CN113265435A

CN113265435A - Preparation method of bacterial second messenger molecule cyclic dinucleotide

Info

Publication number: CN113265435A
Application number: CN202110667590.3A
Authority: CN
Inventors: 景志忠; 何小兵; 龙朝琳; 陈国华; 杨帆; 贾怀杰; 房永祥; 李维克; 娄忠子
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2021-06-16
Filing date: 2021-06-16
Publication date: 2021-08-17

Abstract

The invention relates to the technical field of genetic engineering and biochemistry, in particular to a method for producing three second messenger molecules, namely cyclic dinucleotides c-di-GMP, c-di-AMP and 3 '3' -cGAMP, by applying the catalysis of a recombinant biological enzyme of the same bacterial source. The recombinant biological enzyme is recombinant vibrio cholerae dinucleotide cyclase DncV, namely recombinant DncV enzyme. The amino acid sequence of DncV is shown as sequence 1 in the sequence table. The invention uses gene engineering technology to prepare soluble expressed recombinant vibrio cholerae dinucleotide cyclase DncV, then uses ATP, GTP or ATP and GTP as substrates by using a biochemical method, and the biological enzyme catalyzes and synthesizes high-activity and specificity c-di-GMP, c-di-AMP or 3 '3' -cGAMP respectively, thereby providing a simple and rapid preparation method with low cost, mild condition and high yield and being capable of producing three CDNs in a large scale; also provided is a method for identifying the biological activity of recombinant DncV enzyme and its catalytic products, c-di-GMP, c-di-AMP or 3 '3' -cGAMP.

Description

Preparation method of bacterial second messenger molecule cyclic dinucleotide

Technical Field

The invention relates to the technical field of genetic engineering and biochemistry, in particular to a method for producing second messenger molecules, namely cyclic dinucleotides c-di-GMP, c-di-AMP and 3 '3' -cGAMP, by applying the catalysis of a bacterial source recombinant biological enzyme.

Background

Cyclic Dinucleotides (CDNs), including cyclic diguanylic acid (c-di-GMP), cyclic di-adenylic acid (c-di-AMP) and cyclic guanylic acid-adenylic acid (3 '3' -cGAMP), are an important class of second messenger molecules widely present in bacteria, involved in biological processes such as bacterial virulence, fatty acid metabolism, tolerance to low phosphate environments, DNA integrity, metabolic balance of cell wall, flagellar motility, biofilm formation, and resistance to phage infection. Wherein c-di-GMP is a second messenger molecule for gram-negative bacteria, CDN, which catalyzes the two molecules of GTP by guanylate cyclase (DGC) and is formed by 3'-5' phosphodiester bonds; c-di-AMP is a second messenger molecule of gram-positive bacteria, a cyclic nucleic acid molecule formed by 3'-5' phosphodiester bond after two molecules of ATP are subjected to adenylate cyclase (DAC); 3'-3' cGAMP is a second messenger molecule found in Vibrio cholerae, which is generated by the DncV catalysis of 1 molecule of ATP and 1 molecule of GTP, linked by a 3'-5' phosphodiester bond. More importantly, c-di-GMP, c-di-AMP and 3'-3' cGAMP are important pathogen-associated molecular patterns (PAMPs) of bacteria, and can be induced by Pattern Recognition Receptors (PRRs) of hosts to activate downstream signal transduction pathways, trigger natural immune response of organisms and induce subsequent acquired immune response, and further form a complex host defense network. c-di-GMP, c-di-AMP and 3'-3' cGAMP can induce anti-infection natural immune response mainly comprising type I IFNs and inflammatory factors through STING-TBK1-IRF3 signal axis; meanwhile, DDX41 helicase may act as an auxiliary receptor of STING, enhancing the affinity of STING for c-di-AMP, c-di-GMP and 3 '3' -cGAMP. In addition, subsequent studies have also found that RECON is a high affinity receptor for c-di-AMP and 3 '3' -cGAMP, while ERADP is a high affinity receptor for c-di-AMP, and induces a natural immune response characterized by inflammatory factors through activation of NF-. kappa.B. More interestingly, c-di-AMP, c-di-GMP and 3 '3' -cGAMP also induce a innate immune response, mainly IL-1 β and IL-18, by activating the assembly of AIM2-NLRP3-ASC-Caspase-1 inflammasome. Therefore, the c-di-GMP, the c-di-AMP and the 3'-3' cGAMP have various capacities of inducing host anti-infection and anti-tumor natural immune response through natural immune receptors, and can become anti-infection and anti-tumor drugs, vaccine adjuvants and immunopotentiators with good application potential. However, the large scale production of bacterial CDNs has been limited by their high cost and relatively cumbersome procedures. Therefore, the development of a simple, rapid, reliable, effective and environment-friendly production method for preparing CDNs in large quantities is of great significance.

At present, c-di-GMP, c-di-AMP and 3'-3' cGAMP are mainly prepared by tissue extraction, chemical synthesis and enzymatic synthesis, but the tissue extraction and chemical synthesis have low efficiency, difficult extraction, separation and purification, long time consumption, multiple steps, high cost and no environmental protection. Although the enzymatic synthesis method relatively overcomes some of the above disadvantages, the technique has the disadvantage that the preparation of c-di-GMP, c-di-AMP and 3'-3' cGAMP all require different biological enzymes to be obtained, i.e., one biological enzyme only catalyzes the production of one CDN, which limits its wide application. Therefore, it is important for practical application to find a simpler, faster, economical, efficient and environmentally friendly method for preparing c-di-GMP, c-di-AMP and 3'-3' cGAMP.

Disclosure of Invention

The object of the present invention is to provide a process for the preparation of bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP.

