CN113289010A - Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof - Google Patents
Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN113289010A CN113289010A CN202110596115.1A CN202110596115A CN113289010A CN 113289010 A CN113289010 A CN 113289010A CN 202110596115 A CN202110596115 A CN 202110596115A CN 113289010 A CN113289010 A CN 113289010A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- trivalent
- recombinant yeast
- expression
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
- A61K39/012—Coccidia antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/455—Eimeria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/102—Plasmid DNA for yeast
Abstract
The trivalent recombinant yeast subunit vaccine can prevent the efficient expression of three genes, namely 3-1E, NA4 and IMP1, in a pichia expression system, has a good immune protection effect, and can be used for the immune prevention of mixed infection of three coccidia, namely eimeria tenella, eimeria maxima and eimeria necatrix.
Description
Technical Field
The invention provides a trivalent recombinant yeast subunit vaccine for chicken coccidiosis, which is characterized in that pichia GS115 strain is used for carrying out exogenous gene expression and mixed to prepare the trivalent recombinant yeast subunit vaccine, and the trivalent recombinant yeast subunit vaccine can prevent three trivalent recombinant yeast subunit vaccines of different coccidiosis in the same genus, namely chicken Eimeria tenella, Eimeria maxima and Eimeria necatrix.
Background
The chicken coccidiosis is a parasitic disease caused by chicken coccidiosis, seriously threatens the health of poultry, is distributed globally and has high fatality rate due to great harm. At present, the known chicken coccidiosis is 9 types, 7 types of chicken coccidiosis are internationally acknowledged as pathogenicity, and the common domestic coccidiosis is eimeria tenella (Eimeria tenella) (aE. tenella) Eimeria maxima (a)E. maxima) Eimeria necatrix (a)E. necatrix) And the like. The traditional prevention and treatment means of coccidiosis mainly comprises medicines and live oocyst vaccines, the difficulty of preventing and treating the coccidiosis of chicken is increased due to the generation of coccidium resistant strains of chicken coccidia, the problem of medicine residues and the like along with the lapse of time, and potential safety hazards exist due to the introduction of foreign insect species, coccidia're-ancestor' and the like in the use process of the live oocyst vaccines. In contrast, genetically engineered vaccines can compensate for these drawbacks. However, the current genetic engineering vaccine is still in the research and development stage, and no commercialized genetic engineering vaccine is registered, so that the safe and efficient genetic engineering vaccine is developedAnd the production is one of means for preventing chicken coccidiosis. The epidemiological investigation of chicken coccidiosis shows that coccidiosis infection is mostly mixed infection, so that the prevention and treatment of the mixed infection of multiple coccidiosis are required in the development of a vaccine for preventing and treating coccidiosis. At present, some coccidian immunoprotection antigen genes are reported and prokaryotic expression is carried out, but no report that 3-1E, NA4 and IMP1 genes carry out exogenous gene expression in a pichia pastoris expression system exists, and no report related to a coccidium trivalent recombinant yeast subunit vaccine exists.
Disclosure of Invention
The invention aims to provide a coccidiosis trivalent recombinant yeast subunit vaccine and a preparation method thereof.
The purpose of the invention can be realized by the following technical scheme:
according toE. tenellaProtective antigen gene 3-1E,E. maximaProtective antigen genes IMP1 andE. necatrixprotective antigen gene NA4 gene sequence, utilizing Oligo7.0 software to design primer, PCR amplifying target segment and recovering, connecting target gene with expression vector pPICZ alpha A. Performing double enzyme digestion identification on the constructed recombinant plasmid, sequencing after identification, performing induced expression on the recombinant plasmid with correct sequencing, performing analysis and identification by using SDS-PAGE and Western-blot, and performing mass expression and purification on the recombinant plasmid, wherein the mass expression and purification are performed with 4% of an aluminum hydroxide gel adjuvant according to the ratio of 1: 4, uniformly mixing to prepare a univalent recombinant yeast vaccine, and then mixing the three univalent vaccines in equal proportion to prepare the chicken coccidiosis trivalent recombinant yeast subunit vaccine.
