Detailed Description
The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.
Example 1 construction of Escherichia coli strains expressing phenylalanine-free proteins and production and preparation of proteins by fermentation
In this embodiment, the escherichia coli K12 expression system is taken as an example to illustrate the construction of strains for recombinant expression of no/low phenylalanine protein by the escherichia coli expression system, and the preparation of protein expression and purification. Escherichia coli K12(Escherichia coli K12) used in the examples was purchased from American Type Culture Collection (ATCC). The reagents for the test are all commercial scientific research reagents or consumables except for special notes, and the components and preparation methods of various reagents and culture media can refer to the operation in a conventional experiment manual.
Construction of Escherichia coli expression strain
1. Construction of expression vectors
According to the target protein sequence without phenylalanine (PKU1, the protein sequence is shown in SEQ ID NO:1) and the codon preference of an expression system, an expression gene is designed and synthesized in a whole gene mode. Using plasmid pET22b as a template, using a primer pET22b-F/pET22b-R in the table 1 to amplify a vector skeleton with about 5500bp by PCR, digesting the vector skeleton for 2 to 3 hours by DpnI, and recovering the vector skeleton by using a DNA agarose gel recovery kit; PCR is carried out to amplify a PKU1 gene fragment by using a primer PK U1-F/PKU1-R in a table 1, a vector skeleton and an overlapped PCR product are assembled by using a seamless Cloning Kit (Cloneexpress II One Step Cloning Kit, Nanjing Nonakai biotechnology), escherichia coli DH5 alpha competent cells are transformed, an LB plate is coated (ampicillin with the final concentration of 100ug/ml is added), the mixture is inversely placed in an incubator at 37 ℃ for overnight culture until single colonies grow out, a plurality of single colonies are picked for PCR screening, DNA sequencing of the screened positive strains is confirmed, and the positive strains with correct sequencing are extracted by using a plasmid extraction Kit for standby and are named as pET-22b-PKU 1.
TABLE 1 relevant primers for pET22b-PKU1 vector construction
Primer name
|
Primer sequence (5 '-3')
|
PKU1-F
|
CTCGAATTCGGATCCttatttactgcttttcttcttgac
|
PKU1-R
|
GGAGATATACATATGatgaaaaaacagaatgacatt
|
pET22b-F
|
CATATGTATATCTCCTTCTTAAAGTTAAAC
|
pET22b-R
|
GGATCCGAATTCGAGCTCCG |
2. Recombinant expression plasmid transformed Escherichia coli expression strain K12
Transforming E.coli K12 strain competence with pET22b-PKU1 plasmid prepared in step 1, screening LB plate (containing 100ug/ml ampicillin) to obtain expression strain after PCR verification, and performing induced expression culture on the screened expression strain at different temperatures (28 ℃ and 37 ℃) respectively, wherein the induced expression result is shown in figure 1. The results show that 37 ℃ contributes to the high expression of PKU1 protein. The successfully expressed strain is named as KU-1 strain.
3. Expression production and preparation of phenylalanine-free protein
And (3) fermenting and expressing the strains successfully constructed and expressed in the step (2) by using a 30L fermentation tank, and performing post-treatment to prepare the no/low phenylalanine protein powder.
Thawing the frozen expressed strain, spreading on LB plate (containing 100ug/ml ampicillin), culturing at 37 deg.C overnight for activation, selecting single spot, inoculating to LB seed culture medium, shake-culturing at 37 deg.C and 220rpm for 3-6h, inoculating to secondary seed shake flask (2L, LB culture medium) at 37 deg.C and 2% of inoculum sizeShake-culturing at 20rpm for 14-16h, inoculating in 30L fermenter with 3-5% inoculum size (fermentation medium: yeast powder 12g/L, peptone 8g/L, potassium dihydrogen phosphate 4g/L, ammonium sulfate 1.4g/L, glycerol 5g/L, glucose 15g/L, magnesium sulfate 1g/L, NaCl 5g/L, DF104 antifoam 2g/L, pH 7.5). The supplementary culture medium is glucose 200g/L and yeast powder 160 g/L. Fermenting and culturing for 4-6h, OD600When the concentration reaches about 10 ℃, adding an inducer (IPTG, 0.5mM) for induction, wherein the induction temperature is 37 ℃, and the pH value is controlled to be 6.5-7.0 during the induction process. Feeding culture is carried out at the beginning of fermentation for 6-8h, and the dissolved oxygen in the fermentation is controlled to be 30-70%. The fermentation time is 22-24h, and the protein expression yield is 6-8 g/L.
The cells were collected by a butterfly centrifuge and washed twice with a borate buffer (10mM, pH 9.0). The thalli is resuspended to 200g/L by borate buffer solution (10mM, pH9.0), cells are lysed by a high-pressure homogenizer, then 10000g of centrifugation is carried out, supernatant fluid is collected, pH is adjusted to 5.5, centrifugation is carried out, precipitates are collected, the precipitates are resuspended and cleaned by borate buffer solution (10mM, pH9.0), pH is adjusted to 5.5, proteins are precipitated, and the proteins without phenylalanine are obtained after repeated cleaning for 3-5 times. And (3) carrying out spray drying on the phenylalanine-free protein solution (the air inlet temperature is 160 ℃, and the air outlet temperature is 75 ℃) to obtain the phenylalanine-free/low-content protein powder. The protein content of the obtained spray-dried powder is measured by a Kjeldahl method, and the result shows that the protein content is 87%; the protein samples are subjected to SDS-PAGE electrophoresis, and the electrophorogram is subjected to gray scanning analysis, so that the purity of the target protein is about 85 percent. Amino acid content analysis shows that the content of phenylalanine is less than 5mg/g protein powder. The results are shown in Table 2.
TABLE 2 detection of protein powder quality in PKU1
Example 2 construction of Bacillus-expressed No/Low phenylalanine protein Strain and production and preparation of protein fermentation
In this example, a bacillus licheniformis expression system is taken as an example to illustrate the construction of strains expressing no/low phenylalanine protein by the bacillus expression system and the protein expression and preparation. The bacillus licheniformis strain (b. licheniformis cic 10266) used in the examples was purchased from the china industrial collection of microorganisms management center.
The plasmid pEBKan194-GFP used in the examples was pKSGFP 194ts of another 1 patent application (application No. 201610410811.8) of the applicant, and the information on the construction thereof is described in example 1 of the specification of this application.
The reagents for the test are all commercial scientific research reagents or consumables except for special notes, and the components and preparation methods of various reagents and culture media can refer to the operation in a conventional experiment manual.
Construction of phenylalanine-free protein expression strain
1. Knock-out of original genes in expressed strains
(1) Constructing a knockout plasmid;
using genome DNA of bacillus licheniformis CICC10266 as a template, using primers apr-up-F/apr-up-R, apr-down-F/apr-down-R in Table 3 to amplify an upstream homologous arm apr-up and a downstream homologous arm apr-down by PCR, then using apr-up-F/apr-down-R as a primer to amplify apr-up + down by overlapping PCR, and using a DNA agarose gel recovery kit to recover PCR fragments; using pEBKan194-GFP plasmid as a template, using a primer pEBKan194-F/pEBKan194-R in the table 3 to amplify a vector skeleton fragment of about 5300bp by PCR, digesting for 2h by using DpnI endonuclease, and then recovering the vector fragment by using a DNA agarose gel recovery kit; assembling the digested and recovered vector skeleton and the up + down overlapped fragment according to a seamless Cloning Kit (Clonexpress II One Step Cloning Kit, Nanjing Nodezac Biotechnology), transforming escherichia coli DH5 alpha competent cells, coating an LB plate (adding kanamycin with the final concentration of 20 ug/ml), inversely placing the plate in an incubator at 30 ℃ for overnight culture until a single colony grows out, selecting a plurality of single colonies for carrying out bacteria liquid PCR screening, carrying out DNA sequencing confirmation on the screened positive strains, and extracting plasmids for the positive strains with correct sequencing by using a plasmid extraction Kit for later use, wherein the plasmids are named as pEBKan194-GFP-apr-up + down.
TABLE 3 pEBKan194-GFP-apr-up + down vector construction primers
Primer name
|
Primer sequence (5 '-3')
|
apr-up-F
|
GACTCTAGAGGATCCctacaccctttcattgacagaatc
|
apr-up-R
|
CGTTTCTTTGCcgcttgatgaaatcagctcatgtgaaag
|
apr-down-F
|
cacatgagctgatttcatcaagcgGCAAAGAAACGATC
|
apr-down-R
|
GAGCTCGGTACCCGGaaagcggtatgctctatggac
|
pEBKan194-F
|
CCGGGTACCGAGCTCGAGGC
|
pEBKan194-R
|
GGATCCTCTAGAGTCGACCTGCAGGC
|
pEBKan194-F(ce)
|
GTTTATGCATCCCTTAACCG
|
pEBKan194-R(ce)
|
TTTACCAGACAACCATTACCT
|
apr-F bis
|
ctccatcaatgacaatgataatcattatc
|
apr-R bis
|
gtacgccgttttaggagctc |
(2) Transforming host bacteria by electric shock;
I. preparation of competent cells of Bacillus licheniformis:
the frozen bacillus licheniformis strain is streaked on an LB plate and is placed in an incubator at 37 ℃ for overnight culture. Single colonies were picked from fresh plates and inoculated in 5ml LB medium and cultured overnight at 37 ℃ and 220 rpm. The overnight cultured bacterial liquid is absorbed and transferred to the GM culture medium, the inoculation amount is well controlled, and the OD after inoculation is enabled600Between 0.19 and 0.2. Culturing at 37 deg.C and 200rpm to OD600About 1.0 (about 3-4 hours). And transferring all the bacteria liquid to a 50ml sterile centrifuge tube, carrying out ice water bath for 10min, and then centrifuging at 5000rpm for 8min at 4 ℃ to collect the bacteria. The cells were washed with 40ml of an electrotransfer buffer (ETM) pre-cooled at 4 ℃ for 8min at 5000rpm, centrifuged at 4 ℃ to remove the supernatant, and the rinsing was repeated 3 times. The washed cells were resuspended in 500. mu.l of ETM, 60. mu.l of each tube was dispensed, and the cells were frozen in a freezer at-80 ℃.
II, electric shock conversion:
a tube of frozen competent cells of 60 mul is taken and inserted into ice, when the cells are slightly thawed, 5-10 mul of the target recombinant plasmid pEBKan194-GFP-apr-up + down is added, the tube bottom is flicked and mixed evenly, the cells are incubated for 5min in ice bath, and the cells are transferred into a precooled electric rotating cup (1mm) and are electrically shocked once. Setting parameters of the electrotransport instrument: 2.1Kv, shock 1 time (duration between 4.5ms and 5.0 ms). After the electric shock, 1ml of recovery medium RM was added immediately, and after recovery culture at 37 ℃ and 200rpm for 3 hours, LB plates (containing kanamycin at a final concentration of 20 ug/ml) were spread and placed in an incubator at 37 ℃ overnight to grow single colonies.
(3) Screening of knockout strains:
I. and (3) transformant identification:
the transformants grown on the plate of step (2) were observed under an ultraviolet lamp, and colonies having green fluorescence (due to the GFP gene on the plasmid) were picked up, inoculated into LB medium (kanamycin was added thereto to a final concentration of 20 ug/ml), and cultured overnight at 30 ℃ and 200 rpm. Extracting plasmid from overnight cultured bacterial liquid, performing enzyme digestion analysis, adding 20% glycerol into positive strain, and freezing at-80 deg.C.
Single crossover passage and screening:
the overnight cultured positive bacteria solution was inoculated into LB medium (to which was added kanamycin to a final concentration of 20 ug/ml) at a ratio of 0.2%, and was subjected to shaking culture at 42 ℃ and 200rpm, and was transferred every 8 to 12 hours, and thus, 3 to 5 times. The subcultured broth was streaked on LB agar plates (with the corresponding antibiotics added) and placed upside down in a 37 ℃ incubator overnight. Single colonies were picked up from the streaking plate to 200. mu.l of LB medium (kanamycin was added to a final concentration of 20 ug/ml), shaken at 37 ℃ and 200rpm until the suspension became turbid, and positive strains were PCR-selected from the suspension, and PCR-verified and DNA sequencing-confirmed using the primer pairs pEBKan194-F (ce)/apr-R bis or apr-F bis/pEBKan 194-R (ce) in Table 3.
