CN113278593A - European PRRSV-N protein monoclonal antibody and preparation method and application thereof - Google Patents

European PRRSV-N protein monoclonal antibody and preparation method and application thereof Download PDF

Info

Publication number
CN113278593A
CN113278593A CN202110590168.2A CN202110590168A CN113278593A CN 113278593 A CN113278593 A CN 113278593A CN 202110590168 A CN202110590168 A CN 202110590168A CN 113278593 A CN113278593 A CN 113278593A
Authority
CN
China
Prior art keywords
protein
monoclonal antibody
prrsv
european prrsv
european
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110590168.2A
Other languages
Chinese (zh)
Inventor
贺东生
牛佳伟
蔡蔚游
李�根
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CN202110590168.2A priority Critical patent/CN113278593A/en
Publication of CN113278593A publication Critical patent/CN113278593A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6839—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting material from viruses
    • A61K47/6841—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting material from viruses the antibody targeting a RNA virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/10—Detection of antigens from microorganism in sample from host

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Genetics & Genomics (AREA)

Abstract

The invention provides a monoclonal antibody of European PRRSV-N protein, a preparation method of the monoclonal antibody and application of the monoclonal antibody in preparing an immunodetection tool for detecting the infection of the European PRRSV. According to the invention, the European PRRSV-N protein is taken as immunogen to immunize a mouse, a positive monoclonal hybridoma cell strain is prepared, ascites is induced and purified, and the European PRRSV-N protein monoclonal antibody is obtained.

