CN113278728A - Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof - Google Patents
Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof Download PDFInfo
- Publication number
- CN113278728A CN113278728A CN202110797903.7A CN202110797903A CN113278728A CN 113278728 A CN113278728 A CN 113278728A CN 202110797903 A CN202110797903 A CN 202110797903A CN 113278728 A CN113278728 A CN 113278728A
- Authority
- CN
- China
- Prior art keywords
- enteromorpha
- floating
- molecular marker
- ecotype
- specific molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of seaweed molecular genetics, and relates to an enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof. Specific molecular marker amplification primers of enteromorpha floating ecological chloroplast genome; the specific molecular marker of the enteromorpha floating ecotype chloroplast genome is shown as a base sequence in SEQ ID NO. 1. The invention is completed by detecting the specific fragment through PCR, can quickly, simply and accurately perform molecular identification on the enteromorpha floating ecotype which causes the large-scale green tide of the yellow sea by utilizing the specific molecular marker, and provides an important molecular tool for early warning and process tracking of the green tide of the enteromorpha of the yellow sea and monitoring of diffusion invasion of the enteromorpha floating ecotype to other habitats.
Description
Technical Field
The invention belongs to the field of seaweed molecular genetics, and relates to an enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof.
Background
Green tide (green tide) is a marine ecological phenomenon of fulminant proliferation of large marine green algae biomass, and the algae forming the green tide mainly come from ulva (Ulva) of ChlorophytaUlva). Since 2007, large-scale green tides are continuously developed in the yellow sea area for 15 years in spring and summer, biomass peak value exceeds million tons fresh weight, the area of the affected sea area exceeds 5 ten thousand square kilometers, drift distance exceeds 500 kilometers, serious ecological impact and economic loss are caused, and the marine disaster becomes a stable marine disaster.
In order to develop a scientific method for tracing the source of the yellow sea green tide and establishing early warning and forecasting, firstly, the composition rule of the dominant species of the green tide algae needs to be determined. Species identification is often performed by molecular methods, since ulva green algae have few and very unstable features available for morphological classification. Using nuclear genomic encoded ITS (internal transcribed spacer) and chloroplast genomic encodedrbcL (large nacelle of ribe 1, 5-bisphosphate carboxylase/oxydenase, Rubisco) and other sequence markers, and through morphological observation, the dominant species of the yellow sea green tide is determined to be enteromorpha (Enteromorpha prolifera)Ulva prolifera = Enteromorpha prolifera). As the enteromorpha prolifera is widely distributed in various sea areas along the coast of China and a plurality of natural growth stationary groups exist, the possible geographical source of the enteromorpha prolifera cannot be determined only by carrying out molecular identification at the species level, and the requirement of traceability work cannot be met.
In view of this, further performing population genetics research at a seed level, analyzing a yellow sea green tide floating sample and a fixed population with a wide geographical source for many years by using an ISSR (inter-simple sequence repeat) method, and indicating that the floating enteromorpha has high genetic uniformity both in the population and between the years, thereby indicating that the floating enteromorpha is likely to be from a single population; the adventitious sample has different levels of genetic distance among groups and shows different degrees of genetic segregation; particularly, the floating population is obviously different from all the stationary populations, which indicates that the floating population is not formed by the separation and fixation and convergence of the stationary populations along the sea, but has a special life style and occupies a special ecological niche.
In order to realize rapid and accurate molecular identification of the floating population, a specific ISSR amplification band of the floating population is selected, a specific amplification primer is developed through sequencing and design, and a Sequence Characterized Amplified Region (SCAR) molecular marker is developed, wherein the marker only presents a characteristic amplification band of 830bp in a sample of the floating population, and negative results are presented in an enteromorpha shore-based established population and related species. Compared with shore-based benthic populations, researchers propose that the yellow sea green tide is composed of a new floating ecotype of enteromorpha, in view of obvious under-seed genotype difference, unique morphological and physiological phenotypic characteristics and particularly occupying a special ecological niche.
A large number of studies show that large-area porphyra yezoensis culture rafts and ropes far away from the coast and located in the northwest radiata sandbars become important substrates for the mass growth of green algae in ulva; in addition, the production activities of laver harvesting and raft and boom rope recovery cleaning are accompanied, so that the epiphytic green algae are intensively cleaned into the sea, and the epiphytic green algae can become an important source of yellow sea green tide every year. Using the scarr markers, floating ecotypes were confirmed to be detectable in raft-shelved green algae and further tracked for their dynamic changes during green tides, assessing their risk of spreading to the shore base and north-invasion.
Despite the outstanding specificity of the SCAR marker, the analysis found that the SCAR marker is a single copy molecular marker encoded by the nuclear genome, based on the floating Enteromorpha genome sequence (NCBI serial number: GCA 004138255). Due to the extremely low copy number, successful amplification of positive samples is highly dependent on the better physiological status of the seaweed sample and the preparation of high quality total DNA template. Therefore, when a large number of samples are tested, a proportion of false negative results are generated, and the negative samples need to be tested repeatedly for confirmation.