Double crossover passage and screening:
the strains with positive single exchange screening are inoculated into LB culture medium according to the proportion of 0.2 percent, and are subjected to shaking culture at 42 ℃ and 200rpm, and are transferred every 12h for 2-3 times. Subculture of the bacterial liquid, diluting with sterile water 106To double, 100. mu.l of each LB agar plate was spread and placed upside down in a 37 ℃ incubator overnight. Single colonies were picked from the plates and spotted onto LB (final concentration of 20. mu.g/ml kanamycin) and LB antibiotic-free plates, one for one, and placed upside down in a 37 ℃ incubator overnight for culture. Observing the growth conditions of bacterial colonies on the two plates, selecting bacterial colonies which do not grow on the resistant plate but well grow on the non-resistant plate to 200 mul LB culture medium, carrying out shaking culture at 37 ℃ and 200rpm until the bacterial liquid is turbid, carrying out PCR (polymerase chain reaction) screening on positive bacterial liquid, taking apr-F double/apr-R double in the table 3 as a primer pair, carrying out PCR verification on the bacterial colonies, and knocking out the correct bacterial strain to be named as CIC C10266-1.
2. Integration of phenylalanine-free protein genes at the original gene knockout site
(1) Knock-in of phenylalanine-free protein PKU2 gene
According to the target protein sequence without phenylalanine (PKU2, the protein sequence is shown in SEQ ID NO:2) and the codon preference of an expression system, an expression gene is designed and synthesized in a whole gene mode. pEBKan194-GFP-apr-up + down plasmid is used as a template, a vector framework with about 6800bp is subjected to PCR amplification by using a primer P-LC-F/P-ydeD-R in a table 4, a DpnI endonuclease is used for digestion for 2h and then is recovered by using an agarose gel recovery kit, a complete expression frame with about 1800bp of a PKU2 is subjected to PCR amplification by using a primer PKU2-F/PKU2-R, the digested and recovered vector framework and a PK U2 gene fragment are assembled according to a method of a seamless cloning kit, escherichia coli DH5 alpha competent cell is transformed, an LB plate (containing kanamycin with the final concentration of 20 ug/ml) is coated, the whole cell is placed in a 30 ℃ culture box for overnight culture to grow a single colony, a plurality of single colonies are selected for sequencing, a bacterial liquid is subjected to PCR screening, the sequencing of the screened positive strains is confirmed, and the correct positive strains are extracted by using a plasmid extraction kit for standby plasmid.
TABLE 4 pEBKan194-GFP-apr-up + PKU2+ down vector construction related primers
Primer name
|
Primer sequence (5 '-3')
|
P-LC-F
|
caagcgGCAAAGAAACGATC
|
P-ydeD-R
|
atgaaatcagctcatgtgaaag
|
PKU2-F
|
atgagctgatttcatATCTTTCACCCGTTTCTGTATG
|
PKU2-R
|
TTTCTTTGCcgcttgGGCATCAGGAAAAAGCTGCTG |
(2) The screening procedures of (3) and (3) are the same as those of (2) and (3) in the gene knockout operation of the above 1.
The recombinant strain integrated with the target gene PKU2 is verified and preserved and is named as BL 01.
On the basis of single copy integration strain, the same method can be used for integrating target genes at other sites of genome to construct double copy strain, triple copy recombination strain or expression strain with higher copy number, thereby further improving the expression quantity of target protein.
Fermentation expression and preparation of phenylalanine-free protein
1) The recombinant bacillus licheniformis BL01 constructed above is used as a starting strain, a continuous feeding process is adopted to ferment in a 7L fermentation tank, and the basic fermentation culture medium is as follows: 3% of corn starch, 2.5% of soybean protein isolate, 0.25% of yeast extract powder and K2HPO4 0.45%、NaH2PO4 0.9%、CaCl2 0.04%、MgSO4·7H2O 0.08%、MnSO40.02 percent, 0.2 percent of defoaming agent and 0.01 percent of alpha-high temperature amylase, adjusting the pH value to 7.5, and sterilizing at the high temperature of 121 ℃ for 20 minutes; the supplementary culture medium comprises: 40% of glucose, 18% of soybean protein hydrolysate and 2% of yeast powder, and sterilizing the two at high temperature of 121 ℃. The inoculation amount is 5%, and the culture conditions are as follows: controlling DO by more than 40% by adjusting the stirring speed and the ventilation amount (supplementing high-concentration oxygen when necessary) at 37 ℃ and with the ventilation amount of 0.6-1.2 vvm; feeding is started after 12h of fermentation, and the feeding rate is as follows: 1.8-2.5 g/L/h of glucose, 0.7-0.9 g/L/h of soybean protein hydrolysate and yeast powder, controlling the pH value of ammonia water to be 6.75-6.80, supplementing the protein at a rate of 0.7-1.0 ml/L/h, and finishing the fermentation for 72h, wherein the protein concentration is 12.4 g/L.
2) Performing solid-liquid separation on fermentation liquor through a ceramic membrane to obtain fermentation filtrate, adding 1% NaCl, adjusting the pH value to 1.5-1.8 by using HCl to precipitate protein for 15-18 h, removing the supernatant, collecting protein precipitation concentrated solution, cleaning by using the ceramic membrane to the pH value of 2.7-2.9, collecting the concentrated solution to adjust the pH value to 9.0, performing ceramic membrane treatment for 8-10 times of the volume again, collecting the concentrated solution, performing pasteurization, and performing spray drying to obtain the no/low phenylalanine protein powder.
Parameters of spray drying: and (3) carrying out heat preservation pasteurization on the protein liquid with the solid content of 1.3% at 60 ℃, spraying by using a centrifugal spray dryer, carrying out spray drying at the rotation speed of 24000-40000 r/min on an atomizing disc, carrying out spray drying at the air inlet temperature of 160 ℃ and the air outlet temperature of 75 ℃ to prepare powder, wherein the water content is 4.5%.
The protein powder obtained by spraying was subjected to detection and analysis of the protein content, protein purity, phenylalanine content, and quality indices such as LNAA: Phe, and the specific results are shown in table 5, and the results of grayscale scan analysis of SDS-PAGE gel images show that the purity is about 90%, as shown in fig. 2.
TABLE 5 quality testing of PKU2 protein powder
Index (I)
|
Results
|
Protein content
|
89%
|
Purity of protein
|
90%
|
Water content
|
4.5%
|
Phenylalanine content
|
3.5mg/g protein
|
Phe ratio of LNAA
|
125
|
Total amount of LNAA
|
43.50% |
Example 3 construction of Yeast recombinant expression of Phenylalanine-free protein Strain and production and preparation of protein fermentation
In this embodiment, a pichia pastoris expression system is taken as an example to illustrate the construction of strains expressing no/low phenylalanine protein by the yeast expression system, and the protein expression and purification preparation. The Pichia species (Pic hia pastoris X-33) and plasmid pPICZ. alpha.A used in the examples were purchased from Invitrogen. The reagents are commercially available scientific research reagents or consumables except for special indications, and the components and preparation methods of various reagents and culture media can refer to the operations in a conventional laboratory manual.
Construction of recombinant pichia pastoris strain for expressing phenylalanine-free protein
1. Construction of recombinant expression plasmid pPICZ alpha A-PKU3
According to the phenylalanine-free target protein sequence (PKU3, the protein sequence is shown in SEQ ID NO:3) and the codon preference of a pichia pastoris expression system, an expression gene is designed and synthesized in a whole gene mode. pPICZ alpha A plasmid is used as a template, a vector skeleton of about 3500bp is amplified by PCR by using a primer pPICZ alpha A-F/pPICZ alpha A-R in a table 6, the vector skeleton is recovered by using a DNA agarose gel recovery kit after being digested for 2h by DpnI, and a PKU3 full-length gene is amplified by PCR by using a primer PKU3-F/PKU3-R in the table 6. Assembling the digested and recovered vector skeleton and a PKU3 gene fragment according to a seamless cloning kit method, transforming Escherichia coli DH5 alpha competent cells, coating an LB plate (containing bleomycin with the final concentration of 25 ug/ml), inversely placing the plate in an incubator at 37 ℃ overnight to grow single colonies, selecting a plurality of single colonies, carrying out bacterial liquid PCR screening, confirming the sequencing of the screened positive strains, and extracting plasmids (pPICZ alpha A-PKU3) from the positive strains with correct sequencing by using a plasmid extraction kit for later use.
TABLE 6 primers related to pPICZ alpha A-PKU3 vector construction
Primer name
|
Primer sequence (5 '-3')
|
pPICZαA-F
|
TGAGTTTGTAGCCTTAGACATG
|
pPICZαA-R
|
AGCTTCAGCCTCTCTTTTCTC
|
PKU3-F
|
AGAGAGGCTGAAGCTGATGCACACAAGAGTGAGGTTG
|
PKU3-R
|
AAGGCTACAAACTCATAAGCCTAAGGCAGCTTGAC |
2. Transformed yeast expression host bacteria
(1) Linearization of recombinant plasmids
The vector pPICZ alpha A-PKU3 constructed in the previous step is subjected to plasmid linearization by using restriction enzyme MssI, and the reaction system is shown in Table 7:
TABLE 7 plasmid linearization reaction System
Recombinant plasmid pPICZ alpha A-PKU3
|
40μl
|
10x FD Buffer
|
10μl
|
FD MssI
|
2μl
|
ddH2O
|
Make up the volume to 100. mu.l |
After digesting in water bath at 37 ℃ for 2-3h, extracting with phenol chloroform, precipitating with ethanol and recovering high-concentration linearized plasmid.
(2) Linearized plasmid electrotransfer host bacteria
I. Preparing pichia pastoris competent cells:
taking Pichia pastoris X-33 stored in glycerin tube from-80 deg.C ultra-low temperature refrigerator, streaking on YPD plate, and culturing in 30 deg.C constant temperature incubator for 2-3 days. Single colonies were picked, inoculated into 5ml YPD liquid medium, and shake-cultured at 28 ℃ for 18-24 h. 80-120. mu.l of overnight culture was inoculated into 100ml of liquid YPD medium and grown overnight to OD600The cultured broth was transferred to a 50ml sterile centrifuge tube and incubated at 4 ℃ or on ice for 10min, between 1.15 and 1.50. Cells were collected by centrifugation at 2,000g for 5min at 4 ℃. 100ml of ice-cold sterile water was added thereto and the suspension was gently shaken, followed by centrifugation. 50ml of ice-cold sterile water was added for suspension washing, the two tubes were combined into one tube, and the tube was centrifuged as above, and the supernatant was discarded. The cells were suspended in 40ml of 1M ice-cold sorbitol, centrifuged as above, and then suspended in 20ml of 1M ice-cold sorbitol, centrifuged as above, and the supernatant was removed. Resuspend cells with approximately 1-2ml of 1M ice-cold sorbitol to a final cell concentration of 1X 1010cells/ml, 100. mu.l/tube, and placed on ice until use.
Electric shock conversion
Mixing the competent cells prepared in the above step with 3-10 μ g of linearized pPICZ alpha A-PKU3 plasmid DN A, placing on ice for 3-5min, transferring to a precooled 0.2cm electrotransformation cup, and placing on ice for 5 min. Turning on the electric rotating instrument in advance for preheating for 10-15min, and setting electric rotating parameters: the electric rotor is taken out of ice, quickly wiped dry and shocked by electricity at a voltage of 1.5Kv, then 1ml of 1M sorbitol is added immediately, and after being sucked out, the electric rotor is kept stand and incubated in a water bath at 30 ℃ for 1.5 to 2 hours. Centrifuging at 10000rpm for 0.5min, removing part of supernatant, taking a certain amount of YPDS resistant plate (the final concentration of Zeocin is 100 μ g/ml), coating the YPDS resistant plate with the coating amount of 80-100 μ l, and inversely placing the plate in an incubator at 28 ℃ for culturing for 2-3 days until a single colony grows out.