Description

European PRRSV-N protein monoclonal antibody and preparation method and application thereof
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a European PRRSV-N protein monoclonal antibody, and a preparation method and application thereof.
Background
Porcine Reproductive and Respiratory Syndrome (PRRS) is a highly contagious disease caused by the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), which can cause sow reproductive dysfunction and respiratory system diseases of fattening pigs, is accompanied by mild neurological symptoms, can cause systemic viremia in severe cases, and produces cyanosis and purplish of the skin of both ears in the course of pathogenesis, so the Porcine reproductive and respiratory syndrome is also called as 'blue ear disease'. In recent years, new strains (such as NADC30 and NADC30-like) are continuously appeared due to gene recombination, so that the difficulty of preventing and controlling PRRS is increased. According to virus gene characteristics and the prevalence conditions in the global range, PRRSV can be divided into type 1 (European type) and type 2 (American type), the type 2 is mainly prevalent in China, but in recent years, the European type is the epidemic existing seedling head in China, the PRRSV genome is 15.2Kb long and contains 10 Open Reading Frames (ORFs), namely ORF1a, ORF1b, ORF2a, ORF2b, ORF3, ORF4, ORF5, ORF5a, ORF6 and ORF7, and short overlapping sequences exist between the adjacent Open Reading frames. The nucleocapsid protein N coded by ORF7 accounts for 20-40% of total virus protein, has strong immunogenicity, can stimulate the body to produce specific antibody for about one week after PRRSV infects pigs, and lasts for several months. Since many pigs are introduced from abroad by large domestic enterprises after outbreak of African swine fever in 2018, European PRRSV is likely to spread widely, so that a detection method for the European PRRSV is needed to be established, and a foundation is laid for the subsequent research on the European PRRSV.
Coli is a preferred system for expressing exogenous genes in vitro due to relatively simple operation and low preparation cost, but most of the exogenous proteins expressed by the escherichia coli exist in a form of insoluble inclusion bodies, so that the difference between the escherichia coli and natural active proteins is far, and the application of the escherichia coli is limited. Glutathione mercaptotransferase tag protein (GST) is transferase which plays an important role in the detoxification process, the natural size of the GST is 26kDa, and the GST is highly soluble protein capable of increasing the solubility of foreign protein and can be massively expressed in escherichia coli to improve the expression quantity of the foreign protein, so the GST can be massively applied to prokaryotic expression; the Flag tag protein is a hydrophilic polypeptide (DYKDDDDK) for encoding 8 amino acids, and a Kozak sequence constructed in the vector enables the fusion protein with the FLAG to have higher expression efficiency in a eukaryotic expression system; the size of the MBP (maltose binding protein) tag protein is 40kDa, the MBP is coded by malE gene of Escherichia coli K12, the MBP is fused at the N end or the C end of the protein, the solubility of fusion protein which is over-expressed in bacteria, especially eukaryotic protein can be increased, and the MBP tag can be conveniently detected by immunoassay; the 6 XHis refers to a fusion tag consisting of six histidine residues, which can be inserted into the C-terminal or N-terminal of the target protein, and His-tag has several advantages: the molecular weight of the label is small, and is only 0.84 kDa; the His-tag fusion protein can be purified in the presence of a non-ionic surfactant or under denaturing conditions; his-tag fusion proteins have also been used in protein-protein, protein-DNA interaction studies; the immunogenicity of the His label is relatively low, and the purified protein can be directly injected into animals for immunization to prepare antibodies; the method can be applied to various expression systems, and the purification condition is mild; the parent and tag may be constructed together with other affinity tags.
The PRRSV N protein is an alkaline protein, has good local hydrophilicity, can realize the soluble expression of the PRRSV N protein in escherichia coli by adjusting expression conditions, adding a dissolution promoting label and other modes, and can obtain a large amount of high-purity recombinant N protein by verifying the immunogenicity of the PRRSV N protein through Western blot after expression.
In conclusion, it is necessary to provide a method for preparing an RRSV N protein monoclonal antibody in vitro, which is important for the follow-up development of other detection methods, the tracking, monitoring, prevention and control of European PRRSV in the prevalence trend in China, and simultaneously lays a material foundation for further exploring the epitope of the N protein and establishing a PRRSV diagnosis method.
Disclosure of Invention
In view of the above, the present invention provides a monoclonal antibody against a european PRRSV-N protein, a method for preparing the monoclonal antibody, and an application of the monoclonal antibody in preparing an immunoassay tool for detecting infection with a european PRRSV. According to the invention, the European PRRSV-N protein is taken as immunogen to immunize a mouse, a positive monoclonal hybridoma cell strain is prepared, ascites is induced and purified, and the European PRRSV-N protein monoclonal antibody is obtained.
The invention provides a hybridoma cell strain which secretes European PRRSV-N protein monoclonal antibody.
The second aspect of the invention provides a European PRRSV-N protein monoclonal antibody, wherein the European PRRSV-N protein monoclonal antibody specifically recognizes the European PRRSV-N protein, and the monoclonal antibody is obtained by secretion of a hybridoma cell strain of the first aspect of the invention.
In one embodiment of the present invention, the european PRRSV-N protein, the corresponding PCR amplification product thereof, can be obtained by PCR amplification with the following specific primers:
an upstream primer F: CGCGGATCCATGGCCGGTAAAAA (SEQ ID NO.1), the BamHI cleavage site is underlined;
a downstream primer R: CC (challenge collapsar)GGAATTCTCAATTTGCATCCT (SEQ ID NO.2), the EcoRI cleavage sites are underlined;
wherein, BamHI enzyme cutting site is introduced into the 5 'end of the upstream primer F, and EcoRI enzyme cutting site is introduced into the 5' end of the downstream primer R.
In a preferred embodiment of the present invention, the PCR amplification reaction conditions are as follows:
Figure BDA0003089201870000031
in one embodiment of the invention, the monoclonal antibody of the European PRRSV-N protein does not bind to any one of HC, PCV2, PRV, SVV and PDCoV viruses.
In a third aspect, the present invention provides a recombinant protein having:
(i) a monoclonal antibody according to the second aspect of the invention; and