In order to construct a quantitative model for early warning and forecasting of yellow sea green tide, dynamic and high-flux accurate investigation on the sample proportion of the enteromorpha floating ecotype in each stage of green tide, particularly in the early stage is required, which undoubtedly depends on further improvement of the stability and reliability of a specific molecular marker, and the molecular marker from the organelle genome has the characteristic of high copy number, so that the requirement can be met.
Disclosure of Invention
The invention aims to provide a specific molecular marker of an enteromorpha floating ecological chloroplast genome of a yellow sea green tide causative species, which can quickly, simply, stably and accurately perform molecular identification on the enteromorpha floating ecological type which causes the yellow sea large-scale green tide, make up for the deficiency of an SCAR marker in stability when analyzing a large sample amount, and provide an important molecular tool for early warning and process tracking of the yellow sea enteromorpha green tide and monitoring of diffusion invasion of the enteromorpha floating ecological type to other habitats.
In order to achieve the purpose, the invention adopts the technical scheme that:
an enteromorpha floating ecological chloroplast genome specific molecular marker amplification primer comprises:
an upstream primer: 5'-ACCAACAAATACCCCATTCTTTGA-3'
A downstream primer: 5'-TTTCTCTCCATACCCCCATCG-3' are provided.
The primer is used for amplifying specific molecular markers of chloroplast genomes of enteromorpha floating ecotypes (floating ecotypes), and the amplified markers are applied to early warning of green tide of enteromorpha in the yellow sea, process tracking and monitoring of diffusion invasion of the enteromorpha floating ecotypes to other habitats.
An enteromorpha floating ecological chloroplast genome specific molecular marker is shown as a base sequence in SEQ ID NO. 1.
The application of the enteromorpha floating ecological chloroplast genome specific molecular marker is used for early warning of green tide of enteromorpha in yellow sea and is used for identifying the proportion of the enteromorpha floating ecological.
The application of the enteromorpha floating ecological chloroplast genome specific molecular marker is used for tracking and monitoring the process of green tide of enteromorpha in yellow sea and is used for identifying the floating ecological proportion of the enteromorpha.
The specific molecular marker of the enteromorpha floating ecotype chloroplast genome is used for monitoring the diffusion invasion of the enteromorpha floating ecotype to other habitats and is applied to identifying the proportion of the enteromorpha floating ecotype.
A detection kit for identifying floating ecological enteromorpha contains the primer.
The kit also contains buffers, Taq enzymes, etc., e.g., ddH2O, Taq Master Mix.
A method for identifying floating ecological enteromorpha prolifera comprises the following steps:
carrying out PCR amplification on total DNA extracted from the enteromorpha by using the enteromorpha floating ecological chloroplast genome specific molecular marker specific primer;
amplifying by using the enteromorpha floating ecotype genome as a template and an enteromorpha floating ecotype chloroplast genome specific molecular marker primer pair to obtain a specific strip of about 966 bp, wherein the characteristic strip is the enteromorpha floating ecotype chloroplast genome specific molecular marker shown in SEQ ID NO.1, and the amplification result is positive;
no specific band is amplified, and the amplification result is negative.
The PCR amplification system is as follows: 25 μ l, 9.5 μ l ddH2O, 12.5. mu.l of 2 XTaq Master Mix (Novoprotein Scientific Inc., Suzhou, China), 0.5. mu.l of forward primer (10. mu.M), 0.5. mu.l of reverse primer (10. mu.M), 2.0. mu.l of template DNA (about 30 ng/. mu.l).
The PCR amplification procedure of the primers was: multiplying by 10 min at 94 ℃; at 94 ℃ for 45 s, at 52.5 ℃ for 45 s, at 72 ℃ for 1 min, for 35 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃.
The detection is completed by detecting the specific fragment, and the steps comprise the extraction of total DNA of an enteromorpha genome to be detected, PCR amplification, agarose gel electrophoresis detection of an amplification product, recovery of a target fragment after detection, cloning by utilizing a cloning Vector pGEM-T Easy Vector and an escherichia coli competent strain TOP10 and the like.
Compared with the prior art, the method has the following beneficial effects:
1. the existing enteromorpha floating ecological type specific SCAR molecular marker is a single-copy molecular marker coded by a cell nucleus genome, and due to extremely low copy number, the successful amplification of a positive sample highly depends on the better physiological state of a seaweed sample and the preparation of a high-quality total DNA template. Therefore, when a large number of samples are tested, a proportion of false negative results are generated, and the negative samples need to be tested repeatedly for confirmation. The invention provides a chloroplast genome encoded specific molecular marker, which keeps high specificity to floating ecotype and has the characteristic of high copy number, thereby remarkably improving the stability and reliability of detection and improving the working efficiency.
2. The enteromorpha floating ecotype chloroplast specific molecular marker provided by the invention can provide an important molecular tool for early warning and process tracking of green tide of enteromorpha in yellow sea and monitoring of diffusion invasion of the enteromorpha floating ecotype to other habitats.