The method for preparing the bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP provided by the invention comprises the following steps: the same recombinant biological enzyme is adopted to catalyze and produce three second messenger molecules of bacterial c-di-GMP, c-di-AMP and 3 '3' -cGAMP respectively.

c-di-GMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₄P₂Molecular weight: 734.38, respectively;

c-di-AMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₂P₂Molecular weight: 702.38, respectively;

3 '3' -cGAMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₃P₂Molecular weight: 718.38.

wherein the molecular structural formulas of the c-di-GMP, the c-di-AMP and the 3 '3' -cGAMP are as follows:

the recombinant biological enzyme can be specifically recombinant vibrio cholerae dinucleotide cyclase DncV, namely recombinant DncV enzyme;

the recombinant vibrio cholerae dinucleotide cyclase DncV is prepared by a method comprising the following steps of:

the amino acid sequence of DncV is shown as sequence 1 in the sequence table, the original coding gene sequence of DncV is shown as sequence 2 in the sequence table, and the coding gene sequence of DncV after codon optimization is shown as sequence 3 in the sequence table;

1) replacing a fragment between BamHI and XhoI sites of a prokaryotic expression vector pET-28a-SUMO with a DNA molecule shown in 1 st to 1305 th sites from the 5' end of a sequence 3 in a sequence table to obtain a recombinant expression vector pET-28 a-SUMO-DncV;

2) introducing the recombinant expression vector pET-28a-SUMO-DncV obtained in the step 1) into escherichia coli Rosetta (DE3) competent cells to obtain recombinant bacteria;

3) inoculating the recombinant bacteria obtained in the step 2) into an LB liquid culture medium, and culturing at 37 ℃ and 230rpm until the OD of a bacterial liquid_600nmWhen the concentration is 0.6-0.8, adding IPTG with concentration of 0.5mmol/L into the culture system, inducing at 16 deg.C and 230rpm for 20h, centrifuging at 4 deg.C and 6000r/min for 5min after induction, and collecting thallus precipitate;

4) washing the cell pellet obtained in step 3) with 50mL of 20mM Tris-HCl buffer solution (pH 7.5) containing a protease inhibitor for 3 times, then resuspending the cell pellet with 4mL of Tris-Cl containing a protease inhibitor, freeze-thawing for 3 times repeatedly, and disrupting and lysing the cells using an ultrasonic cell disruptor;

5) after the step 4) is finished, centrifuging at 16000rpm/min for 30min at 4 ℃, and collecting the supernatant;

6) filtering the supernatant obtained in the step 5) by a 0.45-micron microporous filter membrane, and then primarily separating and purifying by a Ni-NTA agarose gel affinity column to obtain DncV;

7) taking the DncV obtained in the step 6), carrying out enzyme digestion by adopting SUMO protease to remove His6-SUMO fusion tag protein, and then separating and purifying by using a Ni-NTA agarose gel affinity column to obtain the recombinant DncV enzyme.

In the step 4), the pH value of the Tris-HCl buffer solution is 7.5;

the ultrasonic wave of the ultrasonic wave cell crusher is set as follows: performing ultrasonic treatment for 5s and intermittent treatment for 5s for 20 min;

in the step 7), the enzyme digestion reaction system is as follows: recombinant DncV enzyme 1000. mu.g, SUMO Protease Buffer 20. mu.L, SUMO Protease 2. mu.L, ddH₂O is constant volume to 1000 mu L;

the enzyme digestion reaction program is as follows: enzyme digestion is carried out for 12h or overnight at 4 ℃;

and further separating and purifying the enzyme digestion product by a Ni-NTA agarose gel affinity column to obtain the recombinant DncV enzyme with the His and SUMO labels cut off.

Specifically, the method for preparing bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP comprises the following steps: catalyzing and synthesizing c-di-AMP by adopting a recombinant DncV enzyme through an in-vitro enzymatic reaction by taking ATP as a substrate;

catalytically synthesizing c-di-GMP by taking GTP as a substrate and adopting a recombinant DncV enzyme through an in-vitro enzymatic reaction;

uses ATP and GTP as substrates, adopts recombinant DncV enzyme to catalyze and synthesize 3 '3' -cGAMP through in vitro enzymatic reaction,

wherein, the enzymatic reaction system for synthesizing the c-di-AMP comprises the following steps: DncV 5. mu.M, HEPES 20mM, MgCl₂5mM，ATP 2mM，DEPC H₂O up to 1mL；

An enzymatic reaction system for synthesizing c-di-GMP, comprising: DncV 5. mu.M, HEPES 20mM, MgCl₂5 mM，GTP 2mM，DEPC H₂O up to 1mL；

An enzymatic reaction system for the synthesis of 3 '3' -cGAMP, which is: DncV 5. mu.M, HEPES 20mM, MgCl₂5 mM，ATP 2mM，GTP 2mM，DEPC H₂O up to 1mL；

Wherein the concentration of DncV is 10.08 mg/mL.

The method comprises the following specific operations: preparing an enzymatic reaction system, incubating at 37 ℃ for 2h, adding nuclease Benzonase and bovine small intestine alkaline phosphatase, incubating at 37 ℃ for 30min, incubating the reaction product at 95 ℃ for 10min, placing at-20 ℃ for 24h, centrifuging at 4 ℃ and 16000g/min for 10min, taking the supernatant, and filtering the supernatant by using a 3kDa ultrafiltration centrifugal tube to obtain the reaction product.