(ii) optionally a tag sequence to facilitate expression and/or purification.
In a fourth aspect, the present invention provides an immunoconjugate comprising:
(a) a monoclonal antibody according to the second aspect of the invention; and
(b) a coupling moiety selected from the group consisting of: a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.
In a fifth aspect, the present invention provides a pharmaceutical composition comprising:
(i) a monoclonal antibody according to the second aspect of the invention, or a recombinant protein according to the third aspect of the invention, or an immunoconjugate according to the fourth aspect of the invention; and
(ii) a pharmaceutically acceptable carrier.
In one embodiment of the present invention, the carrier is Freund's incomplete adjuvant.
In a sixth aspect, the present invention provides the use of a monoclonal antibody according to the second aspect of the invention, or a recombinant protein according to the third aspect of the invention, an immunoconjugate according to the fourth aspect of the invention, or a pharmaceutical composition according to the fifth aspect of the invention, in the manufacture of a medicament, a reagent, a detection plate or a kit for detecting a european type PRRSV-N protein.
The seventh aspect of the invention provides a preparation method of a monoclonal antibody of European PRRSV-N protein, which comprises the following steps:
1) preparing high-purity European PRRSV-N protein;
2) immunizing a mouse by taking the European PRRSV-N protein prepared in the step 1) as an immunogen;
3) fusing splenocytes of the immunized mice with myeloma cells to prepare hybridoma cells;
4) carrying out positive cloning screening on the hybridoma cells prepared in the step 3) to obtain a positive monoclonal hybridoma cell strain;
5) inducing ascites of the positive monoclonal hybridoma cell strain obtained in the step 4), and purifying to obtain the European PRRSV-N protein.
In one embodiment of the present invention, the european PRRSV-N protein in step 1) can be PCR amplified by the following specific primers:
an upstream primer F: CGCGGATCCATGGCCGGTAAAAA (SEQ ID NO.1), the BamHI cleavage site is underlined;
a downstream primer R: CC (challenge collapsar)GGAATTCTCAATTTGCATCCT (SEQ ID NO.2), the EcoRI cleavage sites are underlined;
wherein, BamHI enzyme cutting site is introduced into the 5 'end of the upstream primer F, and EcoRI enzyme cutting site is introduced into the 5' end of the downstream primer R.
In a preferred embodiment of the present invention, the PCR amplification reaction conditions are as follows:
Figure BDA0003089201870000041
in one embodiment of the invention, the preparation method of the European PRRSV-N protein in the step 1) comprises the steps of constructing a recombinant plasmid of PRRSV-N by adopting a molecular cloning means, transferring the recombinant plasmid into BL21 competent cells for protein expression, and purifying to obtain the high-purity European PRRSV-N protein.
In one embodiment of the invention, the mouse of step 2) is a BALB/c mouse.
In one embodiment of the invention, the immunogen in step 2) is immunized in mice by subcutaneous multiple-point immunization.
In one embodiment of the invention, the immunogen in step 2) is immunized with the European PRRSV-N protein in an amount of 50. mu.g/mouse.
In one embodiment of the invention, the immunogenic European PRRSV-N protein in the step 2) is emulsified by mixing with an equal volume of Freund's incomplete adjuvant and then is immunized.
In an embodiment of the present invention, the spleen cells and myeloma cells of the immunized mouse in step 3) need to be screened before being fused, the screening method is to detect the antibody titer in serum by using an ELISA technology, and the spleen cells and myeloma cells of a BALB/c mouse with the antibody titer meeting the requirement are taken to be fused.
In one embodiment of the present invention, the fusion ratio of spleen cells and myeloma cells of the immunized mouse in step 3) is 5: 1.
in an eighth aspect, the invention provides a hybridoma cell strain according to the first aspect of the invention, a monoclonal antibody against a european PRRSV-N protein according to the second aspect of the invention, a recombinant protein according to the third aspect of the invention, an immunoconjugate according to the fourth aspect of the invention, a pharmaceutical composition according to the fifth aspect of the invention, a use according to the sixth aspect of the invention, or a method for preparing a european PRRSV-N protein according to the seventh aspect of the invention, for preparing a PRRSV detection kit.
The invention has the beneficial effects that: the monoclonal antibody for secreting European PRRSV-N protein from the hybridoma cell strain has higher titer which exceeds 1: 12800 and has no cross reaction with HC, PCV2, PRV, SVV and PDCoV viruses, can be used for qualitatively or quantitatively detecting the PRRSV-N protein content by enzyme-linked immunosorbent assay (ELISA), and has the characteristics of convenient sample operation, low cost, quick reaction, high sensitivity, strong specificity and the like.
Drawings
FIG. 1 is a diagram showing the PCR amplification result of PRRSV ORF7 gene provided by the embodiment of the present invention, wherein lane M is DL5000DNA molecular mass standard, and lanes 1 and 2 are PCR amplification product of PRRSV ORF7 gene;
FIG. 2 is a diagram of the result of double digestion identification of the recombinant plasmid PET-32a-PRRSV-ORF7 provided by the embodiment of the present invention, wherein lane M is DL10000DNA molecular mass standard, lane 1 is the recombinant plasmid PPET-32a-PRRSV-ORF7, and lane 2 is the recombinant plasmid BamH I and EcoRI PPET-32a-PRRSV-ORF 7.
FIG. 3 is a SDS-PAGE detection result of recombinant N protein of PET-32a-PRRSV-ORF7 provided by the embodiment of the present invention, wherein lane M is a protein marker of 170kDa, and lanes 1-5 are induction times of 4h, 6h, 8h, 10h and 12h, respectively;
FIG. 4 is a SDS-PAGE result of the purification effect of the PET-32a-PRRSV-ORF7 recombinant N protein provided by the embodiment of the present invention, wherein lane M is a 170kDa protein marker, lane 1 is a supernatant before induction purification, lane 2 is a flow-through solution, lane 3 is a 50mmol/L imidazole washing solution, lane 4 is a 100mmol/L imidazole washing solution, and lane 5 is a 500mmol/L imidazole washing solution;
FIG. 5 is a diagram of a Western blot analysis result of His fusion N protein using rabbit serum for anti-European PRRSV-N protein as a detection antibody according to an embodiment of the present invention, wherein M is a 170kDa protein marker, 1 is a PET-32a-PRRSV-ORF7 recombinant N protein, and 2 is a negative control;
FIG. 6 is a diagram of a Western blot analysis result of His fusion N protein using an anti-His mouse monoclonal antibody as a detection antibody according to an embodiment of the present invention, wherein M is a 170kDa protein marker, 1 is a PET-32a-PRRSV-ORF7 recombinant N protein, and 2 is a negative control;