Drawings
FIG. 1 shows the amplification of a comparison of the nucleus-encoded SCAR marker (A) and the chloroplast-encoded novel marker (B) in Enteromorpha prolifera floating in the yellow sea, provided by an embodiment of the present invention. M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Co., Ltd.); 1-5: 5 individual yellow sea green tide enteromorpha plants in 2020 year; 6-13, 18-39: 30 single yellow sea green tide enteromorpha plants in 2019 years; 14-17: 4 single yellow sea green tide enteromorpha plants in 2018 years; PC: a positive control; BC: blank control.
FIG. 2 shows that the specific molecular marker of the floating ecotype chloroplast genome of Enteromorpha prolifera provided by the embodiment of the invention floats Enteromorpha prolifera in perennial yellow sea green tide (U. prolifera) Amplification in a sample. M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Co., Ltd.); 1-14: 14 single-plant samples of green tide enteromorpha in the yellow sea of 2016; 15-34: 20 single-plant samples of yellow sea green tide enteromorpha in 2018 years; 35-56, 69-79: 33 single-plant samples of yellow sea green tide enteromorpha in 2019 years; 57: 1 single-plant sample of yellow sea green tide enteromorpha in 2007; 58-68: 11 individual samples of yellow sea green tide enteromorpha in 2020 years; PC, positive control; BC: blank control.
FIG. 3 shows the amplification of specific molecular markers of enteromorpha floating ecotype chloroplast genome in samples of enteromorpha stationary population. M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Co., Ltd.); 1-18: 18 samples of a Shandong Weihai population; 19-20: 2 samples of Zhejiang Ningbo population; 21-22: 2 samples of Jiangsu salt city population; 23-25, 56, 72-74, 76: 8 samples of Fujian Fuzhou group; 26-32: 7 samples of Fujianningde population; 33: 1 sample of the Japanese population; 34: 1 sample of korean group; 35-37: 3 samples of Zhejiang Zhoushan population; 38-44, 57-71: 12 samples of Fujian mansion population; 45-55: 11 samples of Fujian Dongshan population; 75: 1 sample of Fujian Quanzhou group; PC: a positive control; BC: blank control.
FIG. 4 shows that the specific molecular marker of the enteromorpha floating ecotype chloroplast genome provided by the embodiment of the invention has wide representativeness in other ulva (Ulva) along the coast of ChinaUlva) Amplification in species. M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Co., Ltd.); 1-8: 8 are provided withU. compressaCarrying out single plant cultivation; 9-19: 11 are provided withU. linzaCarrying out single plant cultivation; 20-32: 13 are provided withU. meridionalisCarrying out single plant cultivation; 33-41: 9 are provided withU. flexuosaCarrying out single plant cultivation; 42-54: 13 are provided withU. australisCarrying out single plant cultivation; 55-58: 4 are provided withU. lactucaCarrying out single plant cultivation; 59-66: 8 are provided withU. rigidaCarrying out single plant cultivation; 67-68: 2 are provided withU. ohnoiCarrying out single plant cultivation; 69: 1 is provided withU. simplexCarrying out single plant cultivation; 70: 1 is provided withU. splitianaCarrying out single plant cultivation; 71-72: 2 are provided withU. chauguliiCarrying out single plant cultivation; 73: 1 is provided withU. intestinalisCarrying out single plant cultivation; PC: a positive control; BC: blank control.
FIG. 5 shows the amplification of specific molecular markers of the enteromorpha floating ecotype chloroplast genome in various species of epiphytic green algae on the laver raft frame. M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Ltd.); M: trans2K Plus II DNA Marker (Beijing Quanjin Biotechnology Co., Ltd.); 1-2,8-22, 27-33, 35-66: 46 pieces of Enteromorpha proliferaU. flexuosaCarrying out single plant cultivation; 3-7, 23-26, 34: 10 Enteromorpha linza LinnU. linzaCarrying out single plant cultivation; 67-75: 9 enteromorpha proliferaU. proliferaCarrying out single plant cultivation; PC: a positive control; BC: blank control.
Detailed Description
The specific molecular marker of the enteromorpha floating ecotype chloroplast genome and the application thereof are further described in detail with reference to specific embodiments.
According to the invention, the primer is used for amplification, a specific strip of about 966 bp can be obtained from the enteromorpha floating ecological genome, and an amplification result is negative by taking an enteromorpha fixed population sample or genomes of other species of ulva as a template, which indicates that the marker is an enteromorpha floating ecological specific molecular marker (SEQ ID NO. 1). The enteromorpha floating ecological chloroplast genome specific primer or molecular marker provided by the invention can provide an important molecular tool for early warning and process tracking of green tide of enteromorpha in yellow sea and monitoring of diffusion invasion of the enteromorpha floating ecological to other habitats.