High copy strain selection
1. Single colonies were picked from the transformation plates onto high concentration YPDS resistant plates (Zeocin concentration of 500-.
2. Selecting a plurality of colonies which grow well on a high-concentration resistant plate, inoculating the colonies to a YPD culture medium, carrying out shaking culture at 28 ℃ and 200rpm, extracting genome DNA by adopting a glass bead method, and screening positive strains by using a PCR method.
Secondly, fermentation expression and post-treatment purification.
1. Shake flask fermentation expression of recombinant strains
Inoculating all positive strains to 5ml YPD medium, shaking at 28 deg.C and 220rpm for overnight culture, transferring to 500ml baffle shake flask containing 50ml BMGY medium at 10%, shaking at 30 deg.C and 220rp m, and culturing at OD600When the strain is 4-6 hours, centrifuging at 9000rpm for 5min to collect thalli, re-suspending the thalli by using 50ml of induction culture medium BMMY, carrying out induction culture at 28 ℃ and 220rpm for 120 hours, supplementing methanol every 24 hours until the final concentration is 0.5% (V/V), simultaneously sampling and detecting the protein concentration of fermentation liquor, screening the strain with the highest expression level of the target protein, and when the strain is fermented for 120 hours, controlling the extracellular total protein concentration of the strain with the highest expression level to be 1200 mg/L. The expression strain with the highest expression level after verification is named as YX-01.
2. High-density fermentation and post-treatment of recombinant strains
Starting from the YX-01 strain with the highest expression level obtained by primary screening in the shake flask fermentation, the target protein is produced on a 5L glass fermentation tank by adopting a fed-batch culture mode. Inoculating high-yield target protein strain YX-01 into 2L baffle shake flask containing 200ml BMGY medium, performing shake culture at 28 deg.C and 220rpm18-20h to OD600When the amount of the inoculum is 4 to 6, the cells are inoculated into a 5L fermentor containing 2L of the basic salt culture medium FM22 at 10% of the inoculum size, fed-batch culture is carried out, the temperature in the cell growth phase and the temperature in the induction phase are respectively set to 30 ℃ and 28 ℃, the stirring speed is 500 rpm, the DO is maintained above 25%, the aeration rate is maintained at1 to 3vvm, and the pH is automatically controlled to 6.0 by feeding 28% (W/W) ammonia water and 34% (W/W) phosphoric acid. After the glycerol of the carbon source is exhausted, 400ml of 50% glycerol is supplemented, after DO is increased again, 100% methanol is fed until the final concentration of the methanol in the tank is 0.5% (V/V), the feeding speed is 1.5-3.5ml (L/h) within 0-6h and 6-24h, the feeding speed is gradually increased to 6-8ml (L/h), the speed is maintained until the fermentation is finished, and the flow rate of the methanol is properly adjusted according to the fluctuation of the DO in the fermentation process. Sampling every 6-8h during fermentation, and detecting the wet weight and the protein concentration of the thalli. When the fermentation time is up to 200h, the total extracellular protein concentration reaches 7 g/L.
After fermentation, collecting the supernatant by butterfly centrifugation, adding cysteine to the supernatant to a final concentration of 40mM, heating to 68 deg.C, holding the temperature for 30 min, cooling to room temperature (15-25 deg.C), and collecting the supernatant by butterfly centrifugation. The supernatant was filtered and clarified by a 0.45um pleated filter cartridge, then applied to a pre-equilibrated DEAE-Sepharose column (equilibration buffer: 5mM phosphate, pH6.0), the feed concentration was 2-5g/L, adsorbed by passing through the column at 4ml/min, and then subjected to gradient elution with 10mM phosphate (pH8.0) containing 0.2M and 0.5M NaCl, respectively. And concentrating and desalting the eluted and collected protein liquid by a 100kDa ultrafiltration membrane system (Xiamen Sanda), and spray drying the concentrated protein liquid to prepare the phenylalanine-free/low-content protein powder. SDS-PAGE gels showed that the protein was about 95% pure, as shown in FIG. 3; the amino acid analysis result shows that the content of phenylalanine is 1.5 mg/g. Specific mass analysis results are shown in table 8.
TABLE 8 quality testing of PKU3 protein powder
Index (I)
|
Results
|
Protein content
|
94%
|
Purity of protein
|
95%
|
Water content
|
4.5%
|
Phenylalanine content
|
1.5mg/g protein
|
Phe ratio of LNAA
|
269
|
Total amount of LNAA
|
40.30% |
Example 4 construction of filamentous fungal recombinant expression Strain expressing phenylalanine-free proteins and production and preparation of proteins by fermentation
In this embodiment, a trichoderma reesei expression system is taken as an example to illustrate the construction of strains expressing no/low phenylalanine protein by a filamentous fungus expression system, and the expression and preparation of the protein. Trichoderma reesei Rut-C30(Trichoderma reesei Rut-C30) used in the examples was purchased from Guangdong collection of microorganisms.
The plasmid pMDT05 used in the examples is pMDT05 of another 1 of the applicant's patent applications (application No.: 201810177819.3), the construction information of which is referred to in the specification example 2 of this application.
The reagents for the test are all commercial scientific research reagents or consumables except for special notes, and the components and preparation methods of various reagents and culture media can refer to the operation in a conventional experiment manual.
Construction of Trichoderma reesei strain for expressing phenylalanine-free protein
1. Construction of uracil-deficient Strain
(1) Construction of pyr4 Gene knock-out vector pMDT05-pyr4KO
Extracting genome DNA of Trichoderma reesei Rut-C30 by using a column type fungus genome DNA extraction kit, taking the genome DNA as a template, using primers pyr4-up-F/pyr4-up-R, pyr4-down-F/pyr4-down-R in Table 9 to amplify an upstream homologous arm pyr4-up and a downstream homologous arm pyr4-down by PCR, then amplifying pyr4-up + down by overlapping PCR, and recovering a PCR fragment by using a DNA agarose gel recovery kit; assembling the PCR fragment and BglII and XbaI double-restriction enzyme plasmid pMDT05 by using a seamless cloning kit, transforming Escherichia coli DH5 alpha competent cells, coating an LB plate (adding kanamycin with the final concentration of 50 ug/ml) for screening, sequencing the screened positive strain, and extracting the plasmid of the positive strain with correct sequencing by using a plasmid extraction kit for later use.
TABLE 9 relevant primers for pMDT05-pyr4KO vector construction
Primer name
|
Primer sequence (5 '-3')
|
pyr4-up-F
|
ttctgcgtcgaattcAGATCTagtgtttgatgctcacgctcg
|
pyr4-up-R
|
taaatgcctttctttcgaggcgagggagttgctttaatg
|
pyr4-down-F
|
ctccctcgcctcgaaagaaaggcatttagcaagaagg
|
pyr4-down-R
|
gccACTAGTaagcttTCTAGAtgaacagtaaggtgtcagcatg
|
pyr4-F
|
cgcctcttctttgtgcttttctc
|
pyr4-R
|
gtgggcttccttgtttctcgacc |
(2) Recombinant plasmid transformed agrobacterium
The agrobacterium tumefaciens strain preserved at the temperature of minus 80 ℃ is taken to be in a sensitive state at room temperature for a moment until part of the agrobacterium tumefaciens strain is melted, and the agrobacterium tumefaciens strain is inserted into ice when the agrobacterium tumefaciens strain is in an ice-water mixed state. Add 1. mu.g (volume not more than 10. mu.l) plasmid DNA per 100. mu.l competence, mix well by flicking the tube bottom with hand, stand on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 37 ℃ for 5 minutes, ice bath for 5 minutes. Adding 700 mul LB or YEB liquid culture medium without antibiotic, shaking and culturing at 28 deg.C and 200rpm for 3-4 hours. Centrifuging at 6000rpm for 1min to collect bacteria, collecting supernatant of about 100 μ l, lightly blowing to obtain heavy suspension bacteria block, spreading on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-3 days. Single colonies were picked from the transformation plates and transferred to LB medium (final concentration of 50ug/ml kanamycin and 50ug/ml streptomycin were added), shaking cultured at 28 ℃ until the suspension became turbid, and positive strains were screened by PCR.
(3) Agrobacterium-mediated transformation of Trichoderma reesei Rut-C30
Inoculating single colony of Agrobacterium strain containing recombinant plasmid in LB culture medium (containing kanamycin and streptomycin at final concentration of 50 ug/ml) and culturing at 28 deg.C overnight; collecting thallus, centrifuging, suspending and diluting to OD with IM liquid culture medium6600.15, acetosyringone 200. mu. mol/ml, 28 ℃, 200 r/min, culturing in dark to OD6600.6-0.8 percent; washing spores of Trichoderma reesei Rut-C30 from a freshly cultured PDA plate with 5-8 ml of sterile water, filtering to obtain a conidium suspension, and adjusting the spore concentration to 10 by using an IM liquid culture medium5~107Germinating at 24 ℃ for 3-4 h per ml. Get 50ml of activated agrobacterium liquid and 50ml of diluted spore suspension are uniformly mixed, coated on cellophane of an IM flat plate, and cultured for 36-48 h at 24-25 ℃ in the dark. The cellophane was removed and spread on solid MM plates containing 300ug/ml of cefuroxime, 5mg/ml of 5-FOA, 10mM of uridine, 0.1% of TritonX-100, and cultured at 28 ℃ for 4-6 days until transformants germinated. And re-screening the transformant to obtain a transformant successfully transformed.
(4) Screening pyr4 gene knockout strains;
the transformants obtained in the above step were cultured on a PDA plate for 3-4 days, a small amount of mycelia was picked up to 30. mu.l of sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, and the supernatant was taken as a template and verified by PCR using pyr4-F/pyr4-R shown in Table 9 as primers. If the knockout is successful, a band of about 1500bp is amplified. PC R is identified as a positive strain, after the spores are mature, the spores are washed by sterile water to prepare spore suspension, the spore suspension is subjected to gradient dilution, the spore suspension is coated on a PDA plate containing 0.1% TritonX-100 after being diluted by a proper multiple (10mM of Uridine is added in the final concentration), and the PDA plate is inverted and cultured at 28 ℃ for 2-3 days until single colonies grow out. Several single colonies were picked and transferred to PDA medium (10mM final concentration of Uridine added), and when cultured at 28 ℃ for 3-4 days, a small amount of hyphae was picked to 30. mu.l sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, and the supernatant was taken as a template for PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7. This strain was named Rut-C30 (. DELTA.pyr 4).
2. Construction of Single copy phenylalanine-free protein expression Strain
(1) construction of cbh1 Gene knockout vector
The construction is carried out in two steps:
taking Trichoderma reesei Rut-C30 genome DNA as a template, using primers cbh1-up-F/cbh1-up-R, cbh1-down-F/cbh1-down-R in Table 10, carrying out PCR amplification on an upstream homology arm cbh1-up and a downstream homology arm cbh1-down, then carrying out overlapped PCR amplification on cbh1-up + down, and recovering a PCR fragment by using a DNA agarose gel recovery kit; assembling the PCR fragment and BglII and XbaI double-restriction enzyme plasmid pMDT05 by using a seamless cloning kit, transforming Escherichia coli DH5 alpha competent cells, coating an LB plate (adding kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies for bacterial liquid PCR screening, confirming the sequencing of the screened positive strains, extracting plasmids of the positive strains with correct sequencing by using a plasmid extraction kit for later use, and naming the plasmids as pMDT05-cbh 1-KO-01.