fig. 7 is a result of measuring ascites titer prepared from tumor cells provided in the example of the present invention, which shows that among the 5 strains prepared by the present invention, hybridoma cells 4D5, 1E7, 1F6, 7G1 and 6H8 which can stably secrete monoclonal antibodies against the european PRRSV-N protein, hybridoma cell 1F6 has the highest titer.
FIG. 8 shows the results of the indirect immunofluorescence assay of hybridoma cells according to the embodiment of the present invention, in which the culture supernatants of five hybridoma cell lines are used as primary antibodies, and the cell nuclei stained with IFA and DAPI are blue and positive are green, respectively, and the results show that the supernatants of 5 hybridoma cell lines can react with the antibody.
FIG. 9 shows Western blot identification of the monoclonal antibody provided in the embodiment of the present invention, wherein the supernatant of 5 cell lines is used as a primary antibody by using type I PRRSV-N recombinant protein as an antigen, and the DAB color developing solution is used for color development. The results are shown in the figure, and show that the above 5 monoclonal antibodies can be combined with recombinant protein.
Figure 10 is a sequence alignment of PRRSV strains provided by embodiments of the invention with known european and american strains.
Detailed Description
While the following is a description of the preferred embodiments of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention. The experimental methods in the examples, in which specific conditions are not specified, are generally carried out under conventional conditions. In the examples of the present invention, unless otherwise specified, reagents and consumables used therein are commercially available.
1. Material
(1) PCR amplification template and serum
pMD-18T-PRRSV-ORF7 plasmid containing European PRRSV-ORF7, rabbit serum resistant to European PRRSV N protein, European and American PRRSV positive and PRRSV negative pig sera, porcine circovirus type 2 (PCV2) positive pig serum, Classical Swine Fever Virus (CSFV) positive pig serum, pseudorabies virus (PRV) positive pig serum, Porcine Parvovirus (PPV) positive pig serum.
(2) Reagent
PET-32a vector, anti-His murine monoclonal antibody and Factor Xa were purchased from NEB; HRP-labeled anti-mouse IgG antibody, HRP-labeled anti-pig IgG antibody and HRP-labeled anti-rabbit IgG antibody were purchased from sigma company; BL21(DE3) competent cells were purchased from Kyoto Kogyo gold Biotech, Beijing; EX Taq DNA polymerase, DNA restriction enzyme, a plasmid miniextraction kit and a DNA purification and recovery kit are purchased from Takara bioengineering (Dalian) Co., Ltd; the nickel resin purification column was purchased from Wuhan Hui research Biotechnology GmbH; serum dilutions were purchased from qianzhou qianzhong biotechnology; immunoblotting chemiluminescent reagents (Pierce ECL Western Blotting Substrate) were purchased from Thermo corporation; IPTG, peptone, yeast extract and glucose were purchased from OXOID; ampicillin was purchased from Shanghai Crystal Biotechnology, Inc.
2. Construction of recombinant plasmids
1) Design of specific primers
Designing a specific primer according to a PRRSV-N protein coding gene sequence published in GenBank, introducing a BamHI restriction site at the 5 'end of an upstream primer F and introducing an EcoRI restriction site at the 5' end of a downstream primer R according to cloning requirements, wherein the specific nucleotide sequences of the primers are as follows:
an upstream F: CGCGGATCCATGGCCGGTAAAAA (SEQ ID NO.1), bottom barThe line is a BamHI enzyme cutting site;
downstream-R: CCGGAATTCTCAATTTGCATCCT (SEQ ID NO.2), the EcoRI cleavage sites are underlined.
2) PCR amplification
Figure BDA0003089201870000071
Figure BDA0003089201870000081
The results are shown in FIG. 1, and a large amount of PCR amplification products of PRRSV-N protein are obtained by PCR amplification.
3) Construction of recombinant expression vectors
Connecting the PCR amplification product of the recovered PRRSV-N protein to pMD18-T, after the sequencing is correct, carrying out double digestion on pMD18-PRRSV-N recombinant plasmid and pET32a (+) vector by BamHI and EcoRI, connecting PRRSV-N and linearized pET32a (+) by T4 ligase, transferring into DH5 alpha competent cells, extracting pET32a-PRRSV-N recombinant expression plasmid, carrying out double digestion electrophoresis identification, and showing that the PRRSV-N target gene is successfully inserted into pET32a vector, and the construction is correct as shown in figure 2. Then positive recombinant expression plasmid is transferred into BL21 competent cells for standby. The recombinant expression plasmid which is identified as positive is sent to Shanghai's chemical company for sequencing, the sequencing result is compared with the sequence in GeneBank for analysis, and the positive plasmid with correct nucleotide sequence is named as pET32 a-PRRSV-N.
3. Expression and purification of His fusion protein
Transferring BL21(DE3) positive recombinant plasmid into 400mL LB culture medium, shaking and culturing for 3h at 37 ℃ by a shaking table, adding IPTG (isopropyl-beta-thiogalactoside) into the culture solution to enable the final concentration to be 1mmol/L, carrying out induction culture at the temperature close to room temperature, preferably 23 ℃, and selecting the induction temperature close to the room temperature without heating or cooling equipment, wherein the induction time is 10-12 h; centrifuging at 4 ℃ and 6000r/min for 20min, collecting thalli, adding 15mL precooled PBST for resuspension, carrying out ultrasonic pyrolysis in ice bath for 30min under the conditions of power of 220w, working time of 3s and interval of 5s, centrifuging at 4 ℃ and 12000r/min for 15min after pyrolysis, and placing the supernatant at 4 ℃ for later use; adding 4mL of nickel resin into a 15mL chromatographic column, and washing the resin with 3 column volumes of buffer solution, namely Tris-HCl, 0.3mol/L NaCl and 1mmol/L EDTA; cleaning 20% ethanol, adding 15mL of ultrasonically-cracked supernatant in several times, mixing gently, incubating for 2h in a shaking table at 4 ℃, naturally filtering, and collecting flow-through liquid; adding 3-5 times of column volume of 100mmol/L imidazole to clean the hybrid protein; finally, adding 500mmol/L imidazole solution to elute the target protein, so that the required amount is reduced on the premise of ensuring the elution effect, and the cost is saved; further 500mmol/L imidazole was replaced with PBST using a cut-off 3KD ultrafiltration membrane. And (3) measuring the protein concentration of the purified fusion protein by using a BCA method, and calculating the content of the fusion protein in each liter of bacterial liquid.
4. Western blot analysis
