CN113249452A

CN113249452A - Primer probe combination for detecting candida albicans echinocandin drug-resistant mutation target and application thereof

Info

Publication number: CN113249452A
Application number: CN202110756310.6A
Authority: CN
Inventors: 李姝丽; 王志贤; 张傲; 白雪秋; 阎香言; 吴秀祯; 盛长忠; 粟艳; 周泽
Original assignee: Dynamiker Biotechnology Tianjin Co Ltd
Current assignee: Dynamiker Biotechnology Tianjin Co Ltd
Priority date: 2021-07-05
Filing date: 2021-07-05
Publication date: 2021-08-13

Abstract

The invention provides a primer probe combination for detecting candida albicans echinocandin drug-resistant mutation targets and application thereof. The primer probe combination comprises a first primer pair for amplifying mutation sites F641S and S645P, a second primer pair for amplifying mutation sites R1361H and corresponding Taqman detection probes for detecting three mutation targets. The detection method constructed by the combination of the primer and the probe is combined with the analysis of a dissolution curve, and the mutation condition of the drug-resistant mutation target spot of the candida albicans echinocandin in the sample to be detected can be judged by using the melting point of the detection probe.

Description

Primer probe combination for detecting candida albicans echinocandin drug-resistant mutation target and application thereof

Technical Field

The invention belongs to the field of molecular biological detection of fungi, and particularly relates to a primer probe combination for detecting candida albicans echinocandin drug-resistant mutation targets and application thereof.

Background

The echinocandin medicine is taken as an antifungal medicine, comprises caspofungin, micafungin, anidulafungin and the like, shows good bactericidal activity on candida, has small toxic and side effects compared with other antifungal medicines, and becomes a good choice when clinical conventional fungal medication fails to treat based on the good antibacterial activity of the medicine. However, as the application time is prolonged and the application range is expanded, different resistance mechanisms also appear to result in a decrease in the anti-candida activity.

Candida albicans (also called Candida albicans) is usually present in the oral cavity, upper respiratory tract, intestinal tract and vagina of normal people, is small in quantity in normal organisms and does not cause diseases, and when the immune function or general defense of the organisms is reduced or the mutual restriction and interaction of normal flora are disordered, the Candida albicans (Candida albicans) is propagated in large quantity and changes the growth form (budding hyphal phase) to invade cells to cause diseases.

The gene mutation of candida albicans which generates resistance to echinocandin drugs occurs mainly between two hot spot regions (hot spots regions) amino acid residues 641 to 649(hot spots regions 1, HS1) and between residues 1345 to 1365(hot spots regions 2, HS2) of gene FKS1 (also called GSC1 gene) which encodes β -1, 3-D-glucan synthase, resulting in reduced affinity to such drugs and thus generation of resistance. Among them, the most common mutation sites in the clinic are FKS 1F 641S and FKS 1S 645F, and result in the most significant resistance phenotype.

At present, most of candida albicans drug resistance gene detection methods are culture-based fungal drug sensitivity test methods, but the fungus culture method has long separation period, complicated process and easy pollution, and is not beneficial to early rapid diagnosis. Therefore, the development of a kit and a detection method for detecting the drug-resistant genes of the candida albicans echinocandin is an urgent problem to be solved in the field.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide a primer probe for simultaneously detecting 3 mutant targets of echinocandin drug-resistance related gene FKS1 of candida albicans strain, and a detection method and a PCR kit are constructed according to the primer probe. Compared with the prior art, the method provided by the invention does not need a culture step, directly utilizes the collected sample as a detection material, determines whether the mutation is the drug resistance mutation by one-time detection, simultaneously locks the drug resistance mutation target point, is rapid and accurate, and provides powerful support for clinical treatment and the like.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a primer probe combination for detecting candida albicans echinocandin drug-resistant mutation targets, wherein the primer probe combination comprises a first primer pair, a second primer pair, a first detection probe, a second detection probe and a third detection probe;

wherein the first detection probe comprises a nucleotide sequence shown as SEQ ID NO.1, and a detection mutation site F641S is applied; the second detection probe comprises a nucleotide sequence shown as SEQ ID NO.2, and a detection mutation site S645P is applied; the third detection probe comprises a nucleotide sequence shown as SEQ ID NO.3, and is used for detecting a mutation site R1361H.