Example 1: design, screening and verification of enteromorpha floating ecological chloroplast genome specific molecular marker
Is prepared from Ulva (Ulva) EnteromorphaUlva prolifera) Floating ecotype (S096) and Enteromorpha prolifera fixed population sample (U161) as materials, and ITS encoded by cell nucleus genome, 5S spacer, specific SCAR molecular marker of Enteromorpha prolifera floating ecotype and encoded by chloroplast genomerbcThe L molecular marker was used to identify all the test materials again for molecular characterization, to confirm their species and subspecificity level of classification assignment. From the above analysis, it can be seen that S096 is Enteromorpha prolifera (Enteromorpha prolifera) of UlvaU. prolifera) The floating ecotype of (1) is a specific ecotype which induces yellow sea green tide; u161 is Enteromorpha prolifera (Enteromorpha prolifera) of UlvaU. prolifera) But not a floating ecotype.
And sequencing by utilizing a second-generation high-throughput sequencing technology, splicing, assembling and annotating chloroplast genome sequences of ulva species (such as KP720616, NC036137, NC030312 and the like) which are disclosed by NCBI (national center of Biotechnology) as reference sequences, so as to obtain the enteromorpha floating ecotype sample and the enteromorpha definitive colony sample chloroplast genome completion diagram.
On the basis, by utilizing a comparative genome research method, the indexes of genome Structural Variation (SV), indels, SNP, simple repeat sequences (SSR) and the like of the two are compared and analyzed, the sequence variation characteristics of the two are obtained, and the main nucleotide sequence difference and the position of the main nucleotide sequence difference between the two are determined. Based on the bioinformatics analysis result, specific amplification primers are designed and synthesized by using Primer 3 software aiming at a plurality of selected different sequences, and the Primer design principle is as follows: 1) can be completely homologously matched in the chloroplast genome of the enteromorpha floating ecological sample; 2) the enteromorpha prolifera vegetative population samples and chloroplast genomes of other ulva species in NCBI can not be matched.
Finally determining the amplification primers of the enteromorpha floating ecological chloroplast genome specific molecular markers as follows:
an upstream primer: 5'-ACCAACAAATACCCCATTCTTTGA-3'
A downstream primer: 5'-TTTCTCTCCATACCCCCATCG-3'
And then, using the sample material and a plant genome DNA extraction kit of Tiangen corporation, respectively preparing genome total DNA templates of each sample according to the instructions, and respectively carrying out amplification test by using the obtained primers.
A25. mu.l PCR reaction included: 9.5. mu.l ddH2O, 12.5. mu.l of 2 XTaq Master Mix (Novoprotein Scientific Inc., Suzhou, China), 0.5. mu.l of forward primer (10. mu.M), 0.5. mu.l of reverse primer (10. mu.M), 2.0. mu.l of template DNA (about 30 ng/. mu.l).
The PCR amplification procedure of the primers was: multiplying by 10 min at 94 ℃; at 94 ℃ for 45 s, at 52.5 ℃ for 45 s, at 72 ℃ for 1 min, for 35 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃.
And detecting the PCR product by 1.5% agarose gel electrophoresis, cutting the gel, recovering a target band, and performing clone sequencing to obtain a primer amplification product of 966 bp, namely the enteromorpha floating ecological chloroplast genome specific molecular marker (SEQ ID NO. 1).
SEQ ID NO.1：
ACCAACAAATACCCCATTCTTTGAAAATAGATAGGTTCAAAGTTTTGTTCAAATTTAAAGGAAAACCAGCAAACTTGACCTATAGTAAGTTCAAAAAAGAAAAAGAATATTTAGAAAACCGTTACGGTTTCAATATAGAAGATTTTGCCTCGATAGTGGGTGTTTCAATGGCTGGGTTAGAGTTGATATCGCCAAATAATAAATATGATTTGTGTGAGGTGGATTTTGACAAATTCAATAAATTCTTCACCGAATCGAAGGTTAATAATATTTTGGAGTTAAAATATTTTGAAAATTTAACTTACAAAGAGCTTTTGGTTGAATTGTTTGAAGAGCGTAGTTATCGCGAGCGCACTATATACAATAAATCTTTAAATGAGGATGGTTTGAAAAAAATGCACATTTTTAATACAAATAAATATGATATAAGCGAAAATGATTTCGACCTTAAGCTAACAAAAACTAAATGGTTTTGTTCGGTAAACCAAACACAGTACGATATATAAATGATTGTTCGGTCGAACAATCATTTATAATAAAGTTAGCCCGAAAGAACAAAAGCTTTTATACTTTGTTCGGAAGTATAAAATACATAATTTAAAAATCTAAAAAAAAGCATTTTTAATCGATGCGATTAAGCGAACATTTAAAAACGACTTTGTTCGCTTAATCTAACAAAAACACTTTTCATCTGTTCTTATTACAAAACATAATATATGTTCTGTTCTTTCTCAGAGTAAAGCATTTTGTTATAAAAAATTACTTTAAAAAAAAATTTTTTAATTTAAAAATTATTTTTTAAAAATACCAAAATTACTGATTTTAAAAATTTACATTGATTTGCGATTTCGACCAAATTTTTATTGATGTATTAAAAAAGGAAAACAAACTCAATCTAACCCTAGATAATTTAAACTTAATAAAAGAATATTATTCATACCCCTACGATGGGGGTATGGAGAGAAA
(a) Sequence characteristics:
● length: 966 bp
● type: base sequence
● chain type: single strand
● topology: linearity
(b) Molecular type: DNA
(c) Suppose that: whether or not
(d) Antisense: whether or not
(e) The initial sources were: enteromorpha (A), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B) and (C)Ulva prolifera）
The sequence structure is characterized in that: is free of
Example 2: comparing the effect of nucleus-encoded SCAR marker and chloroplast-encoded novel marker in detecting green tide algae
According to the disclosed genome sequence of the enteromorpha prolifera floating in the yellow sea (NCBI serial number: GCA 004138255), bioinformatics analysis finds that the previously developed specific SCAR marker of the enteromorpha prolifera floating ecotype is coded by a cell nucleus genome and is a single-copy molecular marker. Due to the extremely low copy number, successful amplification of positive samples is highly dependent on the preparation of algal samples with good physiological status and high quality total DNA template. Therefore, when a large number of samples are tested, a proportion of false negative results are produced, and repeated tests are required for repeated confirmation.