The invention uses gene engineering technology to prepare soluble expressed recombinant vibrio cholerae dinucleotide cyclase DncV, then uses ATP, GTP or ATP and GTP as substrates by using a biochemical method, and the biological enzyme catalyzes and synthesizes high-activity and specificity c-di-GMP, c-di-AMP or 3 '3' -cGAMP respectively, thereby providing a simple and rapid preparation method with low cost, mild condition and high yield and being capable of producing three CDNs in a large scale; also provided is a method for identifying the biological activity of recombinant DncV enzyme and its catalytic products, c-di-GMP, c-di-AMP or 3 '3' -cGAMP. The three CDNs prepared by the invention are used as nucleic acids PAPMs of bacteria, are effective activators of natural immunity PRRs, and can quickly activate and enhance the natural immune response of a host; the CDNs have wide biological activities of antivirus, antitumor, immunopotentiation, immunologic adjuvant and the like, and have huge development prospects of medicines, immunopotentiators and immunologic adjuvants.

Drawings

FIG. 1 is an SDS-PAGE analysis of purified recombinant protein, A: before enzyme digestion; b: after enzyme digestion. 1. 3: protein relative molecular mass standard; 2: recombinant protein SUMO-DncV; 4: DncV.

FIG. 2 shows the in vitro enzymatic reaction product biological activity of DncV. Control: blank control; 3 '3' -cGAMP: a positive control; DncV-ATP + GTP: the recombinant protein DncV takes ATP and GTP as substrates to produce an enzymatic reaction product; ATP + GTP: negative control; c-di-AMP: a positive control; DncV-ATP: an enzymatic reaction product of the recombinant protein DncV with ATP as a substrate; ATP: negative control; c-di-GMP: a positive control; DncV-GTP: an enzymatic reaction product of the recombinant protein DncV with GTP as a substrate; GTP: and (5) negative control.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemicals, unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

c-di-GMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₄P₂CAS number: 61093-23-0, molecular weight: 734.38, respectively;

c-di-AMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₂P₂CAS number: 1441190-66-4, molecular weight: 702.38, respectively;

3 '3' -cGAMP: the molecular formula is as follows: c₂₀H₂₂N₁₀O₁₃P₂CAS number: 849214-04-6, molecular weight: 718.38.

material

pET-28 a-SUMO: wuhan vast ling biotechnology limited, cat #: p0028.

Rosetta (DE3) competent cells: beijing Huayuyo Biotech Co., Ltd., Cat No.: SJ 00010.

Protease inhibitors: roche, cat number: 04693132001.

Ni-NTA agarose gel affinity column: wechbo hui chromatography technologies ltd, cat #: CS-A01-02.

SUMO protease: beijing Solaibao Tech Co., Ltd., Cat #: p2070.

Pierce^TMCoomassie (bradford) protein quantification kit: sammer Feishale science and technology (China) Co., Ltd., Cat number: 23200.

nuclease Benzonase: sigma aldrich (shanghai) trade limited, cat #: e1014-5 KU.

Cell membrane permeabilizing agent Digitonin: sigma aldrich (shanghai) trade limited, cat #: d141-100 MG.

ATP: sammer Feishale science and technology (China) Co., Ltd., Cat number: r0441.

GTP: sammer Feishale science and technology (China) Co., Ltd., Cat number: r0461.

Bovine small intestine alkaline phosphatase (Calfintestinal alkaline phosphatase): default feishale science and technology (china) ltd, cat #: 18009-027.

3kDa ultrafiltration centrifuge tube: Merck-Millipore, Cat #: UFC 800396.

Insulin-Transferrin-Selenium-Sodium Pyruvate (ITS-A) (100X): sammer Feishale science and technology (China) Co., Ltd., Cat number: 51300-044.

DMEM: sammer Feishale science and technology (China) Co., Ltd., Cat number: 21063-029.

RAW264.7-Lucia^TMISG cells: french invivogen, cat No.: rawl-isg.

3 '3' -cGAMP standard: french invivogen, cat No.: tlrl-nacga.

c-di-AMP standard: french invivogen, cat No.: tlrl-nacda.

c-di-GMP standard: french invivogen, cat No.: tlrl-nacdg.

Luciferase substrate QUANTI-Luc^TM: french invivogen, cat No.: rep-qlc 1.

A method for preparing bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP is provided.

The invention provides a method for preparing bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP, which comprises the following steps: the same recombinant biological enzyme is adopted to catalyze and produce three second messenger molecules of bacterial c-di-GMP, c-di-AMP and 3 '3' -cGAMP respectively.

In the step 4), the pH value of the Tris-HCl buffer solution is 7.5;

wherein, the enzymatic reaction system for synthesizing the c-di-AMP comprises the following steps: DncV 5. mu.M, HEPES 20mM, MgCl₂ 5mM，ATP 2mM，DEPC H₂O up to 1mL；

An enzymatic reaction system for synthesizing c-di-GMP, comprising: DncV 5. mu.M, HEPES 20mM, MgCl₂ 5mM，GTP 2mM，DEPC H₂O up to 1mL；

An enzymatic reaction system for the synthesis of 3 '3' -cGAMP, which is: DncV 5. mu.M, HEPES 20mM, MgCl₂ 5mM，ATP 2mM，GTP 2mM，DEPC H₂O up to 1mL；

Wherein the concentration of DncV is 10.08 mg/mL.

Example 1 preparation of recombinant Vibrio cholerae dinucleotide cyclase DncV

The amino acid sequence of DncV is shown as sequence 1 in the sequence table, the original coding gene sequence of DncV is shown as sequence 2 in the sequence table, and the coding gene sequence of DncV after codon optimization is shown as sequence 3 in the sequence table.

1. And replacing the fragment between BamHI and XhoI sites of the prokaryotic expression vector pET-28a-SUMO with DNA molecules shown in 1 st to 1305 th sites from the 5' end of the sequence 3 of the sequence table to obtain the recombinant expression vector pET-28a-SUMO-DncV (sequencing verification is carried out).