Taking pMDT05-cbh1-KO-01 plasmid as a template, using a primer P-cbh1-F/P-cbh1-R in a table 10 to amplify a vector skeleton of about 11000bp by PCR, digesting and treating for 2-3h by DpnI, and recovering the vector skeleton by using a DNA agarose gel recovery kit; PCR-amplifying cbh1-DR fragment with primers cbh1-DR-F/cbh1-DR-R in Table 10, PCR-amplifying ura3 expression frame of about 2000bp with primers cbh1-ura3-F/cbh1-ura3-R in Table 10, and then overlap-PCR-amplifying cb h1-DR + ura3 with primers cbh1-DR-F/cbh1-ura3-R in Table 10; assembling a vector skeleton and an overlapped PCR product by using a seamless cloning kit, transforming escherichia coli DH5 alpha competent cells, coating an LB plate (containing kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies for carrying out bacterial liquid PCR screening, confirming DNA sequencing of screened positive strains, and extracting plasmids of the positive strains with correct sequencing by using a plasmid extraction kit for later use.
TABLE 10 primers relevant to pMDT05-CBH1-KO vector construction
Primer name
|
Primer sequence (5 '-3')
|
cbh1-up-F
|
ttctgcgtcgaattcAGATCTtgcgatgtgtaatttgcctgc
|
cbh1-up-R
|
aggctttcgccacggagctagcacgagctgtggccaaga
|
cbh1-down-F
|
cttggccacagctcgtgctagctccgtggcgaaagcctg
|
cbh1-down-R
|
gccACTAGTaagcttTCTAGAagcccctgccagagtatctg
|
P-cbh1-F
|
agctccgtggcgaaagcctg
|
P-cbh1-R
|
agcacgagctgtggccaagaag
|
cbh1-DR-F
|
gccacagctcgtgctagctccgtggcgaaagcctg
|
cbh1-DR-R
|
caatatcatcttctgtcgactcaattattgcgccactaatttc
|
cbh1-ura3-F
|
ttagtggcgcaataattgagtcgacagaagatgatattgaagg
|
cbh1-ura3-R
|
tttcgccacggagctcaactgcatccaaaccatcct
|
cbh1-F
|
AATTCTGGAGACGGCTTGTTGAATC
|
cbh1-R
|
CATCGTAACCGAGAATCCAGAGCTG
|
Trpc-cx-F
|
gcattcattgttgacctccactagc
|
Ura3-LB-R
|
gcatttgcttttgcgcgtggag |
(2) Transforming agrobacterium with the recombinant plasmid;
the CBH1 knock-out recombinant plasmid constructed in the above step was transformed into Agrobacterium as described in step 1 (2) of this example.
(3) Agrobacterium-mediated transformation of Trichoderma reesei uracil auxotrophic strain Rut-C30(Δ pyr 4);
inoculating single colony of Agrobacterium strain containing recombinant plasmid in LB culture medium (containing kanamycin and streptomycin at final concentration of 50 ug/ml) and culturing at 28 deg.C overnight; collecting thallus, centrifuging, suspending and diluting to OD with IM liquid culture medium6600.15, acetosyringone 200. mu. mol/ml, 28 ℃, 200 r/min, culturing in dark to OD6600.6-0.8 percent; washing spores of Trichoderma reesei Rut-C30 from a freshly cultured PDA plate with 5-8 ml of sterile water, filtering to obtain a conidium suspension, and adjusting the spore concentration to 10 by using an IM liquid culture medium5~107Germinating at 24 ℃ for 3-4 h per ml. And (3) uniformly mixing 50ml of activated agrobacterium tumefaciens bacterial liquid and 50ml of diluted spore suspension, coating the mixture on cellophane of an IM (instant Messaging) plate, and culturing for 36-48 h at 24-25 ℃ in a dark place. The cellophane was removed and the plate was spread on a solid MM plate containing 300ug/ml of cefuroxime, 0.1% TritonX-100 and incubated at 28 ℃ for 4-6 days until transformants germinated. Picking transformants from the MM plate and spotting them on the MM plate containing 300ug/ml of cefamycin, and culturing them at 28 ℃ overnight; picking well-grown colonies from the MM + C plate to a plate containing 100ug/ml hygromycin B, and culturing the colonies at 28 ℃ overnight; the strain which does not grow on the hygromycin plate is picked up and spotted on a PDA plate, and the PDA plate is inverted and placed at 28 ℃ for spore growth and culture.
(4) Screening cbh1 gene knockout strains;
when the culture is carried out on a PDA plate for 3-4 days, a small amount of hyphae is picked to 30 mu l of sterile water, the hyphae are heated at 98 ℃ for 10min, the hyphae are centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and PCR verification is carried out by taking cbh1-F/Trpc-CX-F and Ura3-LB-R/cbh1-R in a table 10 as primers. If the two groups of primers can amplify bands of about 2000bp and 1200bp respectively, the cbh1 gene is successfully knocked out, and if the target bands are not amplified simultaneously, the cbh1 gene is not successfully knocked out. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Selecting several single colonies, transferring to PDA culture medium, culturing at 28 deg.C for 3-4 days, selecting small amount of mycelia to 30 μ l sterile water, heating at 98 deg.C for 10min, centrifuging at 12000rpm for 10min, collecting supernatant as template, and performing PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7.
(5) Deletion of cbh1 Gene knockout Strain Ura3 selection marker
After spores of the cbh1 gene knock-out strain are mature, the spores are washed off from a PCR plate by sterile water, after a proper multiple is diluted, a PDA plate containing 10mM uridine, 5mg/ml 5-FOA and 0.1% TritonX-100 is coated, the PDA plate is inverted and placed at 28 ℃ for culturing for 4-6 days until single colonies grow out, single colonies are picked up and spotted on the PDA plate containing 10mM uridine, and the PDA plate is subjected to sporulation culture at 28 ℃. When the culture is carried out for 3-4 days, picking a small amount of hyphae from the plate to 30 mu l of sterile water, heating at 98 ℃ for 10min, centrifuging at 12000rpm for 10min, taking the supernatant as a template, and using primers cbh1-F/cbh1-R in the table 10 to verify that a band of about 2400bp is amplified if ura3 is successfully deleted, and a band of about 4900bp is amplified if the ura3 is not successfully deleted. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 and 10mM uridine after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Several single colonies were picked and transferred to PDA medium containing 10mM uridine, and when cultured at 28 ℃ for 3-4 days, a small amount of hyphae was picked to 30. mu.l of sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, and the supernatant was taken as a template for PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7. This strain was named Rut-C30(Δ pyr4, Δ cbh 1).
(6) Construction of PKU4 Gene knock-in vector
According to the target protein sequence without phenylalanine (PKU4, the protein sequence is shown in SEQ ID NO:4) and the codon preference of an expression system, an expression gene is designed and synthesized in a whole gene mode. Taking pMDT05-cbh1-KO plasmid as a template, carrying out PCR amplification on a vector skeleton with about 13000bp by using a primer P-cbh1-F/P-cbh1-R in a table 11, digesting the vector skeleton with DpnI for 2 to 3 hours, recovering the vector skeleton with a DNA agarose gel recovery kit, carrying out PCR amplification on a CDS sequence and a cbh1-DR sequence of PKU4 by using a primer PKU4-F/PKU4-R in the table 11, then assembling the vector skeleton and the PCR product by using a seamless cloning kit, transforming escherichia coli DH5 alpha competent cells, coating an LB plate (adding kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies for carrying out bacterial liquid PCR screening, confirming the sequence of the screened positive strains, and extracting plasmids of the positive strains with correct sequence by using a plasmid extraction kit for later use.
TABLE 11 primers relevant to pMDT05-CBH1-PKU4 vector construction
Primer name
|
Primer sequence (5 '-3')
|
PKU4-F
|
gccacagctcgtgctcagtcggcctgcactctccaatc
|
PKU4-R
|
atcatcttctgtcgactcaattattgcgccactaatttcc
|
P-cbh1-F1
|
tcgacagaagatgatattgaaggag
|
P-cbh1-R
|
agcacgagctgtggccaagaag
|
PKU4-YZ-F
|
gacctacccagtctcactacg
|
PKU4-YZ-R
|
atgaccacggagcctgtctg
|
Ura3-LB-R
|
gcatttgcttttgcgcgtggag
|
cbh1-F
|
AATTCTGGAGACGGCTTGTTGAATC
|
cbh1-R
|
CATCGTAACCGAGAATCCAGAGCTG |
(7) Transforming agrobacterium with the recombinant plasmid;
the PKU4 gene recombinant plasmid constructed in the above step was transformed into Agrobacterium according to the description of step 1 (2) of this example.
(8) Agrobacterium-mediated transformation of Trichoderma reesei uracil-deficient strain Rut-C30(Δ pyr4, Δ cbh 1);
the Agrobacterium transformed with the recombinant plasmid from the above step was transformed with Trichoderma reesei uracil-deficient strain as described in (3) in step 2 of this example.
(9) Screening of PKU4 gene knock-in strains;
when the transformed strain is cultured on a PDA plate for 3-4 days, a small amount of hyphae is picked to 30 mu l of sterile water, the sterile water is heated at 98 ℃ for 10min, the sterile water is centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and PCR verification is carried out by taking cb h1-F/PKU4-YZ-R, Ura3-LB-R/cbh1-R in a table 11 as primers. If the two groups of primers can amplify bands of about 1500bp and 1200bp respectively, the integration of the PKU4 gene at the cbh1 site is considered to be successful, and if the target bands are not amplified simultaneously, the integration is considered to be unsuccessful. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Selecting several single colonies, transferring to PDA culture medium, culturing at 28 deg.C for 3-4 days, selecting small amount of mycelia to 30 μ l sterile water, heating at 98 deg.C for 10min, centrifuging at 12000rpm for 10min, collecting supernatant as template, and performing PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7.
(10) Deletion of ura3 screenable marker of PKU4 knock-in strain;
knocking in a positive strain of a PKU4 gene at the cbh1 site, after spores are mature, washing the spores from a PCR plate by using sterile water, diluting by a proper multiple, coating a PDA plate containing 10mM uridine, 5mg/ml 5-FOA and 0.1% TritonX-100, inversely placing the PDA plate at 28 ℃ for culturing for 4-6 days until a single colony grows out, picking out a single colony point to the PDA plate containing 10mM uridine, and carrying out spore growth culture at 28 ℃. When the culture is carried out for 3-4 days, a small amount of hyphae is picked from the plate to 20 mu l of sterile water, the plate is heated at 98 ℃ for 10min, the plate is centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and a PCR (polymerase chain reaction) test is carried out by using a primer PKU4-YZ-F/cbh1-R in Table 11, wherein if the ura3 is successfully deleted, a band of about 1200bp is amplified, and if the ura3 is not successfully deleted, a band of about 3600bp is amplified. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 and 10mM uridine after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Several single colonies were picked and transferred to PDA medium containing 10mM uridine, and when cultured at 28 ℃ for 3-4 days, a small amount of hyphae was picked to 30. mu.l of sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, and the supernatant was taken as a template for PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7. The strain was named Rut-C30(Δ pyr4, cbh 1:: PKU 4).
3. Construction of double-copy phenylalanine-free protein expression strain
(1) construction of cbh2 site knock-in PKU4 gene vector
The construction is carried out in two steps:
taking Trichoderma reesei Rut-C30 genome DNA as a template, using primers cbh2-up-F/cbh2-up-R, cbh2-down-F/cbh2-down-R, cbh2-ura3-F/cbh2-ura3-R in a table 12, carrying out PCR amplification on expression frames of an upstream homology arm cbh2-up, a downstream homology arm cbh2-down and ura3, then carrying out three-segment overlapping PCR amplification on cbh2-up + ura3+ down, and recovering a PCR segment by using a DNA agarose gel recovery kit; assembling the PCR fragment and BglII and XbaI double-restriction enzyme plasmid pMDT05 by using a seamless cloning kit, transforming Escherichia coli DH5 alpha competent cells, coating an LB plate (containing kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies for bacterial liquid PCR screening, confirming the sequencing of the screened positive strains, extracting plasmids of the positive strains with correct sequencing by using a plasmid extraction kit for later use, and naming the plasmids as pMDT05-cbh2-PKU 4-01.