In order to solve the problems, 39 floating green algae samples collected from the yellow sea green tide outbreak period in 2018 and 2020 are randomly selected, and the total genome DNA templates of the individual samples are respectively prepared according to the instructions by utilizing a plant genome DNA extraction kit of Tiangen corporation.
First, an ITS, a 5S spacer region is used,rbcL and the like are used for carrying out species level molecular identification, and the samples are enteromorpha (Enteromorpha prolifera)U. prolifera) (ii) a Aiming at identified enteromorphaU. proliferaAnd further, performing single PCR identification on the genetic characteristics of each enteromorpha sample at the lower level by respectively using the SCAR molecular marker and the chloroplast genome specific molecular marker provided by the invention, and comparing.
Amplification was carried out using the specific primers described in the above examples, and the amplification system and procedure were carried out as described in example 1;
PCR amplification conditions Using SCAR molecular markers, see for details Genetic analyses of floatingUlva prolifera in the Yellow Sea suggest a unique ecotype (Estuarine, Coastal and Shelf Science 2015. 163: 96-102).
The amplification product was subjected to agarose gel electrophoresis, and the results showed that: 1) in all 39 floating enteromorpha samples (numbered as 1-39), the single detection positive rate of the SCAR molecular marker is 58.97%, the positive samples all show characteristic strips of 830bp, and the amplification results of 16 samples are negative (see figure 1 (A)); 2) the single PCR amplification results of the same batch of 39 floating enteromorpha samples using the enteromorpha floating ecotype chloroplast genome specific molecular marker (SEQ ID NO. 1) are all positive, and each lane shows a characteristic band with 966 bp of amplification (see figure 1 (B)).
The results show that the enteromorpha floating ecological chloroplast genome specific molecular marker (SEQ ID NO. 1) has better detection sensitivity and more real and reliable detection results compared with the prior SCAR molecular marker.
Example 3
The specific primers obtained by the method and the labeled detection kit have higher sensitivity and more real and reliable detection results, and further analyze a large number of samples:
using the primer obtained in example 1 as a specific primer, and following the amplification system and procedure described in example 1, samples of Enteromorpha prolifera floating ecotype collected from the yellow-green tide of the past year, samples of Enteromorpha prolifera colonized group collected in a wide geographical range, and other Ulva genus (Ulva) having wide representativeness in the coastal region of China were subjected toUlva) Species samples, amplification products were electrophoresed on agarose gel.
Samples are collected from enteromorpha floating ecotype samples of yellow sea green tide in the past year, enteromorpha fixed population samples collected in a wide geographical range and other ulva genera with wide representativeness in China coastal regionUlva) Species samples, amplification products were electrophoresed through agarose gel (see fig. 2-4).
The results show that: 1) in all 79 enteromorpha floating ecotype samples (numbered as 1-79), the amplification results of specific molecular markers (SEQ ID NO. 1) of enteromorpha floating ecotype chloroplast genomes are positive, and 966 bp characteristic strips are obtained (shown in figure 1); 2) in 76 samples (numbered as 1-76) in total of 11 enteromorpha stationary groups, amplification results of specific molecular markers (SEQ ID NO. 1) of enteromorpha floating ecotype chloroplast genomes are all negative (shown in figure 2); 3) a total of 73 other ulva genera with broad representativeness in china coastal region (Ulva) In species samples (numbered as 1-73), amplification results of specific molecular markers (SEQ ID NO. 1) of enteromorpha floating ecotype chloroplast genomes are all negative (see figure 3).
The results show that the chloroplast genome molecular marker (SEQ ID NO. 1) provided by the invention has high specificity for the enteromorpha floating ecotype.