The preparation method of the chicken coccidiosis trivalent recombinant yeast subunit vaccine comprises the following steps:
1. preparation of chicken coccidiosis trivalent recombinant yeast subunit vaccine
First extractingE. tenella、E. maximaAndE. necatrixtotal RNA is reversely transcribed into cDNA, and genes of 3-1E, NA4 and IMP1 are amplified by a PCR method, and the sizes of target fragments are 553bp, 774bp and 1131 bp. Connecting the PCR product with an expression vector pPICZ alpha A overnight under the action of T4 DNA ligase, transforming the product into a competent cell DH5 alpha, selecting a positive clone to perform double enzyme digestion identification, and sequencing after successful identification. Thereafter, a recombinant expression vector was constructedThe bodies pPICZ alpha A-3-1E, pPICZ alpha A-NA4 and pPICZ alpha A-IMP1 are used for linearizing recombinant vector plasmids, electrotransfecting the recombinant vector plasmids into yeast cells GS115 for induced expression, and carrying out SDS-PAGE and Western-blot analysis and identification on expression products, wherein the products after protein purification are respectively mixed with 4% aluminum hydroxide gel adjuvant according to the ratio of 1: 4 mixing to prepare monovalent recombinant yeast subunit vaccines which are respectively named as GS115-E.tenella3-1E、GS115-E.necatrixNA4 and GS115-E.maximaIMP1, and mixing the recombinant proteins GS115-pPICZ alpha A-3-1E, GS115-pPICZ alpha A-NA4 and GS115-pPICZ alpha A-IMP1 in equal proportion, and mixing with 4% aluminum hydroxide gel adjuvant according to the ratio of 1: 4 to prepare a trivalent mixed vaccine GS 115-E-N-I.
Vaccine immunization effect detection
The method comprises the steps of immunizing chicks with a univalent vaccine and a trivalent vaccine respectively at a dose of 50 mu g/feather, performing intramuscular injection immunization on legs, performing first-immunization at 14 days, performing second-immunization at 21 days, collecting heart blood of each group of chickens 7 days after the first-immunization and 7 days after the second-immunization respectively, separating serum, separating spleen lymphocytes, and detecting IgG antibody level, IFN-gamma and IL-10 and T lymphocyte proliferation level in the serum respectively. Oral insect attack of 5 × 10 for each group except blank control at 28-day age4Person/feather, GS115-E.tenella3-1E group attackE.tenella，GS115-E.necatrixNA4 group attackE.necatrix，GS115-E.maximaIMP1 group tapE.maxima(ii) a Trivalent mixed vaccine GS115-E-N-I group is respectively infectedE. tenella、E. necatrixAndE. maxima。chickens were sacrificed only on day 7 post infection and the Anticoccidial Index (ACI) calculation was performed to determine Anticoccidial protective effects by survival, average weight gain, oocyst value, and lesion value.
The invention has the positive effects that:
the invention realizes the high-efficiency expression of the three genes of 3-1E, NA4 and IMP1 in a pichia pastoris expression system. The chicken coccidiosis trivalent recombinant yeast subunit vaccine has a good immune protection effect, and can be used for immune prevention of mixed infection of three coccidia including eimeria tenella, eimeria maxima and eimeria necatrix.
Drawings
FIG. 1 shows the amplified 3-1E, NA4 and IMP1 gene (M: DL2000 Marker/DL5000 Marker; 1-2: 3-1E gene PCR amplification product; 3: NA4 gene PCR amplification product; 4: IMP1 gene PCR amplification product) of the present invention;
FIG. 2 shows the double restriction enzyme identification of the recombinant vector of the present invention (M: DL2000 Marker/DL5000 Marker; 1-2: pPICZ. alpha. A-3-1E double restriction enzyme product; 3: pPICZ. alpha. A-NA4 double restriction enzyme product; 4: pPICZ. alpha. A-IMP1 non-restriction enzyme plasmid 5: pPICZ. alpha. A-IMP1 double restriction enzyme product);
FIG. 3 shows the PCR identification of the recombinant strain positive clones (M: DL2000 Marker/DL5000 Marker; a 1-2: pPICZ. alpha. A-31E identification result; b: 1: empty bacterium GS115 control result; 2: pPICZ. alpha. A-NA4 identification result; c: 1: empty bacterium GS115 control result; 2: pPICZ. alpha. A-IMP1 identification result);
FIG. 4 shows SDS-PAGE analysis of the recombinant protein of the present invention (M: DL2000 Marker/DL5000 Marker; a:1-2 pPICZ. alpha. A-31E protein expression result; b:1-2 pPICZ. alpha. A-NA4 protein expression result; c:1-3 pPICZ. alpha. A-IMP1 protein expression result);
FIG. 5 shows the Western-blot identification results of the recombinant protein of the present invention (1: pPICZ. alpha. A-IMP1 Western-blot identification results; 2: pPICZ. alpha. A-NA4Western-blot identification results; 3: pPICZ. alpha. A-31Ewestern-blot identification results);
FIGS. 6.1 and 6.2 show the variation of serum antibody levels in chickens of the invention;
FIG. 7 is a graph showing the change in IL-10 level in the serum of chickens according to the present invention;
FIG. 8 is a graph showing the change in IFN-. gamma.expression levels in chicken serum;
FIG. 9 shows proliferation of chicken spleen T lymphocytes.
Detailed Description
The invention is further illustrated by the following examples, which are not intended to be limiting in any way. The following examples are provided to further illustrate the essence of the present invention, but the present invention is not limited thereto.
Taking Eimeria tenella protective antigen gene 3-1E, Eimeria maxima protective antigen gene IMP1 and Eimeria necatrix protective antigen gene NA4 as examples, the construction of an expression vector and the preparation of a recombinant yeast subunit vaccine are carried out.