Taking pMDT05-cbh2-PKU4-01 plasmid as a template, carrying out PCR amplification on a vector skeleton of about 13000bp by using a primer P-cbh2-F/P-cbh2-R in a table 12, digesting the vector skeleton for 2 to 3 hours by using DpnI, and then recovering the vector skeleton by using a DNA agarose gel recovery kit; respectively amplifying PKU4 and cbh2-DR fragments by PCR by using primers PKU4-F1/PKU4-R1, cbh2-DR-F/cbh2-DR-R in the table 12, and then amplifying PKU4+ cbh2-DR by overlapping PCR by using primers PK U4-F1/cbh2-DR-R in the table 12; assembling a vector skeleton and an overlapped PCR product by using a seamless cloning kit, transforming escherichia coli DH5 alpha competent cells, coating an LB plate (containing kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies, carrying out bacterial liquid PCR screening, confirming the sequencing of the screened positive strains, extracting plasmids of the positive strains with correct sequencing by using a plasmid extraction kit for later use, and naming the plasmids as pMDT05-cbh2-PKU 4.
TABLE 12 relevant primers for pMDT05-CBH2-PKU4 vector construction
Primer name
|
Primer sequence (5 '-3')
|
cbh2-up-F
|
ttctgcgtcgaattcAGATCTgcatctgactagttgtatcg
|
cbh2-up-R
|
caatatcatcttctgtcgaatgtatcaatgggttatacgtatc
|
cbh2-down-F
|
ggatggtttggatgcagttgaaagatcgattcggcagtcg
|
cbh2-down-R
|
gccACTAGTaagcttTCTAGAtatgtgagcaacaataatac
|
cbh2-DR-F
|
ctggattctcggttacgatgaaagatcgattcggcagtcg
|
cbh2-DR-R
|
atcatcttctgtcgaacgcgctattaacgtttggaaa
|
cbh2-ura3-F
|
gtataacccattgatacattcgacagaagatgatattgaagg
|
cbh2-ura3-R
|
cgactgccgaatcgatctttcaactgcatccaaaccatcc
|
PKU4-F1
|
aacccattgatacatgaattctcacggtgaatgtagg
|
PKU4-R1
|
cgactgccgaatcgatctttcatcgtaaccgagaatccag
|
PKU4-YZ-F
|
gacctacccagtctcactacg
|
PKU4-YZ-R1
|
gtccaccattctccagagattc
|
Ura3-LB-R
|
gcatttgcttttgcgcgtggag
|
cbh2-F
|
gttgtatgtagcctctgcag
|
cbh2-R
|
caacgtacctacctagtgtcg |
(2) Recombinant plasmid transformed agrobacterium
The PKU4 gene recombinant plasmid constructed in the above step was transformed into Agrobacterium according to the description of step 1 (2) of this example.
(3) Agrobacterium-mediated transformation of Trichoderma reesei uracil-deficient strain Rut-C30(Δ pyr4, cbh 1:: PK U4)
The Agrobacterium transformed with the recombinant plasmid from the above step was transformed with Trichoderma reesei uracil-deficient strain as described in (3) in step 2 of this example.
(4) Screening of double-copy knock-in strain of PKU4 Gene
When cultured on a PDA plate for 3-4 days, a small amount of hyphae is picked up to 30. mu.l of sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and PCR verification is carried out by using cbh2-F/PKU4-YZ-R, Ura3-LB-R/cbh2-R in Table 12 as primers. If the two groups of primers can amplify bands of about 1600bp and 1500bp respectively, the integration of the PKU4 gene at the cbh2 site is considered to be successful, and if the target bands are not amplified simultaneously, the integration is considered to be unsuccessful. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Selecting several single colonies, transferring to PDA culture medium, culturing at 28 deg.C for 3-4 days, selecting small amount of mycelia to 30 μ l sterile water, heating at 98 deg.C for 10min, centrifuging at 12000rpm for 10min, collecting supernatant as template, and performing PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7.
(5) Deletion of ura3 selection marker of cbh 2-site knock-in PKU4 Gene Strain
The positive strain with the cbh2 locus overlapped and knocked-in PKU4 gene is used for washing spores from a PCR plate by sterile water after the spores are mature, after the spores are diluted by proper times, a PDA plate containing 10mM uridine, 5mg/ml 5-FOA and 0.1% TritonX-100 is coated, the PDA plate is inverted and cultured at 28 ℃ for 4-6 days until a single colony grows out, the single colony is picked up to a PDA plate containing 10mM uridine, and the PDA plate is subjected to sporulation culture at 28 ℃. When the culture is carried out for 3-4 days, a small amount of hyphae is picked from the plate to 30 mu l of sterile water, the plate is heated at 98 ℃ for 10min, the plate is centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and a PCR (polymerase chain reaction) test is carried out by using a primer PKU4-YZ-F/cbh2-R of a table 12, wherein if the ura3 is successfully deleted, a band of about 1200bp is amplified, and if the ura3 is not successfully deleted, a band of about 3600bp is amplified. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 and 10mM uridine after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Several single colonies were picked and transferred to PDA medium containing 10mM uridine, and when cultured at 28 ℃ for 3-4 days, a small amount of hyphae was picked to 30. mu.l of sterile water, heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, and the supernatant was taken as a template for PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7. The strain is named as Rut-C30 (delta pyr4, cbh 1:: PKU4, cbh 2: PKU 4).
4. Pyr4 gene repair in a double copy phenylalanine-free protein expressing strain
(1) Construction of pyr4 Gene repair plasmid
Using plasmid pMDT05-pyr4-KO as a template, using a primer P-pyr4-F/P-pyr4-R in Table 13, carrying out PCR amplification on a vector skeleton of about 12000bp, digesting the vector skeleton for 2 to 3 hours by using DpnI, and recovering the vector skeleton by using a DNA agarose gel recovery kit; PCR amplification of pyr4 gene sequence with primer pyr4 repair-F/pyr 4 repair-R in Table 13; assembling a vector skeleton and an overlapped PCR product by using a seamless cloning kit, transforming escherichia coli DH5 alpha competent cells, coating an LB plate (adding kanamycin with the final concentration of 50 ug/ml), inversely placing the plate in an incubator at 37 ℃ for overnight culture until single colonies grow out, selecting a plurality of single colonies for carrying out bacterial liquid PCR screening, confirming the sequencing of the screened positive strains, extracting plasmids of the positive strains with correct sequencing by using a plasmid extraction kit for standby, and naming the plasmids as pMDT05-pyr4 for repair.
TABLE 13 primers relevant for the construction of the pMDT05-pyr4 repair vector
Primer name
|
Primer sequence (5 '-3')
|
pyr4 repair-F
|
actccctcgcctcgagacgactcggatcgcacgaaat
|
pyr4 repair-R
|
taaatgcctttctttacttctttcttcccttccctcc
|
P-pyr4-F
|
aaagaaaggcatttagcaagaag
|
P-pyr4-R
|
tcgaggcgagggagttgctttaatg
|
pyr4-F
|
cgcctcttctttgtgcttttctc
|
pyr4-R
|
gtgggcttccttgtttctcgacc
|
pyr4-YZ-F
|
cacaagctgattggcatcgc
|
pyr4-YZ-R
|
gcttgaacaggtaagccgtcag |
(2) Transforming agrobacterium with the recombinant plasmid;
the recombinant plasmid constructed in the above step was transformed into Agrobacterium according to the description of step 1 (2) of this example.
(3) Agrobacterium-mediated transformation of Trichoderma reesei Rut-C30(Δ pyr4, cbh 1:: PKU4, cbh 2:: PKU4)
The Agrobacterium transformed with the recombinant plasmid from the above step was transformed with Trichoderma reesei uracil-deficient strain as described in (3) in step 2 of this example.
(4) Screening pyr4 gene repair strains;
when the transformed strain is cultured on a PDA plate for 3-4 days, a small amount of hyphae is picked to 30. mu.l of sterile water, the mixture is heated at 98 ℃ for 10min, centrifuged at 12000rpm for 10min, the supernatant is taken as a template, and PCR verification is carried out by taking pyr4-F/pyr4-YZ-R, pyr4-YZ-F/pyr4-R in Table 13 as primers. If the two groups of primers can amplify bands of about 1700bp and 1500bp respectively, the pyr4 gene is considered to be successfully repaired, and if the target bands are not amplified simultaneously, the pyr4 gene is considered to be unsuccessfully repaired. And (3) identifying the strain as positive by PCR, after the spores are mature, washing the spores with sterile water to prepare spore suspension, performing gradient dilution, coating the spore suspension on a PDA plate containing 0.1% TritonX-100 after diluting by a proper multiple, and inversely culturing at 28 ℃ for 2-3 days until a single colony grows out. Selecting several single colonies, transferring to PDA culture medium, culturing at 28 deg.C for 3-4 days, selecting small amount of mycelia to 30 μ l sterile water, heating at 98 deg.C for 10min, centrifuging at 12000rpm for 10min, collecting supernatant as template, and performing PCR verification. Strains identified as positive by PCR were cultured until spore maturation at day 7. A successful strain was constructed under the designation TR 01.
Secondly, recombinant fermentation expression and preparation of the phenylalanine-free protein.
1. Preparation of seed liquid
Inoculating recombinant Trichoderma reesei strain TR01 expressing phenylalanine-free protein into multiple PDA solid plates, culturing at 28 deg.C for 7d, washing with sterile water after conidia grow green, collecting spore suspension, and adjusting spore concentration to 1.0 × 108About one seed/ml, inoculating in 500ml seed culture medium at 1%, shaking at 28 deg.C under dark condition (170 rpm), and culturing for 24-36h to obtain seed solution for fermentation in 7L fermentation tank.
2. Trichoderma reesei strain TR01 was fermented in a 50L fermentor
The whole fermentation process of the trichoderma reesei is divided into the following two stages: the first stage is a mycelium growth stage (0-72 h): 28L of basic fermentation medium (glucose 20g/L, corn steep liquor 7g/L, KH) was added to a 50L fermentor (Shanghai Baoxing Biotechnology engineering Co., Ltd.)2PO44g/L, urea 1g/L, ammonium sulfate 2g/L, MgSO4·7H2O 0.5g/L,CaCl2 1g/L,MnCl21mM, 1m L/L of Mandelis microelements (1000X), and pH 4.0), inoculating the prepared Trichoderma reesei seed solution according to the proportion of 10%, ventilating and stirring at 28 deg.C for about 72 hours, maintaining the dissolved oxygen at more than 30%, adjusting the stirring speed according to the dissolved oxygen, generally controlling at 250-. In the mycelium growth stage, glucose is basically consumed within about 24-28h along with the growth of the trichoderma reesei thallus, and 250g/L lactose solution is supplemented at the rate of 12 ml/h. The dry weight of the thallus is 15-18g/L after the culture for about 72 hours. The second stage is an induced expression stage (72-168 h): at 72h after the beginning of fermentation, 250g/L lactose solution is fed by a peristaltic pump, so that the working concentration of the lactose solution is not more than 2g/L all the time, the dissolved oxygen is more than 20% all the time, aeration and stirring culture are carried out at 28 ℃ until 188 hours are left after inoculation, and the pH is maintained at about 5.0. Sampling every 24 hours to detect the protein concentration of the supernatant of the fermentation liquor, fermenting 1The supernatant protein content of the fermentation liquor can reach 10g/L after about 80 hours.
Adding 1% perlite into the fermentation liquor after canning, filtering with a plate frame to remove mycelium, and collecting the filtrate. Adding 0.5% of activated carbon into the plate-and-frame filtrate, stirring uniformly, standing for 10-15 minutes for decolorization, adding 1% of perlite, mixing uniformly, filtering with a plate-and-frame filter to remove the decolorized activated carbon, and collecting the filtrate. Filtering the clear filtrate with 0.45 μm folded filter element (Shanghai Yiming), collecting the filtrate, adding phosphoric acid while stirring to adjust pH to 2.0-2.5, standing at room temperature for 3 hr to precipitate target protein, and discarding the supernatant. And (3) washing the target protein precipitate for 3 times by using pure water through 200nm inorganic ceramic membrane, then concentrating to 30-50g protein/L, and spray drying the concentrated solution to obtain the phenylalanine-free/low-phenylalanine protein powder. The protein content, protein purity (as shown in FIG. 4), phenylalanine content and LNAA/phe assay results of the protein powder are shown in Table 14.