2. And (2) introducing the recombinant expression vector pET-28a-SUMO-DncV obtained in the step (1) into escherichia coli Rosetta (DE3) competent cells to obtain recombinant bacteria.

3. Inoculating the recombinant bacteria obtained in the step 2 into an LB liquid culture medium, and culturing at 37 ℃ and 230rpm until the OD of the bacterial liquid_600nmWhen the concentration is 0.6-0.8, adding IPTG with concentration of 0.5mmol/L into the culture system, inducing at 16 deg.C and 230rpm for 20h, centrifuging at 4 deg.C and 6000r/min for 5min after induction, and collecting thallus precipitate.

4. The cell pellet obtained in step 3 was washed 3 times with 50mL of 20mM Tris-HCl buffer (pH 7.5) containing a protease inhibitor, then resuspended in 4mL Tris-Cl containing a protease inhibitor, freeze-thawed 3 times repeatedly, and disrupted by an ultrasonic cell disruptor (ultrasonic setting: 5 seconds, 5 seconds intermittent, 20min total).

5. After completion of step 4, the mixture was centrifuged at 16000rpm/min for 30min at 4 ℃ and the supernatant was collected.

6. The supernatant obtained in step 5 was filtered through a 0.45 μm microfiltration membrane and then subjected to preliminary separation and purification by Ni-NTA agarose gel affinity column (according to the instructions) to obtain DncV, and the purified DncV (purity 95%) was identified by SDS-PAGE analysis, and the results are shown in FIG. 1.

7. Taking the DncV obtained in the step 6, carrying out enzyme digestion by SUMO protease (Beijing Solebao science and technology Co., Ltd.) to remove His6-SUMO fusion tag protein, and then separating and purifying by a Ni-NTA agarose gel affinity column (operating according to the instruction) to obtain the recombinant DncV enzyme. The recombinant DncV enzyme (95% purity) was identified by SDS-PAGE analysis and the results are shown in FIG. 1.

An enzyme digestion reaction system: recombinant DncV enzyme 1000. mu.g, SUMO Protease Buffer 20. mu.L, SUMO Protease 2. mu.L, ddH₂O is metered to 1000. mu.L. And (3) enzyme digestion reaction program: the digestion was carried out at 4 ℃ for 12h or overnight. The digested product was further separated and purified by Ni-NTA agarose gel affinity column to obtain recombinant DncV enzyme (purity: 97%) from which His and SUMO tag had been excised, and the results are shown in FIG. 1.

8. Use of Pierce^TMThe concentration of recombinant DncV enzyme was 10.08mg/mL as determined by the Coomassie (Bradford) protein quantification kit (according to the instructions).

Example 2 catalytic Synthesis of bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP, respectively, Using recombinant DncV enzyme

The bacterial recombinant DncV enzyme prepared in example 1 is used for catalyzing and synthesizing bacterial cyclic dinucleotides c-di-GMP, c-di-AMP and 3 '3' -cGAMP in vitro with high efficiency and specificity, and the specific steps are as follows:

1. configuration of enzymatic reaction system:

(1)3 '3' -cGAMP synthesis: DncV 5. mu.M, HEPES 20mM, MgCl₂5 mM，ATP 2mM，GTP 2mM，DEPC H₂O up to 1mL；

(2) c-di-AMP Synthesis: DncV 5. mu.M, HEPES 20mM, MgCl₂5 mM，ATP 2mM，DEPC H₂O up to 1mL；

(3) c-di-GMP Synthesis: DncV 5. mu.M, HEPES 20mM, MgCl₂5 mM，GTP 2mM，DEPC H₂O up to 1mL。

All enzymatic reaction system steps above were performed on ice.

2. After completion of step 1, incubation was carried out at 37 ℃ for 2h, followed by addition of 5. mu.L of nuclease Benzonase and bovine small intestine alkaline phosphatase, and incubation was carried out at 37 ℃ for 30 min.

3. After the step 2 is completed, the reaction product is incubated at 95 ℃ for 10min and then placed at-20 ℃ for about 24h, and then centrifuged at 16000g/min for 10min at 4 ℃ to obtain supernatant. The supernatant was filtered through a 3kDa ultrafiltration tube (Merck-Millipore Co., Ltd., cat # UFC501096) to obtain reaction products, respectively.

The absorbance values of the reaction product obtained in step 3 and the enzymatic reaction system of step 1 were measured at 260nm using a spectrophotometer, and the reaction yields were 96.70%, 98.20%, and 97.00%, respectively.

Reaction yield-reaction product OD_260nmEnzymatic reaction System OD260_nm。

Example 3 characterization of the Activity of bacterial DncV enzyme and the catalytic products c-di-GMP, c-di-AMP and 3 '3' -cGAMP

1. Mixing RAW264.7-Lucia^TMISG cells were adjusted to a density of 5X 10⁵Perml, seeded in 96-well plates (100. mu.L per well, cell number 5X 10⁴) Culturing at 37 deg.C until cell density reaches 70-80%.

2. After completion of step 1, the 96-well plate was taken, the culture solution was discarded, and the cells were washed 3 times with 100 μ L of FBS-free DMEM cell culture solution.

3. After completion of step 2, the following 6 sets were set for operation (7 replicates per set):

DncV + ATP + GTP group: the enzymatic reaction product was mixed with 2 × cell permeant at A volume ratio of 1:1 and added to wells (50 μ L per well), incubated at 37 ℃ for 30min and the well fluid was discarded, 100 μ L of FBS-free DMEM cell culture was used to wash the cells 3 times, 75 μ L of FBS-free cell culture containing 1% ITS-A was added and cultured at 37 ℃ for 18 h. The enzymatic reaction product is the reaction product obtained in example 2.