The primer probe combination provided by the invention is used for detecting 3 mutant targets of the candida albicans echinocandin drug resistance related gene FKS1, is reasonable in design, can accurately amplify a target region without omission, and does not affect each other; in the primer probe combination, the specially designed Taqman probe can be used for analyzing and identifying a dissolution curve, and further, whether a target region is mutated or not is judged according to the change of the dissolution curve, so that the mutation condition of a target object to be detected is obtained. According to the method for constructing the primer probe combination, whether the candida albicans in the sample to be detected is echinocandin drug-resistant mutation or not can be obtained by directly taking the collected sample as a detection material without culturing, and meanwhile, a drug-resistant mutation target point is locked.

Likewise, as a further improvement of the present invention, the coverage of drug resistance detection can be increased by further increasing the number of target spots. However, in the design of the primer probes, the primer probes should be ensured not to be affected with each other, and the accuracy of the result should be ensured.

It should be noted that the "sample" or "test material" as used herein refers to a substance to be tested for the drug-resistant mutant target of the candida albicans echinocandin class, and can be derived from an individual (e.g., human or animal), or from other sources, such as some treated or untreated laboratory materials, or artificially synthesized test products. It will be appreciated that the detection of a "sample" or "test material" is not solely directed to diagnostic or therapeutic purposes, but may be directed to other non-diagnostic or therapeutic purposes.

As a preferred technical scheme of the invention, the first primer pair is used for amplifying a mutation site F641S and a mutation site S645P, the upstream primer comprises a nucleotide sequence shown as SEQ ID NO.4, and the downstream primer comprises a nucleotide sequence shown as SEQ ID NO. 5;

preferably, the second primer pair is used for amplifying the mutation site R1361H, the upstream primer of the second primer pair comprises the nucleotide sequence shown as SEQ ID NO.6, and the downstream primer of the second primer pair comprises the nucleotide sequence shown as SEQ ID NO. 7. The nucleotide sequences are shown in the following table 1:

TABLE 1 nucleotide sequence

As a preferred technical scheme of the invention, the detection probe is a Taqman probe and carries a fluorescent group and a quenching group.

Preferably, the fluorophore comprises any one of ALEX-350, Alexa Fluor 488, CY3, FAM, VIC, TET, CALCEL 540, JOE, HEX, CALCFLUOROrange 560, TAMRA, CALCFLUORRed 590, ROX, CALCFLUORRed 610, TexasRed, CALCFluORRed 635, Quasar670, CY5, CY5.5, LC RED640, or Quasar705, or a combination of at least two thereof.

Preferably, the quencher group comprises any one of TAMRA, DABCYL, BHQ-1, BHQ-2, BHQ-3 or Eclipse or a combination of at least two thereof.

In a second aspect, the invention provides a method for detecting drug-resistant mutant targets of candida albicans echinocandin based on a probe dissolution curve method, which comprises the following steps:

(1) synthesizing a primer probe combination as described in the first aspect;

(2) carrying out real-time fluorescent quantitative PCR amplification reaction on a sample to be detected by using the primer probe combination;

(3) and (3) carrying out dissolution curve analysis after the real-time fluorescent quantitative PCR amplification reaction, and judging the mutation condition of the candida albicans echinocandin drug-resistant mutation target in the sample to be detected according to the melting point of the detection probe.

The invention provides a candida albicans echinocandin drug-resistant multiplex PCR detection method based on probe dissolution curve analysis, wherein a primer probe combination can carry out single-fold, multiple-fold single-color and multiple-fold multicolor real-time fluorescence quantitative PCR amplification reaction on a specific target; and then, the multiple detection of 3 common candida albicans echinocandin drug-resistant targets is realized by analyzing and identifying a specially designed Taqman probe dissolution curve.

As a preferred technical scheme of the invention, the real-time fluorescent quantitative PCR amplification reaction in the step (2) is an asymmetric real-time fluorescent quantitative PCR amplification reaction.