TABLE 14 quality testing of PKU4 protein powder
Index (I)
|
Results
|
Protein content
|
81%
|
Purity of protein
|
87%
|
Water content
|
6.5%
|
Phenylalanine content
|
4.1mg/g protein
|
LNAA/phe ratio
|
101
|
Total amount of LNAA
|
40.50% |
Example 5 construction of Escherichia coli strains expressing phenylalanine-free proteins and production and preparation of proteins by fermentation
Constructing a fermentation strain KU-2 expressing PKU5 (protein sequence shown in SEQ ID NO: 5) according to the protocol described in example 1; fermenting, expressing, purifying, and spray drying to obtain phenylalanine-free protein powder. The mass analysis of the protein powder is shown in table 15.
TABLE 15 detection of PKU5 protein powder quality
Index (I)
|
Results
|
Protein content
|
91%
|
Purity of protein
|
82%
|
Water content
|
6%
|
Phenylalanine content
|
1.3mg/g protein
|
Phe ratio of LNAA
|
348
|
Total amount of LNAA
|
46.07% |
Example 6 construction of Bacillus strains expressing phenylalanine-free proteins and production and preparation of proteins by fermentation
Constructing a fermentation strain BL02 expressing PKU6 (protein sequence shown in SEQ ID NO: 6) by referring to the scheme described in example 2; fermenting, expressing, purifying, and spray drying to obtain phenylalanine-free protein powder. The mass analysis of the protein powder is shown in table 16.
TABLE 16 detection of PKU6 protein powder quality
Index (I)
|
Results
|
Protein content
|
84%
|
Purity of protein
|
87%
|
Water content
|
6%
|
Phenylalanine content
|
2.3mg/g protein
|
Phe ratio of LNAA
|
196
|
Total amount of LNAA
|
45.17% |
Example 7 construction of Pichia pastoris Strain expressing phenylalanine-free protein and production and preparation of protein fermentation
Constructing a fermentation strain YX02 expressing PKU7 (protein sequence shown in SEQ ID NO: 7) by referring to the protocol described in example 3; fermenting, expressing, purifying, and spray drying to obtain phenylalanine-free protein powder. The mass analysis of the protein powder is shown in table 17.
TABLE 17 detection of PKU7 protein powder quality
Index (I)
|
Results
|
Protein content
|
84%
|
Purity of protein
|
87%
|
Water content
|
6%
|
Phenylalanine content
|
0.5mg/g protein
|
Phe ratio of LNAA
|
336
|
Total amount of LNAA
|
41.36% |
Example 8 construction of expressing Phenylalanine-free protein Trichoderma reesei species and production and preparation of protein fermentation
Constructing a fermentation strain TR02 expressing PKU8 (protein sequence shown in SEQ ID NO: 8) according to the protocol described in example 4; fermenting, expressing, purifying, and spray drying to obtain phenylalanine-free protein powder. The mass analysis of the protein powder is shown in table 18.
TABLE 18 detection of PKU8 protein powder quality
Index (I)
|
Results
|
Protein content
|
84%
|
Purity of protein
|
87%
|
Water content
|
6%
|
Phenylalanine content
|
1.0mg/g protein
|
Phe ratio of LNAA
|
410
|
Total amount of LNAA
|
40.87% |
Example 9 Effect of lowering blood phenylalanine
Phenylketonuria model mouse (Pah)enu2) 20 individuals were purchased from Jackson Laboratory, USA, the weight of each half of the male and female was 100-. The mice were fed with the customized mouse diets containing only bovine whey protein and only the mouse diets containing no/low phenylalanine protein prepared in examples 1 to 4 of the present invention, which were randomly divided into five groups (4 per group, each half of males and females), for 7 days, and blood was collected from the tail vein on day 7 to measure the phenylalanine content in the serum, and the results are shown in table 19.
TABLE 19 Effect of No/Low phenylalanine protein powder intervention on rat blood phenylalanine concentration
The results show that compared with the conventional dietary protein (whey protein), the protein powder without/with low phenylalanine content produced by the technology can effectively control the phenylalanine content in the blood of a phenylketonuria model mouse, and prevent and treat phenylketonuria or hyperphenylalaninemia. In the test process, all test mice have good growth states, and actively take the mouse food containing the protein powder, which shows that the protein powder has better safety and no obvious difference between the sensory compliance and the whey protein.
Sequence listing
<110> Shenzhen nouvejian Biotechnology Limited liability company
<120> A group of specific dietary proteins
<160> 82
<170> SIPOSequenceListing 1.0
<210> 1
<211> 385
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Lys Lys Gln Asn Asp Ile Pro Gln Pro Ile Arg Gly Asp Lys Gly
1 5 10 15
Ala Thr Val Lys Ile Pro Arg Asn Ile Glu Arg Asp Arg Gln Asn Pro
20 25 30
Asp Met Leu Val Pro Pro Glu Thr Asp His Gly Thr Val Ser Asn Met
35 40 45
Lys Trp Ser Thr Ser Asp Thr His Asn Arg Leu Glu Lys Gly Gly Tyr
50 55 60
Ala Arg Glu Val Thr Val Arg Glu Leu Pro Ile Ser Glu Asn Leu Ala
65 70 75 80
Ser Val Asn Met Arg Leu Lys Pro Gly Ala Ile Arg Glu Leu His Trp
85 90 95
His Lys Glu Ala Glu Trp Ala Tyr Met Ile Tyr Gly Ser Ala Arg Val
100 105 110
Thr Ile Val Asp Glu Lys Gly Arg Ser Tyr Ile Asp Asp Val Gly Glu
115 120 125
Gly Asp Leu Trp Tyr Tyr Pro Ser Gly Leu Pro His Ser Ile Gln Ala
130 135 140
Leu Glu Glu Gly Ala Glu Cys Leu Leu Val Tyr Asp Asp Gly Ser Tyr
145 150 155 160
Ser Glu Asn Ser Thr Trp Gln Leu Thr Asp Trp Leu Ala His Thr Pro
165 170 175
Lys Glu Val Ile Ala Ala Asn Trp Gly Val Thr Lys Glu Glu Ile Ser
180 185 190
Asn Leu Pro Gly Lys Glu Lys Tyr Ile Ala Glu Asn Gln Leu Pro Gly
195 200 205
Ser Leu Lys Asp Asp Ile Val Glu Gly Pro Asn Gly Glu Val Pro Tyr
210 215 220
Pro Ala Thr Tyr Arg Leu Leu Glu Gln Glu Pro Ile Glu Ser Glu Gly
225 230 235 240
Gly Lys Val Tyr Ile Ala Asp Ser Thr Asn Tyr Lys Val Ser Lys Thr
245 250 255
Ile Ala Ser Ala Leu Val Thr Val Glu Pro Gly Ala Met Arg Glu Leu
260 265 270
His Trp His Pro Asn Thr His Glu Trp Gln Tyr Tyr Ile Ser Gly Lys
275 280 285
Ala Arg Met Thr Val Trp Ala Ser Asp Gly His Ala Arg Thr Trp Asn
290 295 300
Tyr Gln Ala Gly Asp Val Gly Tyr Val Pro Trp Ala Met Gly His Tyr
305 310 315 320
Val Glu Asn Ile Gly Asp Glu Pro Leu Val Tyr Leu Glu Ile Cys Lys
325 330 335
Asp Asp His Tyr Ala Asp Val Ser Leu Asn Gln Trp Leu Ala Met Leu
340 345 350
Pro Glu Thr Tyr Val Gln Ala His Leu Asp Leu Gly Lys Asp Trp Thr
355 360 365
Asp Val Leu Ser Lys Glu Lys His Pro Val Val Lys Lys Lys Ser Ser
370 375 380
Lys
385
<210> 2
<211> 274
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Ala Gln Thr Val Pro Tyr Ala Ile Pro Leu Ile Lys Gly Asp Lys Val
1 5 10 15
Gln Gly Gln Ala Trp Lys Ala Gly Asn Val Lys Val Gly Val Leu Asp
20 25 30
Thr Ala Ile Gln Gly Ser His Pro Asp Leu Asn Val Val Gly Ala Gly
35 40 45
Ser Tyr Val Gly Ala Glu Gly Tyr Asn Thr Asp Ala Asn Ala His Ala
50 55 60
Thr His Val Gly Ala Thr Val Gly Gly Leu Asp Asn Thr Thr Ala Val
65 70 75 80
Leu Ala Val Gly Pro Ser Val Ser Leu Tyr Gly Val Lys Val Leu Asn
85 90 95
Ser Ser Ala Ser Ala Ser Tyr Ser Ala Ile Val Ser Ala Ile Glu Trp
100 105 110
Gly Thr Thr Asn Ala Met Asp Val Ile Asn Met Ser Leu Ala Ala Gly
115 120 125
Ser Ala Ser Thr Gly Met Lys Gln Gly Val Asp Asn Gly Tyr Gly Arg
130 135 140
Ala Val Val Val Val Gly Gly Ala Ala Asn Ser Ala Ser Ser Ala Asn
145 150 155 160
Thr Asn Thr Ile Ala Tyr Pro Gly Lys Tyr Asp Ser Val Ile Gly Val
165 170 175
Ala Gly Val Asp Ser Asn Ser Asn Arg Gly Ser Trp Ser Ser Val Ala
180 185 190
Gly Glu Leu Glu Val Met Gly Pro Ala Gly Ala Val Tyr Ser Thr Tyr
195 200 205
Pro Thr Asn Thr Tyr Gly Thr Leu Asn Ala Thr Ser Met Gly Ser Pro
210 215 220
His Val Gly Ala Gly Ala Gly Leu Ile Leu Ser Lys His Pro Asn Leu
225 230 235 240
Ser Gly Ser Gln Val Arg Asn Arg Leu Ser Ser Thr Ala Thr Tyr Leu
245 250 255
Ala Ser Ser Trp Tyr Tyr Ala Lys Ala Leu Ile Asn Val Glu Ala Ala
260 265 270
Ala Gln
<210> 3
<211> 606
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Lys Trp Val Thr Tyr Ile Ser Leu Leu Trp Ser Ser Ala Tyr Ser
1 5 10 15
Arg Gly Val Gly Arg Arg Asp Ala His Lys Ser Glu Val Ala His Arg
20 25 30
Trp Lys Asp Leu Gly Glu Glu Asn Tyr Lys Ala Leu Val Leu Ile Ala
35 40 45
Trp Ala Gln Tyr Leu Gln Gln Cys Pro Ile Glu Asp His Val Lys Leu
50 55 60
Val Asn Tyr Val Thr Glu Ile Ala Lys Thr Cys Val Ala Asp Glu Ser
65 70 75 80
Tyr Glu Asn Cys Asp Lys Ser Leu His Thr Leu Trp Gly Asp Lys Leu
85 90 95
Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys
100 105 110
Cys Ala Lys Gln Tyr Pro Glu Arg Asn Glu Cys Trp Leu Gln His Lys
115 120 125
Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val Asp Val
130 135 140
Met Cys Thr Tyr Trp His Asp Asn Glu Glu Thr Gly Leu Lys Lys Tyr
145 150 155 160
Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Met Tyr Ala Pro Glu Leu
165 170 175
Leu Trp Ala Lys Arg Tyr Lys Ala Ala Trp Thr Glu Cys Cys Gln Ala
180 185 190
Ala Asp Lys Ala Tyr Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp
195 200 205
Glu Gly Lys Tyr Ser Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu
210 215 220
Gln Lys Trp Gly Glu Arg Ala Tyr Lys Ala Trp Ala Val Ala Arg Leu
225 230 235 240
Ser Gln Arg Gly Pro Lys Ala Glu Ile Ala Glu Val Ser Lys Leu Val
245 250 255
Thr Asp Leu Thr Lys Val His Thr Glu Tyr Cys His Gly Asp Leu Leu
260 265 270
Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn
275 280 285
Gln Asp Ser Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu
290 295 300
Leu Glu Lys Tyr His Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro
305 310 315 320