DncV + ATP panel: the enzymatic reaction product was mixed with 2 × cell permeant at A volume ratio of 1:1 and added to the wells (50 μ L per well), incubated at 37 ℃ for 30min and the well fluid was discarded, 100 μ L of FBS-free DMEM cell culture was used to wash the cells once, 75 μ L of cell culture containing 1% ITS-A but no FBS was added and cultured at 37 ℃ for 18 h. The enzymatic reaction product is the reaction product obtained in example 2.

DncV + GTP group: the enzymatic reaction product was mixed with 2 × cell permeant at A volume ratio of 1:1 and added to the wells (50 μ L per well), incubated at 37 ℃ for 30min and the well fluid was discarded, 100 μ L of FBS-free DMEM cell culture was used to wash the cells once, 75 μ L of cell culture containing 1% ITS-A but no FBS was added and cultured at 37 ℃ for 18 h. The enzymatic reaction product is the reaction product obtained in example 2.

3 '3' -cGAMP (1000ng/ml) standard set: 2000ng/ml of 3 '3' -cGAMP and 2 Xcell permeant were mixed at A volume ratio of 1:1 and added to wells (50. mu.L per well), incubated at 37 ℃ for 30min, the well fluid was discarded, 100. mu.L of FBS-free DMEM cell culture medium was used to wash the cells once, 75. mu.L of cell culture medium containing 1% ITS-A but no FBS was added, and cultured at 37 ℃ for 18 h.

c-di-AMP (1000ng/ml) standard set: 2000ng/ml c-di-AMP was mixed with 2 × cell permeant at A volume ratio of 1:1 and added to wells (50 μ L per well), incubated at 37 ℃ for 30min, the well fluid was discarded, 100 μ L of FBS-free DMEM cell culture medium was used to wash the cells once, 75 μ L of cell culture medium containing 1% ITS-A but no FBS was added, and cultured at 37 ℃ for 18 h.

c-di-GMP (1000ng/ml) standard group: 2000ng/ml c-di-GMP and 2 Xcell membrane penetrating agent are mixed according to the volume ratio of 1:1 and then added into the wells (50 mu L of each well), incubated at 37 ℃ for 30min, the liquid in the wells is discarded, 100 mu L of FBS-free DMEM cell culture solution is used for washing the cells once, 75 mu L of cell culture solution containing 1% ITS-A but not FBS is added, and the cells are cultured for 18h at 37 ℃.

DMEM control group: DMEM and 2 x cell membrane penetrating agent are mixed according to the volume ratio of 1:1 and then added into the wells (50 mu L of each well), liquid in the wells is discarded after incubation for 30min at 37 ℃, 100 mu L of FBS-free DMEM cell culture solution is used for washing cells once, 75 mu L of cell culture solution containing 1% ITS-A but not containing FBS is added, and the cells are cultured for 18h at 37 ℃.

The formulation of the 2X cell membrane permeabilizing agent is shown in Table 1.

TABLE 12X cell permeant formulation

Components	Concentration in the reaction System	Volume of
			HEPES(pH7.5)	100mM	500μL
MgCl₂	6mM	30μL
			KCl	200mM	1ml
DTT	0.2mM	10μL
			Sucrose	170mM	850μL
BSA	7.5％	267μL
			ATP	2mM	100μL
GTP	0.2mM	10μL
			Digitonin	20μg/mL	20μL
DEPCH₂O		Make up to 5ml

4. After completion of step 3, 50. mu.L of the supernatant was pipetted into a 96-well microwell plate and 50. mu.L of luciferase substrate was added, and fluorescence was measured at a wavelength of 700nm immediately using a VICTORNivo multimode plate reader (Perkin Elmer Co., Ltd.) and the relative fluorescence intensity (fold) was calculated, thereby determining the biological activities of the recombinant DncV enzyme and its catalytic products, c-di-GMP, c-di-AMP and 3 '3' -cGAMP.

The results are shown in FIG. 2. The results show that the recombinant DncV enzyme has biological activity and can catalyze the synthesis of c-di-GMP, c-di-AMP and 3 '3' -cGAMP by respectively taking ATP, GTP and ATP + GTP as substrates, and the generated c-di-GMP, c-di-AMP and 3 '3' -cGAMP also have immune stimulation activity and can induce the expression of luciferase reporter genes after being recognized by a natural immune receptor STING. Thus, one bacterial source of recombinant DncV enzyme is capable of producing three CDNs.

Sequence listing

1.MTWNFHQYYTNRNDGLMGKLVLTDEEKNNLKALRKIIRLRTRDVFEEAKGIAKAVKKSALTFEIIQEKVSTTQIKHLSDSEQREVAKLIYEMDDDARDEFLGLTPRFWTQGSFQYDTLNRPFQPGQEMDIDDGTYMPMPIFESEPKIGHSLLILLVDASLKSLVAENHGWKFEAKQTCGRIKIEAEKTHIDVPMYAIPKDEFQKKQIALEANRSFVKGAIFESYVADSITDDSETYELDSENVNLALREGDRKWINSDPKIVEDWFNDSCIRIGKHLRKVCRFMKAWRDAQWDVGGPSSISLMAATVNILDSVAHDASDLGETMKIIAKHLPSEFARGVESPDSTDEKPLFPPSYKHGPREMDIMSKLERLPEILSSAESADSKSEALKKINMAFGNRVTNSELIVLAKALPAFAQEPSSASKPEKISSTMVSG