After searching for the optimized expression conditions, determining that the expression quantity of the recombinant N protein is the highest under the conditions that the IPTG final concentration is 1mmol/L, the induction temperature is 23 ℃ and the induction time is 10-12 h. The purified His fusion N protein is subjected to SDS-PAGE detection, and the result is shown in figure 3; protein with molecular weight consistent with the theoretical value appears at 35kD as analyzed by SDS-PAGE electrophoresis. And the His fusion protein with higher purity is obtained after the purification of the nickel resin affinity chromatography. After purification, about 22mg of fusion protein with the purity of about 90% can be obtained from each liter of bacterial liquid, and the result is shown in FIG. 4; then, Western blot analysis is carried out, the primary antibody respectively selects anti-European PRRSV-N protein rabbit serum (the dilution is 1: 200) and anti-His mouse monoclonal antibody (the dilution is 1: 4000), after the corresponding secondary antibody reaction, ECL chemiluminescence method is used for exposure in a dark room, and non-induced recombinant bacteria are used as negative control.
And after the His recombinant N protein is separated by SDS-PAGE electrophoresis, transferring the His recombinant N protein to a PVDF membrane, and then respectively using rabbit serum for resisting the N protein and a His mouse-derived monoclonal antibody as primary antibodies to detect the reactionogenicity of the recombinant N protein. When the His mouse monoclonal antibody is used as a primary antibody, a specific target band appears at 35kD, but a recombinant N protein band of uninduced bacteria does not exist. The rabbit serum resisting the N protein is used for primary antibody detection, and an obvious specific target band appears at 35KD, which indicates that the His label does not influence the reactogenicity of the N protein. The results are shown in FIGS. 5 to 6
5. Preparation and immunization of antigens
1) Animal immunization
The inactivated European blue-ear virus strain and Freund's complete adjuvant are mixed uniformly, then mice are selected to be injected at multiple subcutaneous points, equivalent volume of Freund's incomplete adjuvant is added according to the injection amount of 50 mu g/mouse, and the vaccine is emulsified by two connected 20mL injectors. The inoculated mice are BALB/c female mice of 6-8 weeks old, the inoculation process is 1, 3 and 5 weeks, blood is collected at the tail of 7 weeks to measure the titer, and the mice meeting the titer are subjected to boosting immunization without adjuvant.
6. Cell fusion and screening
1) Preparation of SP2/0 myeloma cells
Recovering the frozen myeloma cells by the same recovery method as common cells, and replacing nutrient solution every day to prevent reversion. It also needs to be screened by 8-AG in 20% 1640 medium to remove mutant cells before it can be used. Cell concentration 1X 10 adjusted by RPMI6one/mL.
2) Preparation of feeder cells
Blood was collected from the eyeballs of the mice, the collected blood was used as negative serum, and then the mice were sacrificed and rapidly placed in 75% alcohol to soak for 5 minutes. Dissecting on gauze in sterilized tray, fully exposing abdominal cavity, washing abdominal cavity with 1640, and collecting liquid in abdominal cavity. Multiple low-speed centrifugal washing, re-suspending the cells with HAT medium, and adjusting the concentration to 5 × 105100. mu.L/well of each well was added to a 96-well plate, and the plate was left at 37 ℃ with 5% CO2An incubator.
3) Preparation of splenic lymphocytes
After the mice are boosted once again through serum titer measurement, blood is collected by eyeballs, and serum is collected as positive serum. The dead mice after blood collection are quickly soaked in 75% alcohol for 5 minutes, and then are laid with gauze in a sterilized tray for dissection, and the whole spleen is taken out. After cutting the spleen, the contents were placed in a sieve and ground using the propeller of a syringe. After grinding, the mixture was washed with 25mL1640 medium, and the liquid was collected and washed twice in a 50mL centrifuge tubeThe mixture was centrifuged at 1000rpm/min for 10 min. Adjusting the cell concentration to 1X 107one/mL.
4) Cell fusion
(1) 1mL of myeloma cells plus 5mL of spleen cells were taken, placed in a water bath in a beaker containing hot water at 37 ℃ and mixed with gentle shaking. After centrifugation, the supernatant was removed and the cells at the bottom were gently shaken loose.
(2) 0.7mL of PEG4000 was pipetted into the flask using a pipette according to the following procedure with gentle stirring while adding PEG4000 over an average of 45s and then gently stirring for 1 min. 1mL of 1640 medium was added while shaking the tube at 1 minute, first half minute, 2 s/drop; half minute, 1 s/drop. 2mL was added slowly at 2 min, and 3mL at 3 min, the total amount being 10mL 1640 medium. After standing at 37 ℃ for 10 minutes, the supernatant was centrifuged at low speed.
(3) Cells were resuspended in HAT medium, plated, 40mL of each plate was added, 40mL of HAT medium was added, and plated again, followed by 3 plates.
(4) Cultured at 37 ℃ in 5% CO2, and after 4 days, the medium was changed with HAT and one week later with HT.
5) Establishment of hybridoma cell strain
(1) Indirect ELISA method for detecting antibody in hybridoma cell culture supernatant
Approximately 10 days after cell fusion, some wells of hybridoma cells were observed under a microscope and their supernatants were used as primary antibodies for identification by indirect ELISA. The antigen coated in this step is different, and the antigen plate should be coated with GST protein and recombinant protein separately, and the wells that only react with recombinant protein are selected to continue the experiment.
(2) Subcloning
After the first screening, taking the positive hole for subcloning, and adopting a limiting dilution method for subcloning. Each subclone is screened by GST protein and recombinant protein separately coated antigen plate, and wells that react only with recombinant protein are selected for further experiments. After 3 times of subcloning, a cell line stably secreting the antibody can be obtained.
(3) Cryopreservation and recovery of hybridoma cells
And (3) carrying out expanded culture on the screened cell strains, and freezing and storing the cells with good growth and sufficient activity. To assess stability, the cryopreserved tumor cells were thawed at least two months after cryopreservation, and the antibodies in the cell culture supernatant were detected by ELISA.
(4) Preparation of ascites
Each mouse was first injected with 0.5mL of liquid paraffin per mouse, and cells were inoculated 7 days later. At this time, the hybridoma cell line cultured to full length was washed with 1640 solution and prepared to have a concentration of 1X 107Each cell sap/mL is 0.5mL, and abdominal swelling can be seen after 7 days, and abdominal dropsy can be obviously sensed. An indwelling needle can be used for collecting ascites, and ascites can be collected for 2-3 times generally. And (4) centrifuging ascites, taking supernatant, inactivating at 56 ℃ for 30min, subpackaging and carrying out next step of experiment.
6) Identification of monoclonal antibodies
(1) Titer determination of supernatant and ascites
