtgccg cgtgaatagc gccgcttttc 900

cagcccctat cgagaagacc atcagcaaga ccaagggcag gcccaaggcc cctcaggtgt 960

acacaatccc tcctcctaag gagcagatgg ccaaggacaa ggtgtccctg acttgcatga 1020

tcaccgactt cttccccgag gacatcaccg tcgagtggca gtggaatggc cagccagccg 1080

agaactacaa gaacacccag cccatcatga acaccaacgg cagctacttc gtgtacagca 1140

agctgaacgt gcagaagagc aattgggagg ccggcaacac cttcacctgc tcagtgctgc 1200

acgagggact gcacaaccac cataccgaga agagcctgag ccacagccca ggcaagtgat 1260

aagctt 1266

Claims

1. The fusion protein of the mesencephalon astrocyte-derived neurotrophic factor is characterized in that: contains at least the following two fragments: the amino acid sequence of the mesencephalon astrocyte-derived neurotrophic factor and the amino acid sequence of an immunoglobulin Fc fragment; the sequence of the polynucleotide for coding the fusion protein is shown as SEQ ID No. 5; the nucleotide sequence of SEQ ID No.5 is as follows:

GAATTCCCGCCGCCACCATGTGGGCCACAAGAGGACTGGCAGTGGCTCTGGCTCTGAGCGTGCTGCCAGATTCTAGGGCTCTGAGACCAGGCGATTGCGAAGTCTGCATCAGCTACCTGGGCCGGTTCTACCAGGACCTGAAGGACAGGGACGTGACCTTCAGCCCAGCTACCATCGAGGAGGAGCTGATCAAGTTCTGCAGGGAGGCCAGAGGCAAGGAGAATAGGCTCTGCTACTACATCGGCGCCACAGACGACGCCGCCACCAAGATCATCAACGAGGTGTCCAAGCCTCTGGCCCATCACATCCCAGTGGAGAAGATTTGCGAGAAGCTGAAGAAGAAGGACAGCCAGATTTGCGAGCTGAAGTACGACAAGCAGATCGACCTGAGCACCGTGGACCTGAAGAAGCTGCGCGTGAAGGAGCTGAAGAAGATCCTGGACGACTGGGGCGAGATGTGTAAGGGTTGCGCCGAGAAGAGCGACTACATCCGGAAGATCAACGAGCTGATGCCCAAATACGCCCCTAAGGCCGCTAGCGCCAGAACAGACCTGATCGAGGGCAGAGACATGGACGTGCCTAGGGATTGCGGTTGCAAGCCTTGCATTTGCACCGTGCCCGAGGTGTCAAGCGTGTTCATCTTCCCCCCCAAGCCCAAAGACGTGCTGACCATCACCCTGACCCCCAAAGTGACTTGCGTGGTGGTGGACATCAGCAAGGACGACCCCGAGGTGCAGTTCTCTTGGTTCGTGGACGACGTGGAGGTGCACACAGCTCAGACCCAGCCTAGAGAGGAGCAGTTCAACAGCACCTTCCGGAGCGTGTCCGAGCTGCCCATCATGCACCAGGATTGGCTGAACGGCAAGGAGTTCAAGTGCCGCGTGAATAGCGCCGCTTTTCCAGCCCCTATCGAGAAGACCATCAGCAAGACCAAGGGCAGGCCCAAGGCCCCTCAGGTGTACACAATCCCTCCTCCTAAGGAGCAGATGGCCAAGGACAAGGTGTCCCTGACTTGCATGATCACCGACTTCTTCCCCGAGGACATCACCGTCGAGTGGCAGTGGAATGGCCAGCCAGCCGAGAACTACAAGAACACCCAGCCCATCATGAACACCAACGGCAGCTACTTCGTGTACAGCAAGCTGAACGTGCAGAAGAGCAATTGGGAGGCCGGCAACACCTTCACCTGCTCAGTGCTGCACGAGGGACTGCACAACCACCATACCGAGAAGAGCCTGAGCCACAGCCCAGGCAAGTGATAAGCTT。

2. a recombinant vector characterized by: comprising the polynucleotide of claim 1.

3. The recombinant vector of claim 2, characterized in that: the vector is proEM.

4. A host cell characterized by: comprising the recombinant vector of claim 2 or 3.

5. The host cell of claim 4, wherein: the host cell is HEK293 cell.

6. The method for preparing the fusion protein according to claim 1, comprising the steps of: culturing the host cell of claim 4 or 5 to express the fusion protein, and recovering the fusion protein.

7. A composition characterized by: the composition is a preparation prepared by taking the fusion protein as an active ingredient in claim 1 and adding acceptable auxiliary materials or auxiliary ingredients.

8. The composition of claim 7, wherein: the preparation is an injection.

9. Use of the fusion protein of claim 1, the composition of claim 7 or 8, for the preparation of a medicament for inhibiting weight gain.

10. Use of the fusion protein of claim 1, the composition of claim 7 or 8, for the preparation of a medicament for inhibiting insulin resistance.

11. Use of the fusion protein of claim 1, the composition of claim 7 or 8 for the preparation of a medicament for the treatment and/or prevention of a metabolic disease; the metabolic disease is obesity or type II diabetes.