Ala Asp Leu Pro Ser Leu Ala Ala Asp Gly Val Glu Ser Lys Asp Val
325 330 335
Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Trp Leu Gly Met Thr Leu
340 345 350
Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val Leu Leu Leu
355 360 365
Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys Cys Ala Ala
370 375 380
Ala Asp Pro His Glu Cys Tyr Ala Lys Val Trp Asp Glu Tyr Lys Pro
385 390 395 400
Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Glu Leu Trp
405 410 415
Glu Gln Leu Gly Glu Tyr Lys Ile Gln Asn Ala Leu Leu Val Arg Tyr
420 425 430
Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser
435 440 445
Arg Asn Leu Gly Lys Val Gly Tyr Lys Cys Cys Lys His Pro Glu Ala
450 455 460
Lys Arg Met Pro Cys Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Gln
465 470 475 480
Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Asp Arg Val Thr Lys
485 490 495
Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Ile Ser Ala Leu
500 505 510
Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Tyr Asn Ala Glu Thr Trp
515 520 525
Thr Ile His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile
530 535 540
Lys Tyr Gln Thr Ala Leu Val Glu Leu Val Lys His Lys Pro Lys Tyr
545 550 555 560
Thr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Trp Ala Ala Tyr Val
565 570 575
Glu Lys Cys Cys Lys Ala Asp Asp Lys Glu Thr Cys Trp Ala Glu Glu
580 585 590
Gly Lys Lys Leu Val Ala Ala Ser Gln Ala Ala Leu Gly Leu
595 600 605
<210> 4
<211> 497
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Gln Ser Ala Cys Thr Leu Gln Ser Glu Thr His Pro Pro Leu Thr Trp
1 5 10 15
Gln Lys Cys Ser Ser Gly Gly Thr Cys Thr Gln Gln Thr Gly Ser Val
20 25 30
Val Ile Asp Ala Asn Trp Arg Trp Thr His Ala Thr Asn Ser Ser Thr
35 40 45
Asn Cys Tyr Asp Gly Asn Thr Trp Ser Ser Thr Leu Cys Pro Asp Asn
50 55 60
Glu Thr Cys Ala Lys Asn Cys Cys Leu Asp Gly Ala Ala Tyr Ala Ser
65 70 75 80
Thr Tyr Gly Val Thr Thr Ser Gly Asn Ser Leu Ser Ile Gly Trp Val
85 90 95
Thr Gln Ser Ala Gln Lys Asn Val Gly Ala Arg Leu Tyr Leu Met Ala
100 105 110
Ser Asp Thr Thr Tyr Gln Glu Val Thr Leu Leu Gly Asn Glu Trp Ser
115 120 125
Ile Asp Val Asp Val Ser Gln Leu Pro Cys Gly Leu Asn Gly Ala Leu
130 135 140
Tyr His Val Ser Met Asp Ala Asp Gly Gly Val Ser Lys Tyr Pro Thr
145 150 155 160
Asn Thr Ala Gly Ala Lys Tyr Gly Thr Gly Tyr Cys Asp Ser Gln Cys
165 170 175
Pro Arg Asp Leu Lys Trp Ile Asn Gly Gln Ala Asn Val Glu Gly Trp
180 185 190
Glu Pro Ser Ser Asn Asn Ala Asn Thr Gly Ile Gly Gly His Gly Ser
195 200 205
Cys Cys Ser Glu Met Asp Ile Trp Glu Ala Asn Ser Ile Ser Glu Ala
210 215 220
Leu Thr Pro His Pro Cys Thr Thr Val Gly Gln Glu Ile Cys Glu Gly
225 230 235 240
Asp Gly Cys Gly Gly Thr Tyr Ser Asp Asn Arg Tyr Gly Gly Thr Cys
245 250 255
Asp Pro Asp Gly Cys Asp Trp Asn Pro Tyr Arg Leu Gly Asn Thr Ser
260 265 270
Val Tyr Gly Pro Gly Ser Ser Trp Thr Leu Asp Thr Thr Lys Lys Leu
275 280 285
Thr Val Val Thr Gln Met Glu Thr Ser Gly Ala Ile Asn Arg Tyr Tyr
290 295 300
Val Gln Asn Gly Val Thr Trp Gln Gln Pro Asn Ala Glu Leu Gly Ser
305 310 315 320
Tyr Ser Gly Asn Glu Leu Asn Asp Asp Tyr Cys Thr Ala Glu Glu Ala
325 330 335
Glu Ile Gly Gly Ser Ser Trp Ser Asp Lys Gly Gly Leu Thr Gln Ile
340 345 350
Lys Lys Ala Thr Ser Gly Gly Met Val Leu Val Met Ser Leu Trp Asp
355 360 365
Asp Tyr Tyr Ala Asn Met Leu Trp Leu Asp Ser Thr Tyr Pro Thr Asn
370 375 380
Glu Thr Ser Ser Thr Pro Gly Ala Val Arg Gly Ser Cys Ser Thr Ser
385 390 395 400
Ser Gly Val Pro Ala Gln Val Glu Ser Gln Ser Pro Asn Ala Lys Val
405 410 415
Thr Ile Ser Asn Ile Lys Trp Gly Pro Ile Gly Ser Thr Gly Asn Pro
420 425 430
Ser Gly Gly Asn Pro Pro Gly Gly Asn Pro Pro Gly Thr Thr Thr Thr
435 440 445
Arg Arg Pro Ala Thr Thr Thr Gly Ser Ser Pro Gly Pro Thr Gln Ser
450 455 460
His Tyr Gly Gln Cys Gly Gly Ile Gly Tyr Ser Gly Pro Thr Val Cys
465 470 475 480
Ala Ser Gly Thr Thr Cys Gln Val Leu Asn Pro Tyr Tyr Ser Gln Cys
485 490 495
Leu
<210> 5
<211> 311
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Lys Lys Gln Asn Asp Ile Pro Gln Pro Ile Arg Gly Asp Lys Gly
1 5 10 15
Ala Thr Val Lys Ile Pro Arg Asn Ile Glu Arg Asp Arg Gln Asn Pro
20 25 30
Asp Met Leu Val Pro Pro Glu Thr Asp His Gly Thr Val Ser Asn Met
35 40 45
Lys Trp Ser Thr Ser Asp Thr His Asn Arg Leu Glu Lys Gly Gly Tyr
50 55 60
Ala Arg Glu Val Thr Val Arg Glu Leu Pro Ile Ser Glu Asn Leu Ala
65 70 75 80
Ser Val Asn Met Arg Leu Lys Pro Gly Ala Ile Arg Glu Leu His Trp
85 90 95
His Lys Glu Ala Glu Trp Ala Tyr Met Ile Tyr Gly Ser Ala Arg Val
100 105 110
Thr Ile Val Asp Glu Lys Gly Arg Ser Tyr Ile Asp Asp Val Gly Glu
115 120 125
Gly Asp Leu Trp Tyr Tyr Pro Ser Gly Leu Pro His Ser Ile Gln Ala
130 135 140
Leu Glu Glu Gly Ala Glu Cys Leu Leu Val Tyr Asp Asp Gly Ser Tyr
145 150 155 160
Ser Glu Asn Ser Thr Trp Gln Leu Thr Asp Trp Leu Ala His Thr Pro
165 170 175
Lys Glu Val Ile Ala Ala Asn Trp Gly Val Thr Lys Glu Glu Ile Ser
180 185 190
Asn Leu Met Arg Glu Leu His Trp His Pro Asn Thr His Glu Trp Gln
195 200 205
Tyr Tyr Ile Ser Gly Lys Ala Arg Met Thr Val Trp Ala Ser Asp Gly
210 215 220
His Ala Arg Thr Trp Asn Tyr Gln Ala Gly Asp Val Gly Tyr Val Pro
225 230 235 240
Trp Ala Met Gly His Tyr Val Glu Asn Ile Gly Asp Glu Pro Leu Val
245 250 255
Tyr Leu Glu Ile Cys Lys Asp Asp His Tyr Ala Asp Val Ser Leu Asn
260 265 270
Gln Trp Leu Ala Met Leu Pro Glu Thr Tyr Val Gln Ala His Leu Asp
275 280 285
Leu Gly Lys Asp Trp Thr Asp Val Leu Ser Lys Glu Lys His Pro Val
290 295 300
Val Lys Lys Lys Ser Ser Lys
305 310
<210> 6
<211> 246
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Ala Gln Thr Val Pro Tyr Ala Ile Pro Leu Ile Lys Gly Asp Lys Val
1 5 10 15
Gln Gly Gln Ala Trp Lys Ala Gly Asn Val Lys Val Gly Val Leu Asp
20 25 30
Thr Ala Ile Gln Gly Ser His Pro Asp Leu Asn Val Val Gly Ala Gly
35 40 45
Ser Tyr Val Gly Ala Glu Gly Tyr Asn Thr Asp Ala Asn Ala His Ala
50 55 60
Thr His Val Gly Ala Thr Val Gly Gly Leu Asp Asn Thr Thr Ala Val
65 70 75 80
Leu Ala Val Gly Pro Ser Val Ser Leu Tyr Gly Val Lys Val Leu Asn
85 90 95
Ser Ser Ala Ser Ala Ser Tyr Ser Ala Ile Val Ser Ala Ile Glu Trp
100 105 110
Gly Thr Thr Asn Ala Met Asp Val Ile Asn Met Ser Leu Ala Ala Gly
115 120 125
Ser Ala Ser Thr Gly Met Lys Gln Gly Val Asp Asn Gly Tyr Gly Arg
130 135 140
Ala Val Val Val Val Gly Gly Ala Ala Asn Ser Ala Ser Ser Ala Asn
145 150 155 160
Thr Asn Thr Ile Ala Tyr Pro Gly Lys Tyr Asp Ser Val Ile Gly Val
165 170 175
Ala Gly Val Asp Ser Asn Ser Asn Arg Gly Ser Trp Ser Ser Val Ala
180 185 190
Gly Glu Leu Glu Val Met Gly Pro Ala Gly Ala Val Tyr Ser Thr Tyr
195 200 205
Pro Thr Asn Thr Tyr Gly Thr Leu Asn Ala Thr Ser Met Gly Ser Pro
210 215 220
His Val Gly Ala Gly Ala Gly Leu Ile Leu Trp Tyr Tyr Leu Ile Asn
225 230 235 240
Val Glu Ala Ala Ala Gln
245
<210> 7
<211> 552
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Met Lys Trp Val Thr Tyr Ile Ser Leu Leu Trp Ser Ser Ala Tyr Ser
1 5 10 15
Arg Gly Val Gly Arg Arg Asp Ala His Lys Ser Glu Val Ala His Arg
20 25 30
Trp Lys Asp Leu Gly Glu Glu Asn Tyr Lys Ala Leu Val Leu Ile Ala
35 40 45
Trp Ala Gln Tyr Leu Gln Gln Cys Pro Ile Glu Asp His Val Lys Leu
50 55 60
Val Asn Tyr Val Thr Glu Ile Ala Lys Thr Cys Val Ala Asp Glu Ser
65 70 75 80
Tyr Glu Asn Cys Asp Lys Ser Leu His Thr Leu Trp Gly Asp Lys Leu
85 90 95
Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala Asp Cys
100 105 110
Cys Ala Lys Gln Tyr Pro Glu Arg Asn Glu Cys Trp Leu Gln His Lys
115 120 125
Asp Asp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val Asp Val
130 135 140
Met Cys Thr Tyr Trp His Asp Asn Glu Glu Thr Gly Leu Lys Lys Tyr
145 150 155 160
Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Met Tyr Ala Pro Glu Leu
165 170 175
Leu Trp Ala Lys Arg Tyr Lys Ala Ala Trp Thr Glu Cys Cys Gln Ala
180 185 190
Ala Asp Lys Ala Tyr Cys Leu Leu Pro Lys Leu Asp Glu Leu Arg Asp
195 200 205
Glu Gly Lys Tyr Ser Ser Ala Lys Gln Arg Leu Lys Cys Ala Ser Leu
210 215 220
Gln Lys Trp Gly Glu Arg Ala Tyr Lys Ala Trp Ala Val Ala Arg Leu
225 230 235 240
Ser Gln Arg Gly Pro Lys Ala Glu Ile Ala Glu Val Ser Lys Leu Val
245 250 255
Thr Asp Leu Thr Lys Val His Thr Glu Tyr Cys His Gly Asp Leu Lys
260 265 270
Pro Leu Leu Glu Lys Tyr His Cys Ile Ala Glu Val Glu Asn Asp Glu
275 280 285
Met Pro Ala Asp Leu Pro Ser Leu Ala Ala Asp Gly Val Glu Ser Lys
290 295 300
Asp Val Cys Lys Asn Tyr Ala Glu Ala Lys Asp Val Trp Leu Gly Met
305 310 315 320
Thr Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp Tyr Ser Val Val Leu
325 330 335
Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu Lys Cys Cys
340 345 350
Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Trp Asp Glu Tyr
355 360 365
Lys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Asn Cys Glu
370 375 380
Leu Trp Glu Gln Leu Gly Glu Tyr Lys Ile Gln Asn Ala Leu Leu Val
385 390 395 400
Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu
405 410 415
Val Ser Arg Asn Leu Gly Lys Val Gly Tyr Lys Cys Cys Lys His Pro
420 425 430
Glu Ala Lys Arg Met Pro Cys Val Thr Lys Cys Cys Thr Glu Ser Leu
435 440 445
Val Asn Arg Arg Pro Cys Ile Ser Ala Leu Glu Val Asp Glu Thr Tyr
450 455 460
Val Pro Lys Glu Tyr Asn Ala Glu Thr Trp Thr Ile His Ala Asp Ile
465 470 475 480
Cys Thr Leu Ser Glu Lys Glu Arg Gln Ile Lys Tyr Gln Thr Ala Leu
485 490 495
Val Glu Leu Val Lys His Lys Pro Lys Tyr Thr Lys Glu Gln Leu Lys
500 505 510
Ala Val Met Asp Asp Trp Ala Ala Tyr Val Glu Lys Cys Cys Lys Ala
515 520 525
Asp Asp Lys Glu Thr Cys Trp Ala Glu Glu Gly Lys Lys Leu Val Ala
530 535 540
Ala Ser Gln Ala Ala Leu Gly Leu
545 550
<210> 8