At the early stage, a large amount of recombinant protein coated plates and GST protein coated plates are prepared, and the supernatant of common hybridoma cells and the supernatant of a positive clone culture are used as primary antibodies respectively. Sera from mice immunized with recombinant protein served as positive controls. Other conditions were unchanged and the indirect ELISA protocol was followed.
The result shows that the highest titer of No. 4 mice is taken to perform a cell fusion experiment, 251 wells of 3 96-well plates are provided with hybridoma cells, the fusion rate is 87.2%, the 36-well ELISA detection result is positive, and the positive rate is 14.3%. 5 hybridoma cells which can stably secrete monoclonal antibodies against European PRRSV-N protein are obtained by screening, the hybridoma cells are named as 4D5, 1E7, 1F6, 7G1 and 6H8, ascites titer results of ascites prepared by the 5 hybridoma cells are shown in a figure 7, and the titer exceeds 1: 12800, and determining the subtype of antibody secreted by 5 tumor cells, wherein the heavy chains of 4D5 and 7G1 monoclonal antibodies are IgG2b, the heavy chains of 1E7, 1F6 and 6H8 monoclonal antibodies are IgG1, and the light chains are kappa chains.
(2) Subtype identification
The subclass of the 5-strain monoclonal antibody prepared was identified using Southern Biotech 5300-05 antibody subclass identification kit, and the specific procedures were developed according to the instructions. The primary antibody used in this experiment was 5 tumor cell culture supernatant, the secondary antibody was provided by the kit, and other steps were unchanged.
(3) Identification of specificity
The method is carried out according to the conventional method, a 96-well plate is coated by HC, PCV2, PRV, SVV and PDCoV viruses stored in the laboratory, and the supernatant 1:200 diluent is primary antibody, the specificity of the monoclonal antibody is detected by experiments according to the indirect ELISA operation steps, the results are shown in Table 1, except the positive type I PRRSV-N recombinant protein, the OD values of the plates with other 5 viruses as antigens are less than 0.249 (negative), which shows that the specificity of the 5 PRRSV-N recombinant protein monoclonal antibody is good.
TABLE 1 identification of the specificity of recombinant proteins
Figure BDA0003089201870000111
(4) Indirect immunofluorescence assay
Inoculating the I type PRRSV-GDHD2018 strain to PAMs cells, culturing at 37 ℃ for 24h, and then harvesting the culture for challenge experiments; the experimental animal adopts a pig with double negative of blue ear virus, pseudorabies virus and swine fever virus antigen antibody, after 3 days of virus attack, PRRSV-GDHD2018 strain positive is detected in blood, then a lung sample is dissected and collected to prepare a section, the section is browsed under a microscope or a CaseViewer2.2 is used for browsing a digital section, the tissue structure is observed in detail under different multiples, the conditions of typical pathological changes in the section such as inflammation, necrosis, degeneration, hyperplasia, fibrosis and the like are described in text, and the difference between the sections is reflected. The mapping of the corresponding different typical lesion sites was taken using an imaging microscope or intercepted using a caseviewer 2.2. The ascites fluid prepared from the monoclonal antibody cell strain was used as a primary antibody to perform immunofluorescence experiments and photographed, and the results are shown in fig. 8, which shows that the supernatants of 5 cell strains all reacted with the anti-platelet.
(5) Characterization of antibody secretion stability
The hybridoma cells were cultured for 30 consecutive passages, and cell culture supernatants collected from 1, 5, 10, 20, and 30 passages were examined, and the antibody titer was measured by indirect ELISA, showing that 1F6 had good stability.
TABLE 2 identification of secretion stability of antibodies
Figure BDA0003089201870000121
(6) Western blot detection of monoclonal antibody
Firstly, carrying out SDS-PAGE electrophoresis on the I type PRRSV-N-32a recombinant protein to determine the position of the recombinant protein;
electric conversion: the PVDF membrane is cut to the size of a target rubber block, the rubber block is placed into formaldehyde solution for activation, and meanwhile, the splint is unfolded and soaked in electrotransformation liquid (a black surface is connected with a negative electrode). The sponge pad, the filter paper, the protein adhesive, the PVDF membrane (covering the target protein position), the filter paper, the sponge pad and the colorless surface are sequentially placed, and air bubbles are repeatedly discharged in the placing process. The combined clamp plate is put into an electric rotating groove, precooled electric rotating liquid is filled inwards, and the electric rotating instrument is put into an ice box filled with ice. Constant voltage of an electric rotating instrument, and electric rotation of 200mA for 30 min;
and (3) sealing: and taking out the electrically transformed splint, and taking out the PVDF film, wherein substances in the visible target gel block are completely separated. Soaking PVDF membrane in washing membrane box, washing with PBST for 3 times, soaking in 5% skimmed milk powder, and sealing at 37 deg.C for 2 hr;
ascites prepared by incubating monoclonal antibody cell strains: pouring off the blocking solution, repeatedly washing PBST for several times, soaking in ascites diluted at a ratio of 1:200, and incubating for 2h at 37 ℃;
incubation of secondary antibody: pouring out ascites prepared from the single-antibody cell strain, repeatedly washing PBST (Poly-beta-glucosidase) for several times, soaking the PBST in a secondary antibody diluted by 1:2000, and incubating the secondary antibody at 37 ℃ for 2 hours;
washing: repeatedly washing with PBST for several times and washing with PBS for 2 times;
color development: putting the PVDF film into an exposure machine, dripping the prepared color developing solution on the film, exposing and taking a picture.
The results are shown in FIG. 9, which shows that the above 5 monoclonal antibodies can bind to the recombinant protein.
The PRRSV strain used in the invention is tentatively named as GDEU2018, and is a virus strain newly found by a subject group of an applicant. The sequence alignment results of the GDEU2018 adopted by the invention and European strains BJEU-06-1(GU067771), FJ0603(HM114313), GZ11-G1(KF001144), HKEU16(EU076704) and LV (M96262) as well as American strain 233VR 2(EF536003) show that the homology of the GDEU2018 strain and other European strains is more than 90 percent, and the homology of the GDEU2018 strain and the American strain is only 65.6 percent. The alignment results are shown in FIG. 10.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> European PRRSV-N protein monoclonal antibody, preparation method and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgcggatcca tggccggtaa aaa 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccggaattct caatttgcat cct 23