2.ATGACTTGGAACTTTCACCAGTACTACACAAACCGAAATGATGGCTTGATGGGCAAGCTAGTTCTTACAGACGAGGAGAAGAACAATCTAAAGGCATTGCGTAAGATCATCCGCTTAAGAACACGAGATGTATTTGAAGAAGCTAAGGGTATTGCCAAGGCTGTGAAAAAAAGTGCTCTTACGTTTGAAATTATTCAGGAAAAGGTGTCAACGACCCAAATTAAGCACCTTTCTGACAGCGAACAACGAGAAGTGGCTAAGCTTATTTACGAGATGGATGATGATGCTCGTGATGAGTTTTTGGGATTGACACCTCGCTTTTGGACTCAGGGAAGCTTTCAGTATGACACGCTGAATCGCCCGTTTCAGCCTGGTCAAGAAATGGATATTGATGATGGAACCTATATGCCAATGCCTATTTTTGAGTCAGAGCCTAAGATTGGTCATTCTTTACTAATTCTTCTTGTTGACGCGTCACTTAAGTCACTTGTAGCTGAAAATCATGGCTGGAAATTTGAAGCTAAGCAGACTTGTGGGAGGATTAAGATTGAGGCAGAGAAAACACATATTGATGTACCAATGTATGCAATCCCTAAAGATGAGTTCCAGAAAAAGCAAATAGCTTTAGAAGCAAATAGATCATTTGTTAAAGGTGCCATTTTTGAATCATATGTTGCAGATTCAATTACTGACGATAGTGAAACTTATGAATTAGATTCAGAAAACGTAAACCTTGCTCTTCGTGAAGGTGATCGGAAGTGGATCAATAGCGACCCCAAAATAGTTGAAGATTGGTTCAACGATAGTTGTATACGTATTGGTAAACATCTTCGTAAGGTTTGTCGCTTTATGAAAGCGTGGAGAGATGCGCAGTGGGATGTTGGAGGTCCGTCATCGATTAGTCTTATGGCTGCAACGGTAAATATTCTTGATAGCGTTGCTCATGATGCTAGTGATCTCGGAGAAACAATGAAGATAATTGCTAAGCATTTACCTAGTGAGTTTGCTAGGGGAGTAGAGAGCCCTGACAGTACCGATGAAAAGCCACTCTTCCCACCCTCTTATAAGCATGGCCCTCGGGAGATGGACATTATGAGCAAACTAGAGCGTTTGCCAGAGATTCTGTCATCTGCTGAGTCAGCTGACTCTAAGTCAGAGGCCTTGAAAAAGATTAATATGGCGTTTGGGAATCGTGTTACTAATAGCGAGCTTATTGTTTTGGCAAAGGCTTTACCGGCTTTCGCTCAAGAACCTAGTTCAGCCTCGAAACCTGAAAAAATCAGCAGCACAATGGTAAGTGGCTGA

3.ATGACCTGGAATTTCCATCAGTATTATACCAACCGCAACGACGGCCTGATGGGCAAATTAGTGCTGACCGATGAAGAGAAAAATAACCTGAAGGCACTGCGTAAGATTATCCGTCTGCGCACCCGCGATGTGTTCGAAGAAGCCAAGGGTATCGCCAAGGCCGTGAAGAAATCTGCCCTGACCTTCGAGATCATTCAGGAGAAGGTTAGCACCACCCAGATTAAGCACCTGAGCGACAGCGAGCAGCGCGAAGTGGCCAAACTGATCTACGAGATGGACGACGATGCCCGTGACGAATTTCTGGGTCTGACCCCGCGCTTTTGGACCCAGGGTAGCTTCCAGTATGATACCCTGAACCGCCCTTTCCAGCCGGGCCAGGAGATGGATATCGATGATGGCACCTACATGCCGATGCCGATCTTTGAGAGCGAACCGAAGATCGGCCACAGCCGCTGATTCTGCTGGTTGACGCCAGCCTGAAGAGTCTGGTGGCCGAAAATCATGGCTGGAAGTTCGAGGCCAAACAGACCTGTGGTCGTATTAAAATCGAGGCCGAAAAAACCCATATCGATGTGCCGATGTACGCCATTCCGAAGGACGAGTTTCAGAAAAAGCAGATCGCCCTGGAGGCAAACCGCAGCTTCGTGAAAGGTGCCATCTTCGAGAGCTACGTGGCAGATAGCATCACCGACGATAGCGAGACCTACGAGCTGGATAGCGAGAACGTGAACCTGGCACTGCGCGAAGGCGATCGCAAATGGATCAACAGCGACCCGAAGATCGTGGAGGACTGGTTCAACGACAGCTGTATCCGCATTGGCAAACACCTGCGCAAAGTGTGCCGTTTCATGAAGGCATGGCGTGATGCACAGTGGGATGTGGGTGGCCCGAGTAGCATTAGCCTGATGGCCGCCACCGTTAACATCCTGGATAGCGTTGCACATGATGCCAGCGATCTGGGCGAAACCATGAAGATTATTGCCAAACATCTGCCGAGTGAATTTGCCCGCGGTGTGGAGAGCCCGGATAGTACCGACGAAAAACCGCTGTTTCCGCCTAGCTACAAACACGGCCCGCGCGAGATGGACATCATGAGTAAACTGGAGCGCCTGCCGGAAATTCTGAGCAGCGCCGAAAGCGCAGACAGCAAAAGCGAGGCCCTGAAGAAAATTAACATGGCCTTTGGCAATCGCGTTACCAACAGCGAACTGATTGTGCTGGCAAAGGCACTGCCTGCATTCGCCCAAGAGCCGAGTAGCGCCAGCAAGCCGGAAAAAATCAGCAGCACCATGGTGAGCGGTTAA

SEQUENCE LISTING

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> a method for preparing a cyclic dinucleotide, a bacterial second messenger molecule