<211> 426
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 8
Gln Ser Ala Cys Thr Leu Gln Ser Glu Thr His Pro Pro Leu Thr Trp
1 5 10 15
Gln Lys Cys Ser Ser Gly Gly Thr Cys Thr Gln Gln Thr Gly Ser Val
20 25 30
Val Ile Asp Ala Asn Trp Arg Trp Thr His Ala Thr Asn Ser Ser Thr
35 40 45
Asn Cys Tyr Asp Gly Asn Thr Trp Ser Ser Thr Leu Cys Pro Asp Asn
50 55 60
Glu Thr Cys Ala Lys Asn Cys Cys Leu Asp Gly Ala Ala Tyr Ala Ser
65 70 75 80
Thr Tyr Gly Val Thr Thr Ser Gly Asn Ser Leu Ser Ile Gly Trp Val
85 90 95
Thr Gln Ser Ala Gln Lys Asn Val Gly Ala Arg Leu Tyr Leu Met Ala
100 105 110
Ser Asp Thr Thr Tyr Gln Glu Val Thr Leu Leu Gly Asn Glu Trp Ser
115 120 125
Ile Asp Val Asp Val Ser Gln Leu Pro Cys Gly Leu Asn Gly Ala Leu
130 135 140
Tyr His Val Ser Met Asp Ala Asp Gly Gly Val Ser Lys Tyr Pro Thr
145 150 155 160
Asn Thr Ala Gly Ala Lys Tyr Gly Thr Gly Tyr Cys Asp Ser Gln Cys
165 170 175
Pro Arg Asp Leu Lys Trp Ile Asn Gly Gln Ala Asn Val Glu Gly Trp
180 185 190
Glu Pro Ser Ser Asn Asn Ala Asn Thr Gly Ile Gly Gly His Gly Ser
195 200 205
Cys Cys Ser Glu Met Asp Ile Trp Glu Ala Asn Ser Ile Ser Glu Ala
210 215 220
Leu Thr Pro His Pro Cys Thr Thr Val Gly Gln Glu Ile Cys Glu Gly
225 230 235 240
Asp Gly Cys Gly Gly Thr Tyr Ser Asp Asn Arg Tyr Gly Gly Thr Cys
245 250 255
Asp Pro Asp Gly Cys Asp Trp Asn Pro Tyr Arg Leu Gly Asn Thr Ser
260 265 270
Val Tyr Gly Pro Gly Ser Ser Trp Thr Leu Asp Thr Thr Lys Lys Leu
275 280 285
Thr Val Val Thr Gln Met Glu Thr Ser Gly Ala Ile Asn Arg Tyr Tyr
290 295 300
Val Gln Asn Gly Val Thr Trp Gln Gln Pro Asn Ala Glu Leu Gly Ser
305 310 315 320
Tyr Ser Gly Asn Glu Leu Asn Asp Asp Tyr Cys Thr Ala Glu Glu Ala
325 330 335
Glu Ile Gly Gly Ser Ser Trp Ser Asp Lys Gly Gly Leu Thr Gln Ile
340 345 350
Lys Lys Ala Thr Ser Gly Gly Met Val Leu Val Met Ser Leu Trp Asp
355 360 365
Asp Tyr Tyr Ala Asn Met Leu Trp Leu Asp Ser Thr Tyr Pro Thr Asn
370 375 380
Glu Thr Ser Ser Thr Pro Gly Ala Val Arg Gly Ser Cys Ser Thr Ser
385 390 395 400
Ser Gly Val Pro Ala Gln Val Glu Ser Gln Ser Pro Asn Ala Lys Val
405 410 415
Thr Ile Ser Asn Ile Lys Trp Gly Pro Ile
420 425
<210> 9
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ctcgaattcg gatccttatt tactgctttt cttcttgac 39
<210> 10
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggagatatac atatgatgaa aaaacagaat gacatt 36
<210> 11
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
catatgtata tctccttctt aaagttaaac 30
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ggatccgaat tcgagctccg 20
<210> 13
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gactctagag gatccctaca ccctttcatt gacagaatc 39
<210> 14
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgtttctttg ccgcttgatg aaatcagctc atgtgaaag 39
<210> 15
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cacatgagct gatttcatca agcggcaaag aaacgatc 38
<210> 16
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gagctcggta cccggaaagc ggtatgctct atggac 36
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ccgggtaccg agctcgaggc 20
<210> 18
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
ggatcctcta gagtcgacct gcaggc 26
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gtttatgcat cccttaaccg 20
<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tttaccagac aaccattacc t 21
<210> 21
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ctccatcaat gacaatgata atcattatc 29
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gtacgccgtt ttaggagctc 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
caagcggcaa agaaacgatc 20
<210> 24
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
atgaaatcag ctcatgtgaa ag 22
<210> 25
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
atgagctgat ttcatatctt tcacccgttt ctgtatg 37
<210> 26
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
tttctttgcc gcttgggcat caggaaaaag ctgctg 36
<210> 27
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
tgagtttgta gccttagaca tg 22
<210> 28
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
agcttcagcc tctcttttct c 21
<210> 29
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
agagaggctg aagctgatgc acacaagagt gaggttg 37
<210> 30
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
aaggctacaa actcataagc ctaaggcagc ttgac 35
<210> 31
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
ttctgcgtcg aattcagatc tagtgtttga tgctcacgct cg 42
<210> 32
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
taaatgcctt tctttcgagg cgagggagtt gctttaatg 39
<210> 33
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
ctccctcgcc tcgaaagaaa ggcatttagc aagaagg 37
<210> 34
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gccactagta agctttctag atgaacagta aggtgtcagc atg 43
<210> 35
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
cgcctcttct ttgtgctttt ctc 23
<210> 36
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gtgggcttcc ttgtttctcg acc 23
<210> 37
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
ttctgcgtcg aattcagatc ttgcgatgtg taatttgcct gc 42
<210> 38
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
aggctttcgc cacggagcta gcacgagctg tggccaaga 39
<210> 39
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
cttggccaca gctcgtgcta gctccgtggc gaaagcctg 39
<210> 40
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
gccactagta agctttctag aagcccctgc cagagtatct g 41
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
agctccgtgg cgaaagcctg 20
<210> 42
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
agcacgagct gtggccaaga ag 22
<210> 43
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
gccacagctc gtgctagctc cgtggcgaaa gcctg 35
<210> 44
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
caatatcatc ttctgtcgac tcaattattg cgccactaat ttc 43
<210> 45
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
ttagtggcgc aataattgag tcgacagaag atgatattga agg 43
<210> 46
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
tttcgccacg gagctcaact gcatccaaac catcct 36
<210> 47
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
aattctggag acggcttgtt gaatc 25
<210> 48
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
catcgtaacc gagaatccag agctg 25
<210> 49
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
gcattcattg ttgacctcca ctagc 25
<210> 50
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
gcatttgctt ttgcgcgtgg ag 22
<210> 51
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
gccacagctc gtgctcagtc ggcctgcact ctccaatc 38
<210> 52
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
atcatcttct gtcgactcaa ttattgcgcc actaatttcc 40
<210> 53
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
tcgacagaag atgatattga aggag 25
<210> 54
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
agcacgagct gtggccaaga ag 22
<210> 55
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
gacctaccca gtctcactac g 21
<210> 56
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
atgaccacgg agcctgtctg 20
<210> 57
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
gcatttgctt ttgcgcgtgg ag 22
<210> 58
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
aattctggag acggcttgtt gaatc 25
<210> 59
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
catcgtaacc gagaatccag agctg 25
<210> 60
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
ttctgcgtcg aattcagatc tgcatctgac tagttgtatc g 41
<210> 61
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
caatatcatc ttctgtcgaa tgtatcaatg ggttatacgt atc 43
<210> 62
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
ggatggtttg gatgcagttg aaagatcgat tcggcagtcg 40
<210> 63
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
gccactagta agctttctag atatgtgagc aacaataata c 41
<210> 64
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
ctggattctc ggttacgatg aaagatcgat tcggcagtcg 40
<210> 65
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
atcatcttct gtcgaacgcg ctattaacgt ttggaaa 37
<210> 66
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
gtataaccca ttgatacatt cgacagaaga tgatattgaa gg 42
<210> 67
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
cgactgccga atcgatcttt caactgcatc caaaccatcc 40
<210> 68
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
aacccattga tacatgaatt ctcacggtga atgtagg 37
<210> 69
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
cgactgccga atcgatcttt catcgtaacc gagaatccag 40
<210> 70
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
gacctaccca gtctcactac g 21
<210> 71
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
gtccaccatt ctccagagat tc 22
<210> 72
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
gcatttgctt ttgcgcgtgg ag 22
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
gttgtatgta gcctctgcag 20
<210> 74
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
caacgtacct acctagtgtc g 21
<210> 75
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
actccctcgc ctcgagacga ctcggatcgc acgaaat 37
<210> 76
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
taaatgcctt tctttacttc tttcttccct tccctcc 37
<210> 77
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
aaagaaaggc atttagcaag aag 23
<210> 78
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
tcgaggcgag ggagttgctt taatg 25
<210> 79
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
cgcctcttct ttgtgctttt ctc 23
<210> 80
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
gtgggcttcc ttgtttctcg acc 23
<210> 81
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 81
cacaagctga ttggcatcgc 20
<210> 82
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 82
gcttgaacag gtaagccgtc ag 22