Claims (9)

1. A hybridoma cell strain is characterized in that the hybridoma cell strain secretes European PRRSV-N protein monoclonal antibody.
2. The European PRRSV-N protein monoclonal antibody is characterized in that the European PRRSV-N protein monoclonal antibody specifically recognizes the European PRRSV-N protein, and the monoclonal antibody is obtained by secreting the hybridoma cell strain disclosed by the first aspect of the invention.
3. The monoclonal antibody against the european PRRSV-N protein according to claim 2, wherein the PCR amplification product of the european PRRSV-N protein is PCR amplified with the following specific primers:
1) an upstream primer F: CGCGGATCCATGGCCGGTAAAAA(SEQ ID NO.1)；
2) A downstream primer R: CC (challenge collapsar)GGAATTCTCAATTTGCATCCT(SEQ ID NO.2)；
Wherein, BamHI enzyme cutting site is introduced into the 5 'end of the upstream primer F, and EcoRI enzyme cutting site is introduced into the 5' end of the downstream primer R.
4. A recombinant protein, said recombinant protein having:
(i) the monoclonal antibody of claim 2; and
(ii) optionally a tag sequence to facilitate expression and/or purification.
5. An immunoconjugate, comprising:
(a) the monoclonal antibody of claim 2; and
(b) a coupling moiety selected from the group consisting of: a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.
6. A pharmaceutical composition comprising:
(i) the monoclonal antibody of claim 2, or the recombinant protein of claim 5, or the recombinant protein of claim 6
The immunoconjugate described; and
(ii) a pharmaceutically acceptable carrier.
7. Use of the monoclonal antibody of claim 1, the recombinant protein of claim 5, or the immunoconjugate of claim 6 for the preparation of a medicament, a reagent, a test plate, or a kit;
the medicament, the reagent, the detection plate or the kit are used for detecting PRRSV-N protein.
8. A preparation method of a monoclonal antibody of European PRRSV-N protein is characterized by comprising the following steps:
1) preparing high-purity European PRRSV-N protein;
2) immunizing a mouse by taking the European PRRSV-N protein prepared in the step 1) as an immunogen;
3) fusing splenocytes of the immunized mice with myeloma cells to prepare hybridoma cells;
4) carrying out positive cloning screening on the hybridoma cells prepared in the step 3) to obtain a positive monoclonal hybridoma cell strain;
5) inducing ascites to the positive monoclonal hybridoma cell strain obtained in the step 4), and purifying to obtain the European PRRSV-N protein monoclonal antibody.
9. The hybridoma cell strain according to claim 1, the monoclonal antibody against the european PRRSV-N protein according to claim 2, the recombinant protein according to claim 4, the immunoconjugate according to claim 5, the pharmaceutical composition according to claim 6, the use according to claim 7, or the method of preparing the european PRRSV-N protein according to claim 8 for preparing a PRRSV-N protein detection kit.
CN202110590168.2A 2021-05-28 2021-05-28 European PRRSV-N protein monoclonal antibody and preparation method and application thereof Pending CN113278593A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110590168.2A CN113278593A (en) 2021-05-28 2021-05-28 European PRRSV-N protein monoclonal antibody and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110590168.2A CN113278593A (en) 2021-05-28 2021-05-28 European PRRSV-N protein monoclonal antibody and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN113278593A true CN113278593A (en) 2021-08-20