<130> GNCAQ211670

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 434

<212> PRT

<213> Vibrio cholerae

<400> 1

Met Thr Trp Asn Phe His Gln Tyr Tyr Thr Asn Arg Asn Asp Gly Leu

1 5 10 15

Met Gly Lys Leu Val Leu Thr Asp Glu Glu Lys Asn Asn Leu Lys Ala

20 25 30

Leu Arg Lys Ile Ile Arg Leu Arg Thr Arg Asp Val Phe Glu Glu Ala

35 40 45

Lys Gly Ile Ala Lys Ala Val Lys Lys Ser Ala Leu Thr Phe Glu Ile

50 55 60

Ile Gln Glu Lys Val Ser Thr Thr Gln Ile Lys His Leu Ser Asp Ser

65 70 75 80

Glu Gln Arg Glu Val Ala Lys Leu Ile Tyr Glu Met Asp Asp Asp Ala

85 90 95

Arg Asp Glu Phe Leu Gly Leu Thr Pro Arg Phe Trp Thr Gln Gly Ser

100 105 110

Phe Gln Tyr Asp Thr Leu Asn Arg Pro Phe Gln Pro Gly Gln Glu Met

115 120 125

Asp Ile Asp Asp Gly Thr Tyr Met Pro Met Pro Ile Phe Glu Ser Glu

130 135 140

Pro Lys Ile Gly His Ser Leu Leu Ile Leu Leu Val Asp Ala Ser Leu

145 150 155 160

Lys Ser Leu Val Ala Glu Asn His Gly Trp Lys Phe Glu Ala Lys Gln

165 170 175

Thr Cys Gly Arg Ile Lys Ile Glu Ala Glu Lys Thr His Ile Asp Val

180 185 190

Pro Met Tyr Ala Ile Pro Lys Asp Glu Phe Gln Lys Lys Gln Ile Ala

195 200 205

Leu Glu Ala Asn Arg Ser Phe Val Lys Gly Ala Ile Phe Glu Ser Tyr

210 215 220

Val Ala Asp Ser Ile Thr Asp Asp Ser Glu Thr Tyr Glu Leu Asp Ser

225 230 235 240

Glu Asn Val Asn Leu Ala Leu Arg Glu Gly Asp Arg Lys Trp Ile Asn

245 250 255

Ser Asp Pro Lys Ile Val Glu Asp Trp Phe Asn Asp Ser Cys Ile Arg

260 265 270

Ile Gly Lys His Leu Arg Lys Val Cys Arg Phe Met Lys Ala Trp Arg

275 280 285

Asp Ala Gln Trp Asp Val Gly Gly Pro Ser Ser Ile Ser Leu Met Ala

290 295 300

Ala Thr Val Asn Ile Leu Asp Ser Val Ala His Asp Ala Ser Asp Leu

305 310 315 320

Gly Glu Thr Met Lys Ile Ile Ala Lys His Leu Pro Ser Glu Phe Ala

325 330 335

Arg Gly Val Glu Ser Pro Asp Ser Thr Asp Glu Lys Pro Leu Phe Pro

340 345 350

Pro Ser Tyr Lys His Gly Pro Arg Glu Met Asp Ile Met Ser Lys Leu

355 360 365

Glu Arg Leu Pro Glu Ile Leu Ser Ser Ala Glu Ser Ala Asp Ser Lys

370 375 380

Ser Glu Ala Leu Lys Lys Ile Asn Met Ala Phe Gly Asn Arg Val Thr

385 390 395 400

Asn Ser Glu Leu Ile Val Leu Ala Lys Ala Leu Pro Ala Phe Ala Gln

405 410 415

Glu Pro Ser Ser Ala Ser Lys Pro Glu Lys Ile Ser Ser Thr Met Val

420 425 430

Ser Gly

<210> 2

<211> 1305

<212> DNA

<213> Vibrio cholerae

<400> 2

atgacttgga actttcacca gtactacaca aaccgaaatg atggcttgat gggcaagcta 60

gttcttacag acgaggagaa gaacaatcta aaggcattgc gtaagatcat ccgcttaaga 120

acacgagatg tatttgaaga agctaagggt attgccaagg ctgtgaaaaa aagtgctctt 180

acgtttgaaa ttattcagga aaaggtgtca acgacccaaa ttaagcacct ttctgacagc 240

gaacaacgag aagtggctaa gcttatttac gagatggatg atgatgctcg tgatgagttt 300

ttgggattga cacctcgctt ttggactcag ggaagctttc agtatgacac gctgaatcgc 360

ccgtttcagc ctggtcaaga aatggatatt gatgatggaa cctatatgcc aatgcctatt 420

tttgagtcag agcctaagat tggtcattct ttactaattc ttcttgttga cgcgtcactt 480

aagtcacttg tagctgaaaa tcatggctgg aaatttgaag ctaagcagac ttgtgggagg 540

attaagattg aggcagagaa aacacatatt gatgtaccaa tgtatgcaat ccctaaagat 600

gagttccaga aaaagcaaat agctttagaa gcaaatagat catttgttaa aggtgccatt 660

tttgaatcat atgttgcaga ttcaattact gacgatagtg aaacttatga attagattca 720

gaaaacgtaa accttgctct tcgtgaaggt gatcggaagt ggatcaatag cgaccccaaa 780

atagttgaag attggttcaa cgatagttgt atacgtattg gtaaacatct tcgtaaggtt 840

tgtcgcttta tgaaagcgtg gagagatgcg cagtgggatg ttggaggtcc gtcatcgatt 900

agtcttatgg ctgcaacggt aaatattctt gatagcgttg ctcatgatgc tagtgatctc 960

ggagaaacaa tgaagataat tgctaagcat ttacctagtg agtttgctag gggagtagag 1020

agccctgaca gtaccgatga aaagccactc ttcccaccct cttataagca tggccctcgg 1080

gagatggaca ttatgagcaa actagagcgt ttgccagaga ttctgtcatc tgctgagtca 1140

gctgactcta agtcagaggc cttgaaaaag attaatatgg cgtttgggaa tcgtgttact 1200

aatagcgagc ttattgtttt ggcaaaggct ttaccggctt tcgctcaaga acctagttca 1260

gcctcgaaac ctgaaaaaat cagcagcaca atggtaagtg gctga 1305

<210> 3

<211> 1304

<212> DNA

<213> Vibrio cholerae

<400> 3

atgacctgga atttccatca gtattatacc aaccgcaacg acggcctgat gggcaaatta 60

gtgctgaccg atgaagagaa aaataacctg aaggcactgc gtaagattat ccgtctgcgc 120