Example 4: application of new marker in early yellow sea green tide (attachment stage of laver raft frame)
A large number of studies show that large-area porphyra yezoensis culture rafts and ropes located in northern Jiangsu radiant sandbars become important substrates for large-scale growth of green algae in ulva; in addition, along with the production activities of laver harvesting and raft and boom rope recovery cleaning,the epiphytic green algae are intensively cleaned into the sea, and become an important source of yellow sea green tide every year. Notably, the periphyton green algae on the raft are selected from the genus Ulva (Ulva: (Ulva)Ulva) And genus lichen (A), (B), (C)Blidingia) A plurality of species including Enteromorpha linza (A), (B), (C) and (C)U. linza) (iii) Enteromorpha leaven: (III)U. flexuosa) Enteromorpha compressa (Enteromorpha compressa)U. compressa) Enteromorpha prolifera (A) and (B)U. prolifera) And a coating ofBlidingiasp.), wherein only Enteromorpha (mainly floating ecotype) will proliferate violently and trigger yellow sea green tide as an absolute dominant species, and in some years green tide algae also contains a certain proportion of Enteromorpha oblata, while other epiphytic green algae species will not trigger green tide.
Earlier researches also show that species composition and proportion of periphyton green algae in the raft frame can be greatly changed in different years, and the proportion of the enteromorpha floating ecotype is related to the green tide scale in the same year. Therefore, the early detection of the proportion of the enteromorpha floating ecotype in the periphyton green algae of the porphyra raft frame of the northern Jiangsu radiation is enhanced, and an important scientific basis can be provided for the early monitoring, scale prediction and early warning and forecast of the yellow sea green tide.
In order to verify the actual effect of carrying out early monitoring, the collection of raft frame epiphytic green algae samples is carried out in spring 2020 in the culture area of porphyra yezoensis irradiated in northern Jiangsu, 75 healthy green algae samples with complete shapes are randomly selected after collection, the total genome DNA templates of each single plant sample are respectively prepared according to the description by using a plant genome DNA extraction kit of Tiangen company, and then the detection and analysis are carried out, specifically:
for the selected samples, first, the ITS, 5S spacer region is used,rbcL and other conventional molecular markers are used for carrying out molecular identification of species level, and 46 Enteromorpha prolifera (Enteromorpha prolifera) (L and other conventional molecular markers) are identifiedU. flexuosa) 20 Enteromorpha linza (Enteromorpha linza, and Enteromorpha linzaU. linza) And 9 Enteromorpha prolifera (A), (B) and (C)U. prolifera) A sample; further, each green alga sample was identified using the chloroplast genome specific molecular marker (SEQ ID No. 1) provided in example 1, and the amplification product was subjected to agarose gel electrophoresis, and the results are shown in fig. 5: 1) in all 9 enteromorpha samples (number 67-75), amplification resultsThe positive result is positive, the positive rate is 100%, and each lane shows a characteristic band with 966 bp amplification; 2) in all 66 other species samples (numbered 1-66), the amplification was negative and no specific band was detected.
The results show that aiming at the existing species composition characteristics of the epiphytic green algae on the laver raft frame on the northern Suzhou shoal, the chloroplast specific molecular marker disclosed by the invention can be used for quickly and accurately detecting the floating ecotype of the enteromorpha in a specific manner, so that important molecular tools and basic data are provided for early monitoring, scale prediction and early warning and forecast of the green tide in the yellow sea.
Sequence listing
<110> oceanographic institute of Chinese academy of sciences
<120> specific molecular marker of enteromorpha floating ecotype chloroplast genome and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 966
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
accaacaaat accccattct ttgaaaatag ataggttcaa agttttgttc aaatttaaag 60
gaaaaccagc aaacttgacc tatagtaagt tcaaaaaaga aaaagaatat ttagaaaacc 120
gttacggttt caatatagaa gattttgcct cgatagtggg tgtttcaatg gctgggttag 180
agttgatatc gccaaataat aaatatgatt tgtgtgaggt ggattttgac aaattcaata 240
aattcttcac cgaatcgaag gttaataata ttttggagtt aaaatatttt gaaaatttaa 300
cttacaaaga gcttttggtt gaattgtttg aagagcgtag ttatcgcgag cgcactatat 360
acaataaatc tttaaatgag gatggtttga aaaaaatgca catttttaat acaaataaat 420
atgatataag cgaaaatgat ttcgacctta agctaacaaa aactaaatgg ttttgttcgg 480
taaaccaaac acagtacgat atataaatga ttgttcggtc gaacaatcat ttataataaa 540
gttagcccga aagaacaaaa gcttttatac tttgttcgga agtataaaat acataattta 600
aaaatctaaa aaaaagcatt tttaatcgat gcgattaagc gaacatttaa aaacgacttt 660
gttcgcttaa tctaacaaaa acacttttca tctgttctta ttacaaaaca taatatatgt 720
tctgttcttt ctcagagtaa agcattttgt tataaaaaat tactttaaaa aaaaattttt 780
taatttaaaa attatttttt aaaaatacca aaattactga ttttaaaaat ttacattgat 840
ttgcgatttc gaccaaattt ttattgatgt attaaaaaag gaaaacaaac tcaatctaac 900
cctagataat ttaaacttaa taaaagaata ttattcatac ccctacgatg ggggtatgga 960
gagaaa 966
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
accaacaaat accccattct ttga 24
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tttctctcca tacccccatc g 21
Claims (7)
1. An enteromorpha floating ecological chloroplast genome specific molecular marker amplification primer is characterized in that: the enteromorpha floating ecological chloroplast genome specific molecular marker amplification primer comprises:
an upstream primer: 5'-ACCAACAAATACCCCATTCTTTGA-3'
A downstream primer: 5'-TTTCTCTCCATACCCCCATCG-3' are provided.