Preferably, the concentration of each upstream primer in the primer probe combination is the same or different, and the concentration of the upstream primer is 50-500 nM, such as 50nM, 80nM, 100nM, 150nM, 200nM, 250nM, 300nM, 350nM, 400nM, 450nM or 500nM, etc.

Preferably, the concentration of each downstream primer in the primer probe combination is the same or different, and the concentration of the downstream primer is 0.5-25 μ M, for example, 0.5 μ M, 0.8 μ M, 1 μ M, 5 μ M, 10 μ M, 15 μ M, 20 μ M, or 25 μ M.

In the invention, multiple asymmetric PCR is adopted to simultaneously amplify different target gene sequences of the candida echinocandin drug-resistant mutant gene FKS1, in the primer probe combination, the concentration difference of the upper primer and the lower primer is the key of amplification, and the concentration difference is too high or too low to be beneficial to the amplification.

Preferably, the concentration ratio of the upstream primer to the downstream primer of each primer pair in the primer probe combination is 1 (10-50), and may be, for example, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1: 50.

Preferably, the concentration of each probe in the probe combination is the same or different, and the concentration of each probe is 50-500 nM, such as 50nM, 80nM, 100nM, 150nM, 200nM, 250nM, 300nM, 350nM, 400nM, 450nM or 500nM, etc.

As a further improvement of the present invention, the yield of the target fragment complementary to the probe can be increased by further increasing the ratio of the upstream primer to the downstream primer, and the signal of the melting curve can be amplified.

Preferably, the reaction conditions of the real-time fluorescent quantitative PCR amplification reaction include:

the first stage, heating at 95 ℃ for 10 min; second stage, 10s at 95 ℃, 40s of extension at 55 ℃, collecting fluorescence signals during extension, and performing 45 cycles; in the third stage, the temperature is raised from 35 ℃ to 95 ℃, and fluorescence signals are continuously collected for 5 times/DEG C;

preferably, the results of the dissolution curve analysis of step (3) are as follows:

F641S target point, the wild type dissolution temperature range is 66.0-67.0 ℃, the mutant type dissolution temperature range is 64.0-65.0 ℃, and the difference range of the wild type dissolution temperature and the mutant type dissolution temperature is 1-3 ℃;

S645P target point, the wild type dissolution temperature range is 64.0-65.0 ℃, the mutant type dissolution temperature range is 62.5-63.5 ℃, and the difference range of the wild type and mutant type dissolution temperatures is 0.5-2.5 ℃;

the R1361H target point has wild type dissolving temperature range of 62.0-63.0 deg.c, mutant type dissolving temperature range of 56.0-57.0 deg.c and wild type and mutant type dissolving temperature difference range of 5-7 deg.c.

In a third aspect, the invention further provides a kit for detecting the drug-resistant mutant target of the candida albicans echinocandin based on a probe dissolution curve method, wherein the kit comprises the primer probe combination in the first aspect.

Preferably, the kit further comprises a negative control and a positive control.

Preferably, the negative control comprises: a plasmid containing a wild-type Candida albicans DNA fragment for detecting a target sequence.

Preferably, the positive quality control comprises: plasmids containing F641S and S645P gene mutant DNA sequences and plasmids containing R1361H gene mutant DNA sequences.

Preferably, the molar ratio of the plasmid containing the F641S and S645P gene mutant DNA sequences to the plasmid containing the R1361H gene mutant DNA sequence is 1 (0.5-1.5), and can be, for example, 1:0.5, 1:0.6, 1:0.7, 1:0.8, 1:0.9, 1:1.0, 1:1.1, 1:1.2, 1:1.3, 1:1.4 or 1:1.5, and preferably 1:1.

Preferably, the kit also comprises a quality control product and a PCR reaction solution.

Preferably, the quality control product comprises a primer pair and a probe, wherein the primer pair comprises nucleotide sequences shown as SEQ ID NO.8 and SEQ ID NO.9, and the probe comprises a nucleotide sequence shown as SEQ ID NO. 10.

Preferably, the PCR reaction solution comprises Taq polymerase, dNTP and MgCl₂DMSO and buffer.