acccgcgatg tgttcgaaga agccaagggt atcgccaagg ccgtgaagaa atctgccctg 180

accttcgaga tcattcagga gaaggttagc accacccaga ttaagcacct gagcgacagc 240

gagcagcgcg aagtggccaa actgatctac gagatggacg acgatgcccg tgacgaattt 300

ctgggtctga ccccgcgctt ttggacccag ggtagcttcc agtatgatac cctgaaccgc 360

cctttccagc cgggccagga gatggatatc gatgatggca cctacatgcc gatgccgatc 420

tttgagagcg aaccgaagat cggccacagc cgctgattct gctggttgac gccagcctga 480

agagtctggt ggccgaaaat catggctgga agttcgaggc caaacagacc tgtggtcgta 540

ttaaaatcga ggccgaaaaa acccatatcg atgtgccgat gtacgccatt ccgaaggacg 600

agtttcagaa aaagcagatc gccctggagg caaaccgcag cttcgtgaaa ggtgccatct 660

tcgagagcta cgtggcagat agcatcaccg acgatagcga gacctacgag ctggatagcg 720

agaacgtgaa cctggcactg cgcgaaggcg atcgcaaatg gatcaacagc gacccgaaga 780

tcgtggagga ctggttcaac gacagctgta tccgcattgg caaacacctg cgcaaagtgt 840

gccgtttcat gaaggcatgg cgtgatgcac agtgggatgt gggtggcccg agtagcatta 900

gcctgatggc cgccaccgtt aacatcctgg atagcgttgc acatgatgcc agcgatctgg 960

gcgaaaccat gaagattatt gccaaacatc tgccgagtga atttgcccgc ggtgtggaga 1020

gcccggatag taccgacgaa aaaccgctgt ttccgcctag ctacaaacac ggcccgcgcg 1080

agatggacat catgagtaaa ctggagcgcc tgccggaaat tctgagcagc gccgaaagcg 1140

cagacagcaa aagcgaggcc ctgaagaaaa ttaacatggc ctttggcaat cgcgttacca 1200

acagcgaact gattgtgctg gcaaaggcac tgcctgcatt cgcccaagag ccgagtagcg 1260

ccagcaagcc ggaaaaaatc agcagcacca tggtgagcgg ttaa 1304

Claims

1. A method for preparing bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP, comprising: the same recombinant biological enzyme is adopted to catalyze and produce three second messenger molecules of bacterial c-di-GMP, c-di-AMP and 3 '3' -cGAMP respectively.

2. The method of claim 1, wherein: the recombinant biological enzyme is recombinant vibrio cholerae dinucleotide cyclase DncV, namely recombinant DncV enzyme.

3. The method according to claim 1 or 2, characterized in that: the recombinant vibrio cholerae dinucleotide cyclase DncV is prepared by a method comprising the following steps of:

2) introducing the recombinant expression vector pET-28a-SUMO-DncV obtained in the step 1) into escherichia coli Rosetta competent cells to obtain recombinant bacteria;

4) washing the cell precipitate obtained in step 3) with 50mL of 20mm tris-HCl buffer solution (pH 7.5) containing a protease inhibitor 3 times, then re-suspending the cell precipitate with 4 mm tris-Cl containing a protease inhibitor, repeatedly freezing and thawing for 3 times, and disrupting and lysing the cells using an ultrasonic cell disruptor;

4. A method as claimed in claim 3, characterized in that: in the step 7), the enzyme digestion reaction system is as follows: recombinant DncV enzyme 1000. mu.g, SUMO Protease Buffer 20. mu.L, SUMO Protease 2. mu.L, ddH₂O is constant volume to 1000 mu L;

5. The method according to any one of claims 1-4, wherein: the method for preparing the bacterial second messenger molecules c-di-GMP, c-di-AMP and 3 '3' -cGAMP comprises the following steps: catalyzing and synthesizing c-di-AMP by adopting a recombinant DncV enzyme through an in-vitro enzymatic reaction by taking ATP as a substrate;

3 '3' -cGAMP is catalytically synthesized by in vitro enzymatic reaction by using ATP and GTP as substrates and adopting recombinant DncV enzyme.

6. The method of claim 5, wherein: an enzymatic reaction system for the synthesis of c-di-AMP comprising: DncV 5. mu.M, HEPES 20mM, MgCl₂ 5mM，ATP 2mM，DEPC H₂O up to 1mL；

Wherein the concentration of DncV is 10.08 mg/mL.

7. The method of claim 6, wherein: the method comprises the following operations: preparing an enzymatic reaction system, incubating at 37 ℃ for 2h, adding nuclease Benzonase and bovine small intestine alkaline phosphatase, incubating at 37 ℃ for 30min, incubating the reaction product at 95 ℃ for 10min, placing at-20 ℃ for 24h, centrifuging at 4 ℃ and 16000g/min for 10min, taking the supernatant, and filtering the supernatant by using a 3kDa ultrafiltration centrifugal tube to obtain the reaction product.