Family

ID=77282164

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110590168.2A Pending CN113278593A (en) 2021-05-28 2021-05-28 European PRRSV-N protein monoclonal antibody and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113278593A (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007065151A2 (en) * 2005-12-02 2007-06-07 Iowa State University Research Foundation, Inc. Differential immunoassay for prrs vaccine antibody
CA2903542A1 (en) * 2005-11-29 2007-06-07 Iowa State University Research Foundation, Inc. Identification of protective antigenic determinants of porcine reproductive and respiratory syndrome virus and uses thereof
CN101955531A (en) * 2009-07-17 2011-01-26 南方医科大学 Antibody for detecting porcine reproductive and respiratory syndrome virus
CN108707587A (en) * 2018-05-24 2018-10-26 北京世纪元亨动物防疫技术有限公司 One plant of Europe class porcine reproductive and respiratory syndrome virus strain and its application
CN109535250A (en) * 2018-12-13 2019-03-29 郑州大学 American type PRRSV N protein monoclonal antibody, preparation method and its application
CN111500598A (en) * 2020-05-08 2020-08-07 华南农业大学 Kit and method for detecting European PRRSV antibody titer

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2903542A1 (en) * 2005-11-29 2007-06-07 Iowa State University Research Foundation, Inc. Identification of protective antigenic determinants of porcine reproductive and respiratory syndrome virus and uses thereof
WO2007065151A2 (en) * 2005-12-02 2007-06-07 Iowa State University Research Foundation, Inc. Differential immunoassay for prrs vaccine antibody
CN101955531A (en) * 2009-07-17 2011-01-26 南方医科大学 Antibody for detecting porcine reproductive and respiratory syndrome virus
CN108707587A (en) * 2018-05-24 2018-10-26 北京世纪元亨动物防疫技术有限公司 One plant of Europe class porcine reproductive and respiratory syndrome virus strain and its application
CN109535250A (en) * 2018-12-13 2019-03-29 郑州大学 American type PRRSV N protein monoclonal antibody, preparation method and its application
CN111500598A (en) * 2020-05-08 2020-08-07 华南农业大学 Kit and method for detecting European PRRSV antibody titer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
S DEA 等: "Antigenic variability among North American and European strains of porcine reproductive and respiratory syndrome virus as defined by monoclonal antibodies to the matrix protein", 《J CLIN MICROBIOL.》 *
张文立: "我国欧洲型PRRSV的流行病学调查与单克隆抗体的制备", 《中国优秀博硕士学位论文全文数据库(硕士) 基础科学辑》 *
赵东: "《临床免疫学检验技术与操作》", 30 September 2018, 天津：天津科学技术出版社 *

Similar Documents

Publication Publication Date Title
CN110545841A (en) Porcine coronavirus vaccine
CN105669838A (en) Neutralizing epitope from varicella-zoster virus (VZV) gE protein and antibody aiming the same
CN107033250B (en) Bovine coronavirus recombinant multi-epitope antigen and application thereof
CN112175086B (en) Monoclonal antibody of anti-porcine epidemic diarrhea virus nsp13 protein and application
CN109970851B (en) Monoclonal antibody of CCV virus M protein, preparation method thereof and preparation method of immune colloidal gold test strip
CN112921005B (en) Hybridoma cell strain, canine parvovirus VP2 protein monoclonal antibody produced by hybridoma cell strain and application of hybridoma cell strain
CN111087452A (en) Prokaryotic soluble expression method of porcine circovirus 2b subtype Cap protein
CN109082412B (en) Monoclonal antibody of toxoplasma clavuligerus protein ROP18, cell strain secreting antibody and application of monoclonal antibody
CN113150138B (en) KPC-2 monoclonal antibody, and preparation method and application thereof
CN117964746A (en) Neutralizing antibody HY2 of A-type foot-and-mouth disease virus, preparation method and application thereof
CN111569056A (en) Porcine rotavirus vaccine, antigen for preparing vaccine and coding sequence thereof
CN113278593A (en) European PRRSV-N protein monoclonal antibody and preparation method and application thereof
CN113817054B (en) Murine monoclonal antibody 5B11 specifically binding porcine rotavirus VP6 protein and application thereof
CN112458060B (en) Monoclonal antibody of type 1 PAStV, preparation and ELISA application thereof
CN114317571A (en) Virus-like particle and preparation method and application thereof
CN115304670A (en) Murine monoclonal antibody of feline coronavirus nucleocapsid protein, and coding gene and application thereof
CN113583141A (en) Swine epidemic diarrhea virus Nsp9 protein, fusion protein containing Nsp9 protein, and preparation method and application thereof
CN109295014B (en) Atypical classical swine fever virus E2 protein recombinant baculovirus and preparation method and application thereof
CN111850003A (en) Recombinant expression pasteurella multocida thiamine periplasm binding protein and application thereof
CN111560386A (en) Soluble porcine circovirus type 2 Cap protein and application thereof
CN116042531B (en) Hybridoma cell strain resisting porcine delta coronavirus NS7 and NS7a proteins, monoclonal antibody and application thereof
CN113444175B (en) Recombinant lawsonia intracellularis Hsp60 protein monoclonal antibody and application thereof
CN116218789B (en) Hybridoma cell strain, monoclonal antibody resisting PDCoV NS6 protein and application thereof
CN114908056B (en) Recombinant CHO cell line expressing pig PRV gDFc or gBFc fusion protein and construction method and application thereof
CN114805564B (en) Monoclonal antibody for specifically recognizing SARS-CoV-2S protein NTD region and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20210820