Preferably, the final concentration of the Taq polymerase is 0.5-5U, for example, 0.5U, 0.8U, 1U, 1.2U, 1.5U, 1.8U, 2U, 2.5U, 3U, 3.5U, 4U, 4.5U or 5U.

Preferably, the dNTP has a final concentration of 0.1-5 mM, such as 0.1mM, 0.3mM, 0.5mM, 0.8mM, 1mM, 1.2mM, 1.5mM, 1.8mM, 2mM, 2.5mM, 2.8mM, 3mM, 3.5mM, 4mM, 4.5mM, 4.8mM, or 5 mM.

Preferably, the MgCl₂The final concentration of (A) is 0.8 to 10mM, and may be, for example, 0.8mM, 1mM, 1.2mM, 1.5mM, 1.8mM, 2mM, 2.5mM, 3mM, 3.5mM, 4mM, 4.5mM, 5mM, 5.5mM, 6mM, 6.5mM, 7mM, 7.5mM, 8mM, 8.5mM, 9mM, 9.5mM, or 10 mM.

Preferably, the DMSO accounts for 1 to 15% by mass, and may be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%, for example.

Preferably, the buffer comprises Tris-HCl and KCl.

Preferably, the concentration of Tris-HCl in the buffer is 15-20 mM, such as 15mM, 16mM, 17mM, 18mM, 19mM or 20 mM.

Preferably, the concentration of KCl in the buffer is 100-200 mM, and can be 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM or 200mM, for example.

In the present invention, the final concentration of the template in the reaction system may be 0.1pg to 10ng, and may be, for example, 0.1pg, 0.5pg, 1pg, 2pg, 3pg, 4pg, 5pg, 10pg, 20pg, 30pg, 40pg, 50pg, 60pg, 70pg, 80pg, 90pg, 100pg, 200pg, 300pg, 400pg, 500pg, 600pg, 700pg, 800pg, 900pg, 1ng, 2ng, 5ng, 6ng, 7ng, 8ng, 9ng or 10ng, preferably 0.5ng to 2 ng.

In the present invention, the PCR reaction system may be as shown in table 2 below, and then a single, multiple single color, or multiple multi-color real-time fluorescent quantitative PCR amplification reaction is performed on the PCR reaction system.

TABLE 2 PCR reaction System

Components	Dosage form
		Taq polymerase	0.5-5U
dNTP	0.1-5mM
		Upstream primer	50～500nM×N
Downstream primer	0.5～25μM×N
		Probe mixture	50-500nM×N
MgCl₂	0.8-10mM
		Form panel	0.1pg-10ng
DMSO	1-15wt％
		Total volume	10-100μL

Wherein N represents the number of primers or the number of probes.

In a fourth aspect, the present invention also provides a primer probe combination as described in the first aspect, a method as described in the second aspect or a kit as described in the third aspect, for use in candida albicans drug-resistant mutation target detection or candida albicans typing.

The recitation of numerical ranges herein includes not only the above-recited values, but also any values between any of the above-recited numerical ranges not recited, and for brevity and clarity, is not intended to be exhaustive of the specific values encompassed within the range.

Compared with the prior art, the invention has the beneficial effects that:

(1) the primer probe combination and the detection kit provided by the invention are used for detecting 3 mutant targets of the candida albicans echinocandin drug resistance related gene FKS1, the primer probe combination is reasonable in design, and target areas can be amplified accurately and seamlessly without omission, and mutual influence is avoided; in the invention, excessive Taqman probes are added into a reaction system, and the remaining probes after amplification and amplification products are used for carrying out dissolution curve analysis, so that drug-resistant mutation targets of various Candida albicans can be simultaneously analyzed and detected, and specific target sequences of drug-resistant mutation of various Candida albicans can be distinguished in the same reaction system according to the change of the melting point of the Taqman probes; meanwhile, the dissolution curve analysis belongs to non-consumable detection, after the analysis is finished, the sample keeps the state after PCR, and can be repeatedly analyzed for many times, for the object to be detected with a small sample amount, the method effectively avoids the step of cell culture, and improves the detection efficiency;

(2) the detection method provided by the invention utilizes a molecular biological method, firstly amplifies a specific pathogen nucleic acid fragment by a PCR technology, detects the detection fragment by utilizing a specific probe with a fluorescent signal, and judges whether the pathogen in a detection sample has gene mutation or not by detecting a Tm value of a dissolution curve; meanwhile, the dissolution curve analysis can be directly carried out after the real-time fluorescent PCR amplification reaction without opening the tube, and can also be transferred to a real-time fluorescent PCR instrument for analysis after the common PCR is amplified; therefore, the method has simple steps, high accuracy and high detection efficiency, and has wide application prospects in the fields of clinical analysis, identification, typing and the like of candida albicans echinocandin drug-resistant mutation.

Drawings

FIG. 1 is a dissolution profile of F641S target wild type and mutant.

Fig. 2 is a dissolution profile of S645P for the wild type and mutant target.

FIG. 3 is a dissolution profile of the R1361H target corresponding to wild type and mutant.

Detailed Description

The technical solutions of the present invention are further described in the following embodiments with reference to the drawings, but the following examples are only simple examples of the present invention and do not represent or limit the scope of the present invention, which is defined by the claims.

In the following examples, reagents and consumables used were obtained from conventional reagent manufacturers in the field unless otherwise specified; unless otherwise indicated, all experimental methods and technical means are conventional in the art.

Example 1

The embodiment provides a primer probe combination for detecting an echinocandin drug-resistant mutant target of candida albicans, wherein the primer probe combination comprises a first primer pair, a second primer pair, a first detection probe, a second detection probe and a third detection probe.

In the embodiment, in common gene mutation causing drug resistance of candida albicans echinocandin, 3 mutation hotspots of two hotspot mutation regions are selected as detection targets, namely F641S (the corresponding nucleotide mutation site is T1922C) and S645P (the corresponding nucleotide mutation site is T1933C) of an HS1 region; R1361H (the corresponding nucleotide mutation site is G4082A) of HS2 region.

Designing and preparing 3 Taqman probes aiming at 3 targets, and simultaneously respectively designing a pair of primer sequences at the periphery according to the probe sequences, wherein the primer sequences comprise an upstream primer and a downstream primer; and the two probes of the F641S and S645P targets share a pair of primer sequences.

Wherein the first detection probe (SEQ ID NO.1) is used for detecting the mutation site F641S:

5'-CCAAATTGGTTGAATCTTATTTCTTCT-3'；

the second detection probe (SEQ ID NO.2) was used to detect the mutation site S645P:

S645P with a target probe of 5'-TGTCTTTAAGAGATCCTATTAGAAAC-3';

the third detection probe (SEQ ID NO.3) is used for detecting a mutation site R1361H;

the R1361H target probe was 5'-TGATTGGATTAGACGTTATACTTTGTCT-3'.

The first primer pair is used for amplifying a mutation site F641S and a mutation site S645P, and the upstream primer (SEQ ID NO.4) of the first primer pair is 5'-gtggatgtcttatttgtta-3';

the downstream primer (SEQ ID NO.5) is 5'-cttggtttctacaaacaa-3';

the second primer pair is used for amplifying a mutation site R1361H, and an upstream primer (SEQ ID NO.6) of the second primer pair is 5'-ggtgttggctaacttgaa-3';

the downstream primer (SEQ ID NO.7) was 5'-caaccaatggaatgaaagaaa-3'.

Example 2

This example uses the primer probe combination provided in example 1 to construct an asymmetric fluorescent quantitative PCR amplification system. The asymmetric fluorescent quantitative PCR amplification system is shown in Table 3:

TABLE 3 asymmetric fluorescent quantitative PCR amplification system

Components	Dosage form
		Taq polymerase	2U
dNTP	0.2mM
		Primers Primers (2 upstream Primers)	200nM×2
Primers Primers (2 downstream Primers)	2μM×2
		Probes (3 strips)	100nM×3
MgCl₂	3mM
		Tris-HCl	15mM
Form panel	2ng
		DMSO	5wt％
Total volume	25μL

In addition, an internal quality control product is also added into the amplification system, the internal quality control product comprises an upstream primer, a downstream primer and a corresponding probe which are internally controlled, the concentrations are respectively 200nM, 2 muM and 100nM, and the specific sequences are as follows:

the internal control forward primer (SEQ ID NO.8) is 5'-CTGTGAATGCCATTTCTC-3';

the internal control downstream primer (SEQ ID NO.9) is 5'-ACACCTCCTTTGGAATAG-3';

the internal control probe (SEQ ID NO.10) is 5'-CCTAACCTACCCGCCTTGGATATT-3';

when the reaction system is used for detecting a sample to be detected, the template is the sample to be detected;

when the reaction system is used for detecting the positive reference substance and the negative reference substance, the template is replaced by the corresponding reference substance.

The positive control comprises plasmid PUC57-F641S/S645P containing F641S and S645P gene mutant DNA sequences and plasmid PUC57-R1361H containing R1361H gene mutant DNA sequences.

The sequence (SEQ ID NO.11) of the F641S and S645P gene-containing mutant gene fragment is shown as follows:

TCGAAATCGGCATATGCTGTGTCGATTGTTGGATTTTTCATTGCTGTGGCCACTTTAGTATTCTTTGCCGTCATGCCATTGGGTGGTTTATTCACTTCATACATGAACAAGAGATCAAGAAGATATATTGCATCACAAACATTTACTGCCAACTACATTAAATTGAAAGGTTTAGATATGTGGATGTCTTATTTGTTATGGTTTTTGGTTTTCCTTGCCAAATTGGTTGAATCTTATTTCTCCTTGACTTTGCCTTTAAGAGATCCTATTAGAAACTTGTCGACCATGACAATGAGATGTGTTGGTGAAGTTTGGTACAAAGATATTGTTTGTAGAAACCAAGCCAAGATTGTCTTGGGGTTGATGTATCTTGTTGATTTGTTATTGTTCTTTTTGGATACTTATATGTGGTACATTATTTGTAACTGTATCTTCTCCATTGGTCGTTCATTCTATTTGGGTATTTCCATTTTGACTCCT

the sequence (SEQ ID NO.12) of the R1361H gene-containing mutant gene fragment is as follows:

TATTTGGGTACTCAACTTCCATTGGATAGATTTTTGTCATTTTACTATGGTCATCCAGGTTTCCATATTAATAACTTGTTTATTCAATTGTCTTTACAAGTGTTTATTTTGGTGTTGGCTAACTTGAATTCATTAGCTCATGAAGCTATCATGTGTTCTTACAACAAAGATGTCCCAGTTACTGATGTTTTGTATCCATTTGGTTGTTACAATATTGCTCCTGCCGTTGATTGGATTAGACATTATACTTTGTCTATTTTCATTGTTTTCTTCATTTCTTTCATTCCATTGGTTGTACAAGAATTGATTGAAAGAGGGGTATGGAAAGCGTTCCAAAGATTTGTTAGACATTTTATTTCCATGTCACCATTTTTCGAAGTTTTCGTTGCCCAAATTTATTCATCATCGGTTTTCACTGATTTGACCGTTGGTGGTGCTAGATATATTTCCACTGGTAGAGGTTTTGCCACTTCAAGAATT。

the negative control is plasmid PUC57-FKS1 containing a wild type Candida albicans ATCC 90028DNA fragment detecting a sequence of a target gene FKS1 (GenBank: GQ 456066.1).

By the asymmetric fluorescent quantitative PCR amplification system, drug-resistant mutant targets of candida albicans echinocandin in a sample to be detected can be amplified and detected; and (3) analyzing by combining a dissolution curve after amplification, and judging whether the gene mutation exists in the sample to be detected according to the change of the melting point of the Taqman probe.

Example 3

In this embodiment, the asymmetric fluorescent quantitative PCR amplification system constructed in example 2 is used to amplify and detect the dissolution curve of the sample to be detected.

The specific reaction process is as follows:

the first stage is as follows: pre-denaturation at 95 ℃ for 10 min; 1 cycle;

and a second stage: denaturation at 95 ℃ for 10 s; extending at 55 ℃ for 40s, collecting fluorescence signals during extension, and performing 45 cycles;

and a third stage: 1min at 95 ℃ and 2min at 35 ℃; the temperature is increased from 35 ℃ to 95 ℃ and 0.2 ℃/s, and the fluorescence signal is continuously collected for 5 times/DEG C.

The corresponding lysis temperatures of the F641S target wild type and the mutant are shown in figure 1, the lysis temperatures of the S645P target wild type and the mutant are shown in figure 2, and the lysis temperatures of the R1361H target wild type and the mutant are shown in figure 3.

The Tm values obtained by detecting samples having different drug-resistant gene mutations by the above-mentioned method are shown in Table 4 below.

TABLE 4 comparison of drug-resistant mutant targets of different Candida albicans echinocandin and Tm values thereof

In conclusion, the invention provides a method for detecting the drug-resistant mutant target of candida albicans echinocandin by using molecular biology. Firstly, extracting pathogen nucleic acid in a detection sample, amplifying a specific pathogen nucleic acid fragment by a PCR (polymerase chain reaction) technology, detecting the detection fragment by using a specific probe with a fluorescent signal, and judging whether the pathogen in the detection sample has gene mutation or not by detecting a Tm (melting point) value of a dissolution curve; the detection method has wide application range and wide application prospect in the fields of clinical analysis, identification, typing and the like.

The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Dana (Tianjin) Biotechnology Ltd

<120> primer probe combination for detecting candida albicans echinocandin drug-resistant mutation target spot and application thereof

<130> 20210617

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 27

<212> DNA

<213> Artificial Synthesis

<400> 1

ccaaattggt tgaatcttat ttcttct 27

<210> 2

<211> 26

<212> DNA

<213> Artificial Synthesis

<400> 2

tgtctttaag agatcctatt agaaac 26

<210> 3

<211> 28

<212> DNA

<213> Artificial Synthesis

<400> 3

tgattggatt agacgttata ctttgtct 28

<210> 4

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 4

gtggatgtct tatttgtta 19

<210> 5

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 5

cttggtttct acaaacaa 18

<210> 6

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 6

ggtgttggct aacttgaa 18

<210> 7

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 7

caaccaatgg aatgaaagaa a 21

<210> 8

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 8

ctgtgaatgc catttctc 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 9

acacctcctt tggaatag 18

<210> 10

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 10

cctaacctac ccgccttgga tatt 24

<210> 11

<211> 480

<212> DNA

<213> Artificial Synthesis

<400> 11

tcgaaatcgg catatgctgt gtcgattgtt ggatttttca ttgctgtggc cactttagta 60

ttctttgccg tcatgccatt gggtggttta ttcacttcat acatgaacaa gagatcaaga 120

agatatattg catcacaaac atttactgcc aactacatta aattgaaagg tttagatatg 180

tggatgtctt atttgttatg gtttttggtt ttccttgcca aattggttga atcttatttc 240

tccttgactt tgcctttaag agatcctatt agaaacttgt cgaccatgac aatgagatgt 300

gttggtgaag tttggtacaa agatattgtt tgtagaaacc aagccaagat tgtcttgggg 360

ttgatgtatc ttgttgattt gttattgttc tttttggata cttatatgtg gtacattatt 420

tgtaactgta tcttctccat tggtcgttca ttctatttgg gtatttccat tttgactcct 480

<210> 12

<211> 480

<212> DNA

<213> Artificial Synthesis

<400> 12

tatttgggta ctcaacttcc attggataga tttttgtcat tttactatgg tcatccaggt 60

ttccatatta ataacttgtt tattcaattg tctttacaag tgtttatttt ggtgttggct 120

aacttgaatt cattagctca tgaagctatc atgtgttctt acaacaaaga tgtcccagtt 180

actgatgttt tgtatccatt tggttgttac aatattgctc ctgccgttga ttggattaga 240

cattatactt tgtctatttt cattgttttc ttcatttctt tcattccatt ggttgtacaa 300

gaattgattg aaagaggggt atggaaagcg ttccaaagat ttgttagaca ttttatttcc 360

atgtcaccat ttttcgaagt tttcgttgcc caaatttatt catcatcggt tttcactgat 420

ttgaccgttg gtggtgctag atatatttcc actggtagag gttttgccac ttcaagaatt 480

Claims

1. A primer probe combination for detecting candida albicans echinocandin drug-resistant mutation targets is characterized in that the primer probe combination comprises a first primer pair, a second primer pair, a first detection probe, a second detection probe and a third detection probe;

wherein the first detection probe comprises a nucleotide sequence shown as SEQ ID NO.1 and is used for detecting a mutation site F641S;

the second detection probe comprises a nucleotide sequence shown as SEQ ID NO.2 and is used for detecting a mutation site S645P;

the third detection probe comprises a nucleotide sequence shown as SEQ ID NO.3 and is used for detecting a mutation site R1361H.

2. The primer probe combination of claim 1, wherein the first primer pair is used for amplifying mutation site F641S and mutation site S645P, wherein the upstream primer comprises the nucleotide sequence shown in SEQ ID No.4, and the downstream primer comprises the nucleotide sequence shown in SEQ ID No. 5;

preferably, the second primer pair is used for amplifying the mutation site R1361H, the upstream primer of the second primer pair comprises the nucleotide sequence shown as SEQ ID NO.6, and the downstream primer of the second primer pair comprises the nucleotide sequence shown as SEQ ID NO. 7.

3. The primer-probe combination of claim 1 or 2, wherein the detection probe carries a fluorescent group and a quencher group;

preferably, the fluorophore comprises any one or a combination of at least two of ALEX-350, Alexa Fluor 488, CY3, FAM, VIC, TET, CALGold540, JOE, HEX, CALFluorOrange560, TAMRA, CALFluorRed590, ROX, CALFluorRed610, TexasRed, CALFluorRed635, Quasar670, CY5, CY5.5, LC RED640, or Quasar 705;

4. A method for detecting candida albicans echinocandin drug-resistant mutation targets based on a probe dissolution curve method is characterized by comprising the following steps:

(1) synthesizing a primer probe combination according to any one of claims 1 to 3;

5. The method according to claim 4, wherein the real-time quantitative fluorescence PCR amplification reaction of step (2) is an asymmetric real-time quantitative fluorescence PCR amplification reaction;

preferably, the concentration of each upstream primer in the primer probe combination is the same or different, and the concentration of each upstream primer is 50-500 nM;

preferably, the concentration of each downstream primer in the primer probe combination is the same or different, and the concentration of the downstream primer is 0.5-25 mu M;

preferably, the concentration ratio of the upstream primer to the downstream primer of each primer pair in the primer probe combination is 1 (10-50);

preferably, the concentration of each probe in the probe combination is the same or different, and the concentration of each probe is 50-500 nM.

6. The method of claim 4 or 5, wherein the reaction conditions of the real-time fluorescent quantitative PCR amplification reaction comprise:

7. A kit for detecting candida albicans echinocandin drug-resistant mutation targets based on a probe dissolution curve method, wherein the kit comprises the primer probe combination according to any one of claims 1-3.

8. The kit of claim 7, further comprising a negative control and a positive control;

preferably, the negative control comprises: a plasmid containing a wild type Candida albicans DNA fragment for detecting a target sequence;

preferably, the positive control comprises: plasmids containing F641S and S645P gene mutant DNA sequences and plasmids containing R1361H gene mutant DNA sequences;

preferably, the molar ratio of the plasmid containing the F641S and S645P gene mutant DNA sequences to the plasmid containing the R1361H gene mutant DNA sequence is 1 (0.5-1.5), preferably 1:1.

9. The kit according to claim 7, wherein the kit further comprises a quality control material and a PCR reaction solution;

preferably, the quality control product comprises a primer pair and a probe, wherein the primer pair comprises nucleotide sequences shown as SEQ ID NO.8 and SEQ ID NO.9, and the probe comprises a nucleotide sequence shown as SEQ ID NO. 10;

10. Use of a primer probe combination according to any one of claims 1 to 3, a method according to any one of claims 4 to 6 or a kit according to any one of claims 7 to 9 for drug-resistant mutant target detection or typing of Candida albicans.