Example 1
Preparation of recombinant yeast vaccines
Based on GenBank3-1E, NA4 and IMP1 gene sequences and the multiple cloning site sequence of expression vector pPICZ alpha A, Oligo7.0 software was used to design primers as shown in Table 1 below:
TABLE 13-1E, NA4, IMP1 Gene amplification primer sequences
Underlined as restriction sites
Recovering the amplified target gene glue, connecting the target gene glue with a eukaryotic expression vector pPICZ alpha A, carrying out double enzyme digestion identification (figure 1 and figure 2), and carrying out double enzyme digestion identification on a connecting productSac I20 mu g of plasmid after enzyme digestion linearization is softly and evenly mixed with 120 mu L of yeast competence; ice-bath is carried out for 10min, the mixture is moved into a pre-cooled electric transfer cup, yeast cells are electrically transfected by an electric transfer instrument for 1500V and 4ms, 1mL of ice-cooled sorbitol solution is immediately added to uniformly mix the thalli, the mixture is transferred into a 1.5mL EP tube, and standing culture is carried out for 1h at the temperature of 30 ℃; after centrifugation at 12000r/min for 5min, the thalli are suspended in 300 mu L of ice-cooled sorbitol and coated on an YPD plate containing 100 mu g/mLzeocin; culturing the plate at 28-30 deg.c for 2-3 days until transformant appears; positive monoclonal colonies were selected, yeast genomic DNA was extracted, and Mut + transformants were identified by 1.0% agarose gel electrophoresis after PCR using universal primers 5 'AOX and 3' AOX (FIG. 3).
And preserving bacterial liquid of the successfully identified recombinant yeast, streaking, culturing on a YPD plate with 100 mu g/mLzeocin, culturing in a constant-temperature incubator at 30 ℃ for 2-3 days until a normal colony grows out, and selecting a single colony to inoculate in 25mL BMGY. Culturing at 220r/min for 24h in a shaker at 30 deg.C. The shaken BMGY was subjected to aseptic centrifugation to collect the cells. 5,000r/min, centrifugating for 5min, and resuspending thallus precipitate to OD using sterile BMMY600Is about 1.0. Placing the resuspended BMMY in a 1L conical flask, sealing with four layers of gauze to ensure air circulation, culturing in 30 deg.C constant temperature shaking table at 220r/min, adding methanol every 24 hr during shaking bacteria to ensure that air circulation is ensuredFinal concentration of 1.0%; after 96h of induction, the cells were centrifuged at 12,000 rpm for 10min, and the supernatant was concentrated by the TCA method and then subjected to SDS-PAGE and Western-blot analysis (FIGS. 4 and 5). The recombinant yeast is re-streaked, and the single clone is selected and inoculated into 50mL liquid culture medium and cultured overnight at 30 ℃ and 220 r/min. Centrifuging the product at 2500 r/min for 5min, performing heavy suspension by using 500mL sterile BMGY medium, culturing at 30 ℃ and 220r/min for 24h, centrifuging at 5000r/min for 10min, discarding the supernatant, performing induced expression for 96h after 2L sterile BMMY heavy suspension, sampling, centrifuging, and reserving the supernatant for later use. Performing ultrafiltration impurity removal by using a filter membrane of 0.22 mu m, concentrating the sample by using a peristaltic pump, stopping concentration when the concentration is finally 100mL, and performing dialysis; cutting the dialysis bag to a required size, boiling in boiling water for 3-5 min, naturally cooling, putting the sample into the dialysis bag, and clamping two ends by using a clamp to prevent the sample from leaking. Dialyzing in PBS buffer solution at 4 deg.C, and changing the solution every 6 hr until the protein pigment is almost disappeared; protein purification was performed using SCG chromatography workstation, specific protein binding was performed using nano-micron DEAE weak cation chromatography column and Ni Sepharose High Performance purification column, respectively, and after elution the protein samples were stored in a-80 ℃ freezer for future use.
Protein samples were mixed with 4% alumina gel adjuvant at a ratio of 1: 4, mixing the components in a ratio of 4 to prepare a vaccine for immunization in an intramuscular injection mode.
Test example 1
Chicken coccidiosis trivalent recombinant yeast subunit vaccine induces immune response of chicken body
75 healthy 13-day-old coccidiosis-free infected chicks were randomly assigned to 10 groups of 15 chickens. After recombinant proteins GS115-pPICZ alpha A-3-1E, GS115-pPICZ alpha A-NA4 and GS115-pPICZ alpha A-IMP1 were expressed and purified, the protein was mixed with 4% aluminum hydroxide gel adjuvant according to a ratio of 1: 4, mixing to prepare monovalent recombinant yeast subunit vaccines which are respectively named as GS115-E.tenella3-1E、GS115-E. necatrixNA4 and GS115-E. maximaIMP 1. Meanwhile, after the recombinant protein is mixed in equal proportion, the mixture is mixed with 4% of aluminium hydroxide gel adjuvant according to the proportion of 1: 4 are mixed to prepare a trivalent mixed vaccine named GS 115-E-N-I. The monovalent subunit vaccine and the trivalent mixed vaccine are respectively mixed to50, immunizing chicks by leg intramuscular injection at the dose of feather, respectively, collecting heart blood of chickens 7 days after the first immunization and 7 days after the second immunization, separating serum, and detecting the levels of serum IgG antibody, IFN-and IL-10. Specific experimental groups refer to table 2.
Table 2 experimental grouping and immunization procedure
Antibody level detection: the recombinant yeast expression proteins GS115-pPICZ alpha A-31E, GS115-pPICZ alpha A-NA4, GS115-pPICZ alpha A-IMP1 and the equal proportion of mixed protein are respectively used for coating a 96-well plate, the antibody level is determined, each group of proteins are diluted to 2 ng/mu L by 1 XPBS respectively and then added, 100 mu L is added to each well, and the mixture is coated overnight at 4 ℃. And (3) after coating, throwing off liquid in the holes, and washing by adding 200 mu LPBST to each hole, wherein the washing lasts for 5min each time and is carried out for three times. The skim milk was diluted to 5% concentration with PBST as blocking solution, 200. mu.L of blocking solution was added to each well, and blocking was carried out at 37 ℃ for 2 hours. After the sealing, the liquid in the plate was spun off, and 200. mu.L of BST was added to each well for washing for 5min each time for three times. Taking out serum from a refrigerator, thawing, diluting by multiple times, incubating for 1h at 37 ℃ and then continuously washing for three times by PBST, spin-drying liquid in the plate after washing is finished, diluting HRP-labeled goat anti-chicken IgG in advance, adding 100 mu L of the HRP-labeled goat anti-chicken IgG in each hole, incubating for 1h in a 37-DEG thermostat, finishing incubation, repeating the previous steps to dry the liquid in the plate, and washing for three times by PBST. Adding TMB color developing solution into each well, wrapping with 100 μ L tinfoil, incubating at 37 deg.C in dark for 30min, adding 100 μ L stop solution into each well, and rapidly detecting OD within 10min450The absorbance value of (c). The results showed that the serum antibody levels seven days after the second immunization (28 d) were significantly higher than those of the control group (14 d) and seven days after the first immunization (21 d) (P)<0.01), serum antibody levels seven days after primary immunization were not significantly higher than control (P)>0.05). The level of antibodies produced by the body elicited by the trivalent mixed vaccine GS115-E-N-I (marked as MIX in the figure) on the seventh day after the second immunization was very significantly highAt GS115-E. tenella3-1E and GS115-E. necatrixNA4 two monovalent vaccine immunization groups (P)<0.01), significantly higher than GS115-E.maximaIMP1 immune group (P)<0.05), which shows that the trivalent mixed vaccine GS115-E-N-I can better stimulate the humoral immune response of the host. (the results are shown in FIGS. 6.1 and 6.2).
IFN-. gamma.and IL-10 levels in serum assay: and (3) detecting the level of the cytokine by using a chicken interferon gamma (IFN-gamma) ELISA kit and a chicken interleukin 10(IL-10) kit. The variation in IL-10 levels between groups was not significant. The IFN-gamma level of the trivalent mixed vaccine GS115-E-N-I is obviously higher than that of GS115-E.necatrixNA4 group and PBS control group (P)<0.05), GS115-E. tenellaThe IFN-gamma level of the 3-1E group and the trivalent mixed vaccine GS115-E-N-I group is obviously higher than that of GS115-E.necatrixNA4 group (P)<0.05). (the results are shown in FIGS. 7 and 8).
T lymphocyte proliferation assay: spleen lymphocytes are taken 7 days after the attack of the insects, and the proliferation condition of the T lymphocytes of each group is detected by a CKK-8 method. The results show that except GS115-E.necatrixThe proliferation level of T lymphocytes of the rest vaccine immune groups except the NA4 group and the seventh day after the second immunization is obviously higher than that of the T lymphocytes of the PBS control group, which indicates that the recombinant protein can activate the cellular immune mechanism of the body and promote the proliferation and differentiation of the T lymphocytes in vivo. (the results are shown in FIG. 9).
The results of the present invention show that the monovalent recombinant protein vaccine GS115-E. tenella3-1E、GS115-E. necatrix NA4、GS115-E.maximaCompared with the seventh day after the first immunization, the immune chicken immunized by IMP1 and the trivalent mixed vaccine GS115-E-N-I has the advantages that the serum IgG antibody level is obviously increased, the T lymphocyte proliferation capacity is obviously enhanced, the IFN-gamma level is obviously increased, and the IL-10 expression level is not obviously changed after the second immunization, which indicates that the recombinant yeast protein can induce the humoral immune response and the cellular immune response of an organism. Seven days after the second chicken immunization of the trivalent mixed vaccine GS115-E-N-I, the serum IgG antibody level generated by the stimulated organism is obviously higher than that of the monovalent vaccine GS115-E. tenella 3-1E、GS115-E. necatrixNA4 and GS115-E.maximaIMP1 group (P)<0.05), which shows that the trivalent mixed vaccine GS-E-N-I can better induce the humoral immune response of the chicken body.
Test example 2
Coccidiosis resisting protective effect of chicken coccidiosis recombination yeast subunit vaccine
150 healthy 13-day-old coccidiosis-free infected chicks were randomly divided into 10 groups of 15 chickens. After recombinant proteins GS115-pPICZ alpha A-3-1E, GS115-pPICZ alpha A-NA4 and GS115-pPICZ alpha A-IMP1 were expressed and purified, the protein was mixed with 4% aluminum hydroxide gel adjuvant according to a ratio of 1: 4 to prepare monovalent recombinant yeast subunit vaccines which are respectively named as GS115-E. tenella3-1E、GS115-E. necatrixNA4 and GS115- E. maxima IMP 1. Meanwhile, after the recombinant protein is mixed in equal proportion, the mixture is mixed with 4% of aluminium hydroxide gel adjuvant according to the proportion of 1: 4 are mixed to prepare a trivalent mixed vaccine named GS 115-E-N-I. 14-day-old primary immunization, 21-day-old secondary immunization, except for the blank control group, each chicken was orally inoculated with 5X 104 coccidian sporulated oocysts on day 7 after secondary immunization. GS115-E. tenellaInfection of group 3-1EE.tenella，GS115-E. necatrixInfection with NA4 groupE.necatrix，GS115-E. maximaIMP1 infectionE. maxima(ii) a Trivalent mixed vaccine GS115-E-N-I group is respectively infectedE. tenella、E. necatrixAndE. maxima. The chickens were killed by dissection on day 7 after infection, and the Anticoccidial Index (ACI) was calculated from the survival rate, average weight gain, oocyst value and lesion value to determine the protective effect of the recombinant yeast subunit vaccine against coccidia. Specific experimental grouping reference table 2
TABLE 3 animal experiment grouping and immunization, insect challenge design
As a result:
the results show that the part of the chickens in the univalent protein immune group has bloody stool, the feathers stand reversely, the spirit is lingering, most of the chickens still have normal appetite, the spirit state is general, and the phenomenon of loose stool occurs. Marking the chickens one by one before attacking the insects, weighing the chickens one by one, randomly selecting 10 chickens seven days after infection before killing the chickens, and selecting the chickensWeighing one by one, and calculating the weight gain of each group and the average weight gain and variance. The average weight gain of each immunized group was significantly higher than the average weight gain of each positive control group (P<0.05). The average weight gain between immunization groups was not significantly different. After insect attack, the number of oocysts expelled from each immune group is obviously lower than that of the positive control group, wherein the group with the least oocysts is GS115-pPICZ alpha A-31E and GS-E-N-I-E.tenellaAnd secondly GS-E-N-I-E.maxima. The positive control group has the lesion value more than 20, and the immune group has the lesion value less than or equal to 10; wherein the least diseased is GS-E-N-I-E.tenellaNext, GS115-pPICZ α A-31E and GS115-pPICZ α A-IMP 1. See table 3 for details.
TABLE 4 protective Effect of recombinant Yeast subunit vaccines against coccidia
ACI is an important index for evaluating the protective effect of chicken coccidia vaccines, and is specifically referred to table 4.
TABLE 5 anticoccidial index of recombinant Yeast subunit vaccines
As a result: monovalent recombinant yeast subunit vaccine GS115-E.tenella3-1E group antibodyE.tenellaAn index of 173.36; GS115-E.necatrixNA4 group antibodyE.necatrixAn index of 167.69; GS115-E.maximaIMP1 anti-E.maximaThe index was 171.76. ACI of the trivalent mixed vaccine GS115-E-N-I group are respectively antiE.tenellaIndex 174.63, antiE.necatrixIndex 166.24, antiE.maximaThe index is 178.88, which shows that the recombinant yeast subunit vaccine has better anti-coccidium protection effect.
Sequence listing
<110> Jilin university
<120> chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1392
<212> DNA
<213> E.maxima imp-1(Eimeria maxima imp-1 gene)
<400> 1
gcacttttcg tgcattaaat cgctacaatt aatttggtag cccgtttttt cttctttttc 60
ctcttctttg gctgtactgt gagggtgggt tctcccgcgt aggctcatgc agctgttcat 120
actggtctag gcagtgtgcg cctgtgcacg ttttgcaaga ggatgcatgc gtttgcgttt 180
cttctttttt ctgactttta actctttatt acgcgaaacc caaaccacct ttactgtctc 240
atcccccctt gctgcctgag gatgggggcc gcttgcggga aatcgcagcg cgccgccgcc 300
gctgttgaac cccccctttc taccgcggag aaggcagaag cagcagcagt agcagcagca 360
gaacatagcc agaaagcaga agaagcagca gaagttgctg ctgcttgtgc gacgaaagct 420
tccgcagagg ctgctgtcct tacaggggta gagccagggg cagagcctgc tgctgaggca 480
gaagaggccc caaaacaaaa tgaaatagaa gagcagcaaa caacaacaac acccgcacaa 540
acgcatgcaa cagaagagca gccagcagct cctcctgttg ttcccttgag cgatgcagat 600
gcacaagttc ttgctgcagc agaagcagca aagcaggaag cagctagtag caatatgcct 660
agggcgtatt tgttttatgc atgcgaactc aatgaaggat ccttaatgat gcaatggact 720
actacacaaa taacggaaga agatatgcat gcaaagaatt taattcttct tgcctccttt 780
tttcctgcta aacataaaac tgtttctaag agcaaactta cacaaaatgg aggtattacc 840
tacttcctgc aggagatgaa gtacaagtgg gaggtttgga gcaaagtgca gagacaggca 900
tattatcagg gttggataaa attcgtcaaa gcagcagatg agatggaggc gtcattcacc 960
ttacaccact ttgctgctcc tgcgccaccc gccaaacttt tcttactgca tacaggacct 1020
attgagaata aggtactgcc tgctaaggaa gaagaaccat tcaatgtctc cgtcttcggt 1080
cttgctgcgg tgacgccgcc gtcgcctcct tacaagccag gagcgaacat tacaccaaag 1140
agattcggcg aaatcgccac cggagcaggt ggggcttaca tgcagctttc ccgcagaggc 1200
ggtgatgcag catttgatga gaaagaagtt cagaagtggc tggcggctga cggtcttcaa 1260
atgaaaaagg gagaaggaat tacattggat gcagcaggcg gttatgaacg aagatctgag 1320
aaaaaggggg gcgatgctgc agctgcaact gcagccgtag aagcagagcc cactaaagtg 1380
tcgcaagatt ga 1392
<210> 2
<211> 747
<212> DNA
<213> Eimeria necatrix NA4(Eimeria necatrix NA4)
<400> 2
atggctcgtc tctcttttgt ttctcttctt tctctgtcac tgctcttcgg gcagcaagca 60
gccagagctc aggaaacata cccaacagca gaaacgatgg agtgtagaga ggcgatgaac 120
gagctcagaa aagcagcagg gcttcctgaa tttggaaatg ctgttggaga tgcagtagtt 180
ctgccagcat actcgcacga ggccagggcg gcaccagtgg ctgaaactct gtggaagacg 240
gaaatatgtc ccaaagtctt aggaggagca agggccaaga gtgttaccga agctgtcaag 300
ctaactggca actttgccta ctaccccgtc accgacggca aaagagagtg cagcgatgct 360
ctggagtact ggaaaggcgg actttcgcag ttcaacgata aaattccccc aacatttcaa 420
gcgttgaaca accccgctgt gtacaatgac agggccgtct cctttgtcgc cctatacaac 480
cccaaaccca gccccgttgt tagttgcgta ctactccagt gccctaatgc aggaggtggt 540
ggacgcaggc ttgcggcagg cacgacagat gctgtcattt gcttgacaaa ccctgctcct 600
ttggcagcag gctcaccacc attcgacgac gagcaatgga agaaaattgt tgactctcta 660
tctgaaaaga agggtggagt ttctccagtc ggcccttcag tagccctcat ctctgcggcg 720
gttatctccg ctttcgctct cttctag 747
<210> 3
<211> 31
<212> DNA
<213> Eimeria necatrix (Eimeria necatrix)
<400> 3
gaattcatgg ctcgtctctc ttttgtttct c 31
<210> 4
<211> 31
<212> DNA
<213> Eimeria necatrix (Eimeria necatrix)
<400> 4
gcggccgcga agagagcgaa agcggagata a 31
<210> 5
<211> 20
<212> DNA
<213> Eimeria maxima (Eimeria maxima)
<400> 5
<210> 6
<211> 32
<212> DNA
<213> Eimeria maxima (Eimeria maxima)
<400> 6
gcggccgcat cttgcgacac tttagtgggc tc 32
<210> 7
<211> 27
<212> DNA
<213> Eimeria tenella (Eimeria tenella)
<400> 7
gaattcatgg gtgaagaggc tgatact 27
<210> 8
<211> 25
<212> DNA
<213> Eimeria tenella (Eimeria tenella)
<400> 8
gcggccgcga agccgccctg gtaca 25
Claims (3)
1. A trivalent recombinant yeast subunit vaccine for chicken coccidiosis is characterized in that a Pichia pastoris GS115 strain is used for carrying out exogenous gene expression and is mixed to prepare the vaccine, and the trivalent recombinant yeast subunit vaccine can prevent three kinds of trivalent recombinant yeast subunit vaccines of different coccidiosis in the same genus, namely, chicken Eimeria tenella, Eimeria maxima and Eimeria necatrix.
2. The preparation method of the trivalent recombinant yeast subunit vaccine against chicken coccidiosis of claim 1, which comprises the following steps:
according toE. tenellaProtective antigen gene 3-1E,E. maximaProtective antigen genes IMP1 andE. necatrixprotective antigen gene NA4 gene sequence, primers were designed using Oligo7.0 software as follows:
3-1E: an upstream primer GAATTCATGGGTGAAGAGGCTGATACT;
a downstream primer GCGGCCGCGAAGCCGCCCTGGTACA;
NA 4: an upstream primer GAATTCATGGCTCGTCTCTCTTTTGTTTCTC;
a downstream primer GCGGCCGCGAAGAGAGCGAAAGCGGAGATAA;
IMP 1: an upstream primer GAATTCATGGGGGCCGCTTG;
a downstream primer GCGGCCGCATCTTGCGACACTTTAGTGGGCTC;
PCR amplifying and recovering a target fragment, and connecting a target gene with an expression vector pPICZ alpha A; performing double enzyme digestion identification on the constructed recombinant plasmid, sequencing after identification, performing induced expression on the recombinant plasmid with correct sequencing, performing analysis and identification by using SDS-PAGE and Western-blot, and performing mass expression and purification on the recombinant plasmid, wherein the mass expression and purification are performed with 4% of an aluminum hydroxide gel adjuvant according to the ratio of 1: 4, uniformly mixing to prepare a univalent recombinant yeast vaccine, and then mixing the three univalent vaccines in equal proportion to prepare the chicken coccidiosis trivalent recombinant yeast subunit vaccine.
3. The preparation method of the trivalent recombinant yeast subunit vaccine against chicken coccidiosis of claim 2, which comprises the following steps:
extracting total RNA of E.tenella, E.maxima and E.necatrix, carrying out reverse transcription to obtain cDNA, amplifying genes 3-1E, NA4 and IMP1 by a PCR method, wherein the size of a target fragment is 553bp, 774bp and 1131 bp;
connecting the PCR product with an expression vector pPICZ alpha A overnight under the action of T4 DNA ligase, transforming the PCR product into a competent cell DH5 alpha, selecting a positive clone to perform double enzyme digestion identification, and sequencing after the identification is successful;
constructing recombinant expression vectors pPICZ alpha A-3-1E, pPICZ alpha A-NA4 and pPICZ alpha A-IMP1, linearizing the recombinant vector plasmids, electrotransfecting the recombinant vector plasmids into yeast cells GS115 for induced expression, and carrying out SDS-PAGE and Western-blot analysis and identification on expression products, wherein the products after protein purification are respectively mixed with 4% aluminum hydroxide gel adjuvant according to the ratio of 1: 4, preparing monovalent recombinant yeast subunit vaccines which are respectively named as GS 115-E.tenellix NA 4-1E, GS115-E.necatrix NA4 and GS115-E.maximaIMP1, simultaneously mixing the recombinant proteins GS115-pPICZ alpha A-3-1E, GS115-pPICZ alpha A-NA4 and GS115-pPICZ alpha A-IMP1 in equal proportion, and mixing the recombinant proteins with 4% aluminum hydroxide gel adjuvant according to the proportion of 1: 4 to prepare a trivalent mixed vaccine GS 115-E-N-I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110596115.1A CN113289010A (en) | 2021-05-30 | 2021-05-30 | Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110596115.1A CN113289010A (en) | 2021-05-30 | 2021-05-30 | Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113289010A true CN113289010A (en) | 2021-08-24 |
Family
ID=77326126
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110596115.1A Pending CN113289010A (en) | 2021-05-30 | 2021-05-30 | Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113289010A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101422605A (en) * | 2008-11-03 | 2009-05-06 | 南京农业大学 | Immunoloregulation type DNA vaccine capable of preventing Eimeria necatrix |
| US20130216569A1 (en) * | 2010-08-02 | 2013-08-22 | The Pirbright Institute | Vaccine |
| CN103386124A (en) * | 2013-07-01 | 2013-11-13 | 南京农业大学 | Multivalent recombinant protein subunit vaccine in chicken coccidiosis and application thereof |
| CN106492208A (en) * | 2016-09-19 | 2017-03-15 | 中国农业大学 | A kind of chicken coccidiasis vaccine immunity method |
| CN110256576A (en) * | 2019-06-12 | 2019-09-20 | 吉林大学 | A kind of Eimeria tenella SO7-IL-2 albumen and preparation method |
| CN111514284A (en) * | 2020-04-27 | 2020-08-11 | 中国农业大学 | Chicken coccidiosis multivalent recombinant protein vaccine and preparation method and application thereof |
-
2021
- 2021-05-30 CN CN202110596115.1A patent/CN113289010A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101422605A (en) * | 2008-11-03 | 2009-05-06 | 南京农业大学 | Immunoloregulation type DNA vaccine capable of preventing Eimeria necatrix |
| US20130216569A1 (en) * | 2010-08-02 | 2013-08-22 | The Pirbright Institute | Vaccine |
| CN103386124A (en) * | 2013-07-01 | 2013-11-13 | 南京农业大学 | Multivalent recombinant protein subunit vaccine in chicken coccidiosis and application thereof |
| CN106492208A (en) * | 2016-09-19 | 2017-03-15 | 中国农业大学 | A kind of chicken coccidiasis vaccine immunity method |
| CN110256576A (en) * | 2019-06-12 | 2019-09-20 | 吉林大学 | A kind of Eimeria tenella SO7-IL-2 albumen and preparation method |
| CN111514284A (en) * | 2020-04-27 | 2020-08-11 | 中国农业大学 | Chicken coccidiosis multivalent recombinant protein vaccine and preparation method and application thereof |
Non-Patent Citations (6)
| Title |
|---|
| DAMER P. BLAKE等: ""Genetic Mapping Identifies Novel Highly Protective Antigens for an Apicomplexan Parasite"", 《PLOS PATHOGENS》 * |
| XIAOKAI SONG等: ""Partial protection against four species of chicken coccidia induced by multivalent subunit vaccine"", 《VETERINARY PARASITOLOGY》 * |
| 余东游等: ""柔嫩艾美耳球虫3-1E基因工程活载体疫苗对肉鸡的保护效果"", 《中国兽医学报》 * |
| 张思新等: ""我国鸡球虫病疫苗研究进展"", 《寄生虫与医学昆虫学报》 * |
| 董青等: ""柔嫩艾美耳球虫gam22基因重组质粒的免疫原性及保护效果"", 《中国兽医杂志》 * |
| 陈志等: ""分泌型表达EDA-EmIMP1 的重组枯草芽胞杆菌的构建及其免疫原性研究"", 《中国兽医科学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107529534B (en) | Protective antigen of avibacterium paragallinarum, expression and application thereof | |
| CN114480438B (en) | Fusion gene, protein coded by fusion gene and application of fusion gene in fish iridovirus oral vaccine | |
| CN114107228B (en) | Construction of attenuated African swine fever virus strain with twelve genes deleted and application of attenuated African swine fever virus strain as vaccine | |
| CN114015660B (en) | Construction of ten-gene deleted attenuated African swine fever virus strain and application thereof as vaccine | |
| CN111690584A (en) | Recombinant lactococcus lactis and tilapia streptococcus agalactiae vaccine | |
| CN109486846B (en) | Three-gene recombinant plasmid of Brucella, construction method and expression and application thereof in escherichia coli | |
| CN113289010A (en) | Chicken coccidiosis trivalent recombinant yeast subunit vaccine and preparation method thereof | |
| CN107267430B (en) | Recombinant bacterium of Brucella 104M vaccine strain with Omp25 gene knocked out and application | |
| CN109735477B (en) | Preparation and application of three-gene deletion attenuated mutant strain of Listeria monocytogenes | |
| CN110628796B (en) | Fish Nocardia disease common antigen DNA vaccine and preparation and application thereof | |
| CN107245105B (en) | HN-VP233-221aa fusion protein and preparation method and application thereof | |
| CN111763254A (en) | Outia erythrorhizo Mx protein cloning expression and polyclonal antibody preparation | |
| CN113046384A (en) | Construction method of broad-spectrum antiviral recombinant salmonella | |
| CN107267432B (en) | Recombinant bacterium of Brucella 104M vaccine strain with Per gene knocked out and application | |
| CN107267431B (en) | Recombinant bacterium of Brucella 104M vaccine strain with VirB2 gene knocked out and application | |
| CN116162141B (en) | Mycobacterium tuberculosis antigen EPCRA013 and application thereof | |
| CN114456240B (en) | African swine fever virus genetic engineering subunit oral vaccine | |
| CN115044513B (en) | Mycoplasma filiformis goat subspecies SXTG01 and application thereof, mycoplasma filiformis goat subspecies vaccine and preparation method thereof | |
| CN116041541B (en) | Mycobacterium tuberculosis antigen EPPA011 and application thereof | |
| CN113087778B (en) | Preparation method and application of Chlamydia psittaci polytype outer membrane protein PmpG protein | |
| CN112159479B (en) | Mycoplasma gallisepticum multi-antigen epitope fusion protein pMG-mEA and application thereof | |
| CN114437237B (en) | Staphylococcus aureus TRAP targeting recombinant protein antigen and application thereof | |
| CN116024247B (en) | Mandarin frog iridovirus vaccine and preparation method and application thereof | |
| CN114480433B (en) | Eimeria necatrix subunit vaccine and preparation method and application thereof | |
| CN116622740A (en) | Gene sequence and protein for encoding streptococcus suis protective antigen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210824 |