2. The application of the enteromorpha floating ecotype chloroplast genome specific molecular marker amplification primer according to claim 1, which is characterized in that: the primer is used for amplifying specific molecular markers of chloroplast genomes of enteromorpha floating ecotypes (floating ecotypes), and the amplified markers are applied to early warning of green tide of enteromorpha in the yellow sea, process tracking and monitoring of diffusion invasion of the enteromorpha floating ecotypes to other habitats.
3. An enteromorpha floating ecotype chloroplast genome specific molecular marker is characterized in that: the specific molecular marker of the enteromorpha floating ecotype chloroplast genome is shown as a base sequence in SEQ ID NO. 1.
4. The application of the enteromorpha floating ecotype chloroplast genome specific molecular marker in claim 3, is characterized in that: the enteromorpha floating ecological chloroplast genome specific molecular marker is used for early warning of green tide of enteromorpha in yellow sea, process tracking monitoring or diffusion invasion monitoring to other habitats, and is applied to identification of the enteromorpha floating ecological proportion.
5. A detection kit for identifying floating ecological enteromorpha is characterized in that: the kit contains the primer according to claim 1.
6. A method for identifying floating ecological enteromorpha is characterized by comprising the following steps:
carrying out PCR amplification on total DNA extracted from the enteromorpha by using the enteromorpha floating ecotype chloroplast genome specific molecular marker specific primer of claim 1;
amplifying by taking the genome of the enteromorpha floating ecotype as a template and a primer pair to obtain a specific band of about 966 bp by amplification, wherein the characteristic band is a specific molecular marker of the enteromorpha floating ecotype chloroplast genome shown in SEQ ID NO.1, and the amplification result is positive;
no specific band is amplified, and the amplification result is negative.
7. The method for identifying floating ecotype enteromorpha according to claim 6, wherein: the PCR amplification system is as follows: 25 μ l, 9.5 μ l ddH2O, 12.5. mu.l of 2 XTaq Master Mix (Novoprotein Scientific Inc., Suzhou, China), 0.5. mu.l of forward primer (10. mu.M), 0.5. mu.l of reverse primer (10. mu.M), 2.0. mu.l of template DNA (about 30 ng/. mu.l);
the PCR amplification procedure of the primers was: multiplying by 10 min at 94 ℃; at 94 ℃ for 45 s, at 52.5 ℃ for 45 s, at 72 ℃ for 1 min, for 35 cycles; multiplying by 72 ℃ for 10 min; storing at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110797903.7A CN113278728B (en) | 2021-07-15 | 2021-07-15 | Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110797903.7A CN113278728B (en) | 2021-07-15 | 2021-07-15 | Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113278728A true CN113278728A (en) | 2021-08-20 |
| CN113278728B CN113278728B (en) | 2021-10-15 |
Family
ID=77286741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110797903.7A Active CN113278728B (en) | 2021-07-15 | 2021-07-15 | Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113278728B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115713232A (en) * | 2022-11-12 | 2023-02-24 | 山东省海洋资源与环境研究院(山东省海洋环境监测中心、山东省水产品质量检验中心) | Apostichopus japonicus bottom sowing proliferation risk joint defense early warning system |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561333A (en) * | 2015-01-20 | 2015-04-29 | 上海海洋大学 | Method for rapidly identifying green tide enteromorpha algae |
| CN106884055A (en) * | 2017-04-25 | 2017-06-23 | 上海海洋大学 | A kind of method that utilization gel electrophoresis differentiates green tide Enteromorpha algae |
| CN107988408A (en) * | 2017-12-18 | 2018-05-04 | 中国科学院海洋研究所 | A kind of primer pair, DNA bar code and its application for identifying Enteromorpha sibling species and detection method |
| CN108315468A (en) * | 2018-04-08 | 2018-07-24 | 中国科学院海洋研究所 | A kind of mitochondrial molecule mark primer of Enteromorpha population and its application |
-
2021
- 2021-07-15 CN CN202110797903.7A patent/CN113278728B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561333A (en) * | 2015-01-20 | 2015-04-29 | 上海海洋大学 | Method for rapidly identifying green tide enteromorpha algae |
| CN106884055A (en) * | 2017-04-25 | 2017-06-23 | 上海海洋大学 | A kind of method that utilization gel electrophoresis differentiates green tide Enteromorpha algae |
| CN107988408A (en) * | 2017-12-18 | 2018-05-04 | 中国科学院海洋研究所 | A kind of primer pair, DNA bar code and its application for identifying Enteromorpha sibling species and detection method |
| CN108315468A (en) * | 2018-04-08 | 2018-07-24 | 中国科学院海洋研究所 | A kind of mitochondrial molecule mark primer of Enteromorpha population and its application |
Non-Patent Citations (7)
| Title |
|---|
| CHISA MITSUHASHI 等: "Construction of genomic marker sets based on the chloroplast genome of a green alga, Ulva pertusa (syn. Ulva australis), leads to simple detection of Ulva species", 《GENES GENET. SYST.》 * |
| QING-CHUN ZHANG 等: "Genetic evidence in tracking the origin of Ulva prolifera blooms in the Yellow Sea, China", 《HARMFUL ALGAE》 * |
| WANG,L. 等: "KX342867.1 Ulva prolifera chloroplast, complete genome", 《GENBANK》 * |
| WEI SONG 等: "Molecular identification of the macroalgae that cause green tides in the Bohai Sea, China", 《AQUATIC BOTANY》 * |
| YUE LI 等: "Genetic diversity of Ulva prolifera population in Qingdao coastal water during the green algal blooms revealed by microsatellite", 《MARINE POLLUTION BULLETIN》 * |
| 解威峰 等: "tuf A 区分黄海绿潮优势种浒苔及其近缘种的适用性评价研究", 《环境科学与管理》 * |
| 马莹莹 等: "浒苔(Ulva prolifera)漂浮生态型的分枝表型及其可塑性", 《海洋科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115713232A (en) * | 2022-11-12 | 2023-02-24 | 山东省海洋资源与环境研究院(山东省海洋环境监测中心、山东省水产品质量检验中心) | Apostichopus japonicus bottom sowing proliferation risk joint defense early warning system |
| CN115713232B (en) * | 2022-11-12 | 2024-04-23 | 山东省海洋资源与环境研究院(山东省海洋环境监测中心、山东省水产品质量检验中心) | Stichopus japonicus bottom sowing proliferation risk joint defense early warning system |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113278728B (en) | 2021-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pang et al. | Tracking the algal origin of the Ulva bloom in the Yellow Sea by a combination of molecular, morphological and physiological analyses | |
| Asano et al. | Complete nucleotide sequence of the sugarcane (Saccharum officinarum) chloroplast genome: a comparative analysis of four monocot chloroplast genomes | |
| Martin et al. | Molecular phylogenies in angiosperm evolution. | |
| Paul et al. | Micro-and macrodiversity in rbcL sequences in ambient phytoplankton populations from the southeastern Gulf of Mexico | |
| Sato et al. | Organization, developmental dynamics, and evolution of plastid nucleoids | |
| McDonald et al. | Genetic diversity of eukaryotic ultraphytoplankton in the Gulf of Naples during an annual cycle | |
| Darling et al. | Molecular phylogeny of the planktic foraminifera | |
| Liu et al. | The dominant Ulva strain of the 2008 green algal bloom in the Yellow Sea was not detected in the coastal waters of Qingdao in the following winter | |
| Liu et al. | Ulva macroalgae within local aquaculture ponds along the estuary of Dagu River, Jiaozhou Bay, Qingdao | |
| Zhang et al. | Genetic evidence in tracking the origin of Ulva prolifera blooms in the Yellow Sea, China | |
| CN111893202A (en) | Method for rapidly identifying medlar based on DNA bar code | |
| CN113278728B (en) | Enteromorpha floating ecological chloroplast genome specific molecular marker and application thereof | |
| Liu et al. | Chloroplast genomes of the green-tide forming alga Ulva compressa: comparative chloroplast genomics in the genus Ulva (Ulvophyceae, Chlorophyta) | |
| González et al. | A modification to the SCAR (Sequence Characterized Amplified Region) method provides phylogenetic insights within Ceratozamia (Zamiaceae) | |
| Nakazato et al. | Identification and expression analysis of cDNA encoding a chloroplast recombination protein REC1, the chloroplast RecA homologue in Chlamydomonas reinhardtii | |
| Qin et al. | Molecular biotechnology of marine algae in China | |
| CN110698550B (en) | Molecular detection method for rapidly identifying real plum/apricot plum strain | |
| CN107190097A (en) | The method that the SSR molecular marker being sequenced using transcript profile identifies dragon fruit germplasm | |
| Tanaka et al. | Complete elimination of endosymbiotic algae from Paramecium bursaria and its confirmation by diagnostic PCR | |
| CN107326035A (en) | A kind of adjusting and controlling rice grain type and the deubiquitination enzyme gene UBP5 of leaf color and its application | |
| Glotova et al. | Description of Leptomyxa silvatica n. sp.(Amoebozoa, Tubulinea, Leptomyxida), a new soil amoeba species from Chernevaya taiga soil of West Siberia, Russia | |
| CN115948577A (en) | Breeding method of high-temperature-resistant sea cucumbers | |
| CN112522290B (en) | Sea island cotton fiber quality related calcineurin B-like interaction protein kinase gene | |
| Bodaker et al. | D ead S ea rhodopsins revisited | |
| Jiat et al. | cDNA-SSR markers for molecular epidemiology of Ganoderma boninense |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |