CN113249438B - DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard - Google Patents
DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard Download PDFInfo
- Publication number
- CN113249438B CN113249438B CN202110472989.6A CN202110472989A CN113249438B CN 113249438 B CN113249438 B CN 113249438B CN 202110472989 A CN202110472989 A CN 202110472989A CN 113249438 B CN113249438 B CN 113249438B
- Authority
- CN
- China
- Prior art keywords
- molecular weight
- weight standard
- dna molecular
- primer
- stranded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention relates to a DNA molecular weight standard fragment amplification single-stranded primer, an amplification method and a preparation method of DNA molecular weight standard. The 3' end of the single-chain primer is provided with a palindromic sequence, and the palindromic sequence can be used as an upstream primer, a downstream primer and a template, so that the problem that template residues are easy to occur in the amplification process by adopting separate templates and primers in the prior art is solved, and the high-efficiency purification after amplification is facilitated; the single-chain primer is suitable for small fragment amplification of 50-100bp in a DNA marker, so that the amplification cost is reduced, and the efficiency is improved; the preparation method can improve the large-scale production efficiency of the DNA marker and effectively reduce the cost.
Description
Technical Field
The invention relates to the field of gene amplification, in particular to a DNA molecular weight standard amplification fragment single-stranded primer, an amplification method and a preparation method of DNA molecular weight standard.
Background
The DNA molecular weight standard is also called DNA marker, and is a mixed reagent of a series of DNA fragments with different molecular weights. In the field of molecular science, a DNA marker is a reagent for calibrating the molecular weight of a DNA fragment to be detected; the specific calibration method comprises the steps of carrying out electrophoresis on a DNA marker and a DNA fragment to be detected on the same piece of agarose gel, forming strips (ladders) with gradient distribution on the fragments with different lengths in the DNA marker, and comparing the strips of the DNA fragment to be detected with the DNA ladders to obtain the corresponding lengths of the strips. In a commonly used DNA marker, the minimum DNA length is 100bp, such as DL2000, which includes 6 DNA fragments with different lengths, respectively 100bp, 250bp, 500bp, 750bp, 1kb and 2 kb; some DNA markers also include DNA fragments of 50bp in length.
In molecular biology experiments, because a DNA marker is an essential reagent which is widely used and consumed, the requirements for amplification and preparation of the DNA marker are great.
In the prior art, two methods are mainly used for preparing a DNA marker, namely PCR amplification and enzyme digestion of plasmids. The PCR amplification is mainly based on the principle of designing a primer, amplifying the template DNA according to the required length, purifying the amplified template DNA, and finally mixing the obtained different DNA fragments; the main principle of plasmid digestion is to design a pair of primers, and to amplify a DNA fragment by using lambda DNA or other DNAs as templates.
However, for small fragments of the DNA marker, especially for 100bp DNA, the cost of the PCR amplification method is high due to the small fragment length, and the method of enzyme digestion of plasmid is often used to amplify non-specific bands and the template has residues, which is not favorable for subsequent purification and large-scale production.
Disclosure of Invention
The invention aims to solve the technical problem of providing a DNA molecular weight standard fragment amplification single-stranded primer, an amplification method and a preparation method of DNA molecular weight standard.
The technical scheme for solving the technical problems is as follows:
the invention provides a single-stranded primer for amplifying DNA molecular weight standard, wherein a palindromic sequence is arranged at the 3' end of the single-stranded primer.
Furthermore, in the palindromic sequence, the sum of the number of guanine and cytosine accounts for 40-60% of the total base amount of the palindromic sequence.
Furthermore, in the palindromic sequence, the sum of the number of guanine and cytosine accounts for 45% -55% of the total base amount of the palindromic sequence.
Further, the length of the DNA molecular weight standard fragment is 100bp, the total length of the single-stranded primer is a, the length of the palindromic sequence is b, and 2 a-b is 100 bp; wherein, the range of a is 60bp to 90bp, and the range of b is 20bp to 80 bp.
Further, the total length of the single-stranded primer is 60bp, and the length of the palindromic sequence is 20 bp.
Further, the sequence of the single-stranded primer is shown as SEQ ID No: 1 is shown.
The invention provides an amplification method of a DNA molecular weight standard, which adopts the single-stranded primer for amplifying the DNA molecular weight standard fragment to amplify, wherein the single-stranded primer is used as a primer and a template at the same time.
Further, in the first round of the amplification process, palindromic sequences at the 3 'ends of the two single-stranded primers are subjected to complementary annealing, each single-stranded primer corresponding to each single-stranded primer is taken as a template, the single-stranded primer is extended towards the 5' end of the single-stranded primer corresponding to each single-stranded primer, and a double-stranded DNA molecular weight standard fragment is formed after the extension is finished; after the first round of the amplification process, continuing to perform a second round of amplification, wherein the single-stranded primers which are not complementarily extended in the first round continue to the first round of amplification process, and the other part of the single-stranded primers continue to be extended by using the double-stranded DNA molecular weight standard fragment obtained in the first round as a template.
Further, the amplification method adopts a PCR mix amplification method.
The invention provides a preparation method of DNA molecular weight standard, which comprises the step of amplifying at least two DNA molecular weight standard fragments with different lengths and then quantitatively mixing the amplified DNA molecular weight standard fragments, wherein at least one DNA molecular weight standard fragment is amplified by the method for amplifying the DNA molecular weight standard fragment.
The invention has the beneficial effects that:
1) the single-stranded primer can be used as an upstream primer, a downstream primer and a template by arranging the palindromic sequence at the 3' end of the single-stranded primer, so that the problem that the template residue is easy to occur in the amplification process by adopting the single template and the primer in the prior art is solved, and the high-efficiency purification after the amplification is facilitated;
2) the single-chain primer disclosed by the invention is completely suitable for the amplification of small fragments in a DNA marker by limiting the length of a palindromic sequence and the total length of the primer, so that the amplification cost is reduced, and the efficiency is improved;
3) the amplification method can efficiently and accurately amplify small fragments of 100bp in the DNA marker, and effectively avoid the occurrence of nonspecific strips;
4) the DNA marker prepared by the preparation method can be suitable for large-scale high-efficiency production, and the cost of the DNA marker reagent is effectively reduced.
Drawings
FIG. 1 is a schematic representation of a first round of amplification in an embodiment of the invention;
FIG. 2 is a diagram showing a double-stranded DNA obtained after the first round of amplification in an example of the present invention;
FIG. 3 is an electrophoretogram of an amplification product in an example of the present invention.
Detailed Description
The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.
The 3' end of the single-stranded primer for DNA molecular weight standard fragment amplification is provided with a palindromic sequence, and in the base sequence of the palindromic sequence, the sum of the number of guanine G and cytosine C accounts for 40-60% of the total base amount of the palindromic sequence; by arranging a palindromic sequence at the 3 'end and defining the GC content therein, the single-stranded primer can realize self-annealing complementation, thereby realizing the extension of DNA at the 3' end.
Preferably, in the palindromic sequence, the sum of the number of guanine G and cytosine C in the base sequence accounts for 45-55% of the total number of bases in the palindromic sequence.
More preferably, in the base sequence of the palindromic sequence, the sum of the number of guanine G and cytosine C accounts for 50% of the total number of bases in the palindromic sequence; at the same annealing temperature, e.g., 55 ℃, GC content is uniform to favor complementary annealing, GC content is low, annealing is difficult, and GC content increases non-specific amplification.
In the single-stranded primer for DNA amplification of the invention, the length of the palindromic sequence increases with the increase of the length of the single-stranded primer; and, the length of the palindromic sequence is increased by 2bp for every 1bp increase of the length of the single-stranded primer.
Preferably, the length of the DNA marker fragment is 100bp, the total length of the single-chain primer is a, the length of the palindromic sequence is b, and 2 a-b is 100 bp; wherein, the range of a is 60bp to 90bp, and the range of b is 20bp to 80 bp; specifically, the preferred single-stranded primers provided by the invention are as follows:
the single-chain primer with the length of 60bp, wherein the 3' end of the single-chain primer has a 20bp palindromic sequence;
a single-chain primer with the length of 61bp, wherein the 3' end of the single-chain primer has a palindromic sequence of 22 bp;
a single-chain primer with the length of 62bp, wherein the 3' end of the single-chain primer has a 24bp palindromic sequence;
(and so on.) the.
The single-stranded primer with the length of 90bp has a palindromic sequence of 80bp at the 3' end.
In the above-mentioned plurality of single-stranded primers of different lengths, it can be seen that the length of the palindromic sequence at the 3' end is related to the total length of the single-stranded primer under the condition that the length of the resulting fragment is constant.
Further preferably, the length of the single-stranded primer is 60bp, wherein the length of the palindromic sequence is 20 bp; when the length of the palindromic sequence at the 3' end is less than 20bp, the palindromic sequence is too short to facilitate annealing and is easy to form nonspecific amplification, so that an amplification product is not a target product; when the length of the palindromic sequence is greater than 20bp, the total length of the single-stranded primer is increased, which results in a corresponding increase in amplification cost.
The amplification method of the DNA marker fragment adopts any one of the single-chain primers for amplification; during the amplification process, the single-stranded primer is used as both the primer and the template.
Specifically, in the first round of the amplification process, the single-stranded primers are matched pairwise and used as templates, palindromic sequences at the 3 'ends of the two single-stranded primers are subjected to complementary annealing, each single-stranded primer corresponding to each single-stranded primer is used as a template and extends towards the 5' end of the corresponding single-stranded primer, and a double-stranded DNA molecular weight standard fragment is formed after the extension is finished; after the first round of the amplification process, continuing the second round of amplification, wherein the single-stranded primers which are not complementarily extended in the first round continue the first round of amplification process, and the other part of the single-stranded primers continue to be extended by using the double-stranded DNA molecular weight standard fragment obtained in the first round as a template; wherein the amplification method adopts a PCR mix amplification method.
The preparation method of the DNA molecular weight standard provided by the invention comprises the steps that the DNA molecular weight standard comprises a DNA fragment with the length of 100bp, and the DNA fragment is obtained by the amplification method; after obtaining the DNA fragment of 100bp, the DNA fragment is mixed with DNA fragments of other lengths to obtain a DNA marker.
Preferably, the preparation method of the invention can be used for preparing DL2000 DNA marker.
Examples
In this example, a single-stranded primer of 60bp in length was used for amplification, and the 3' end of the primer had a palindromic sequence of 20 bp.
The single-stranded primer sequence in this example is shown in SEQ ID No: 1, specifically:
5`-TCCGATCGAATTCAATTAGAATTCAGCTAGAATTCATTCAGAATTCGCGGCCGCGAATTC-3`；
wherein the palindromic sequence is GAATTCGCGGCCGCGAATTC (-3'), and the GC content is 50%.
The single-chain primer is adopted to carry out PCR amplification, and the reaction system is as follows:
45. mu.l of gold medal PCR mix, 5. mu.l of primer; reaction procedure: 90s at 98 ℃, 10s at 58 ℃, 10s at 72 ℃, 1min at 72 ℃, hold at 4 ℃ and 35 cycles.
In the above cycle, the specific replication process of the primers is as follows:
firstly, carrying out a first round of amplification, wherein the specific process is that, as shown in figure 1, one single-stranded primer molecule and the other single-stranded primer molecule are annealed, complemented and paired through respective 20bp palindromic sequences at the 3' end; under the action of DNA polymerase in the reaction system, the 3 'end of each single-stranded primer extends towards the 5' end of the other single-stranded primer, and after the extension is finished, as shown in FIG. 2, a complete double-stranded DNA is formed, and the complete double-stranded DNA has a target length of 100 bp.
Then, the amplification is continued using the double-stranded DNA molecular weight standard fragment obtained in the first round as a template and the other single-stranded primers as primers.
FIG. 3 is an electrophoretogram of the product of 100bpDNA fragment obtained after amplification in this example, which is 50. mu.l spotted with 6 replicates; the gradient on the left side of the electrophoretogram was obtained by commercially available DL2000, and the lengths of the labeled fragments were, from top to bottom, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp, in that order.
As can be seen from the results in FIG. 3, the amplification product of this example is single in band and extremely high in yield.
The single-chain primer and the amplification method can efficiently and accurately amplify small fragments of 100bp in the DNA marker, and the single-chain primer is used as a template and a primer at the same time, so that the problem of template residue is completely avoided, and non-specific bands can be effectively avoided; the amplification product obtained by the method can be suitable for large-scale high-efficiency production, and the cost is effectively reduced.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Beijing Ongkogaku Biotechnology Co., Ltd
<120> DNA molecular weight standard fragment amplification single-stranded primer, amplification method and preparation method of DNA molecular weight standard
<141> 2021-04-16
<160> 1
<170> SIPOSequenceListing 1.0
<210> 2
<211> 60
<212> DNA
<213> Artificial Sequence
<400> 2
tccgatcgaa ttcaattaga attcagctag aattcattca gaattcgcgg ccgcgaattc 60
Claims (8)
1. A single-chain primer for amplifying a DNA molecular weight standard fragment is characterized in that a palindromic sequence is arranged at the 3' end of the single-chain primer;
the length of a fragment of the DNA molecular weight standard is 100bp, the total length of the single-chain primer is a, the length of a palindromic sequence is b, and 2 a-b is 100 bp; wherein, the range of a is 60bp to 90bp, and the range of b is 20bp to 80 bp.
2. The single-stranded primer for amplifying the DNA molecular weight standard fragment according to claim 1, wherein the sum of the number of guanine and cytosine in the palindromic sequence accounts for 40-60% of the total base number of the palindromic sequence.
3. The single-stranded primer for amplifying the DNA molecular weight standard fragment according to claim 2, wherein the sum of the number of guanine and cytosine in the palindromic sequence accounts for 45% -55% of the total base number of the palindromic sequence.
4. The single-stranded primer for amplifying the DNA molecular weight standard fragment according to claim 1, wherein the total length of the single-stranded primer is 60bp, and the length of the palindromic sequence is 20 bp.
5. The single-stranded primer for amplifying the DNA molecular weight standard fragment according to claim 1, wherein the sequence of the single-stranded primer is shown in SEQ ID No: 1 is shown.
6. A method for amplifying a DNA molecular weight standard fragment, which is characterized in that the DNA molecular weight standard fragment is amplified by using the single-stranded primer according to any one of claims 1 to 5, wherein the single-stranded primer is used as a primer and a template at the same time;
in the first round of the amplification process, palindromic sequences at the 3 'ends of the two single-stranded primers are subjected to complementary annealing, each single-stranded primer corresponding to each single-stranded primer is taken as a template, the single-stranded primer corresponding to each single-stranded primer is extended to the 5' end of the single-stranded primer, and a double-stranded DNA molecular weight standard fragment is formed after the extension is finished; and after the first round of the amplification process, continuing to perform a second round of amplification, wherein the single-stranded primers which are not complementarily extended in the first round continue to the first round of amplification process, and the other part of the single-stranded primers continue to be extended by using the double-stranded DNA molecular weight standard fragment obtained in the first round as a template.
7. The method for amplifying the DNA molecular weight standard fragment according to claim 6, wherein the amplification method is a PCR mix amplification method.
8. A method for preparing a DNA molecular weight standard, comprising the steps of amplifying and then quantitatively mixing at least two DNA molecular weight standard fragments of different lengths, wherein at least one of the DNA molecular weight standard fragments is amplified by the method for amplifying the one DNA molecular weight standard fragment according to claim 6 or 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110472989.6A CN113249438B (en) | 2021-04-29 | 2021-04-29 | DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110472989.6A CN113249438B (en) | 2021-04-29 | 2021-04-29 | DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113249438A CN113249438A (en) | 2021-08-13 |
| CN113249438B true CN113249438B (en) | 2022-04-19 |
Family
ID=77223473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110472989.6A Active CN113249438B (en) | 2021-04-29 | 2021-04-29 | DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113249438B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107488656A (en) * | 2016-06-13 | 2017-12-19 | 陆欣华 | A kind of nucleic acid isothermal is from amplification method |
| CN110714053A (en) * | 2019-11-13 | 2020-01-21 | 生工生物工程（上海）股份有限公司 | Preparation method of 100bp DNA molecular weight standard substance, primer group and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7211382B2 (en) * | 2002-04-09 | 2007-05-01 | Orchid Cellmark Inc. | Primer extension using modified nucleotides |
-
2021
- 2021-04-29 CN CN202110472989.6A patent/CN113249438B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107488656A (en) * | 2016-06-13 | 2017-12-19 | 陆欣华 | A kind of nucleic acid isothermal is from amplification method |
| CN110714053A (en) * | 2019-11-13 | 2020-01-21 | 生工生物工程（上海）股份有限公司 | Preparation method of 100bp DNA molecular weight standard substance, primer group and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| DNA分子量标准制备技术：方法与进展;张颖等;《中国生物工程杂志》;20091231;第29卷(第8期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113249438A (en) | 2021-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2014205648B2 (en) | Templates, libraries, kits and methods for generating molecules | |
| Ochman et al. | [21] Use of polymerase chain reaction to amplify segments outside boundaries of known sequences | |
| CN105861678B (en) | Design method of primer and probe for amplifying low-concentration mutation target sequence | |
| CN105506125A (en) | DNA sequencing method and next generation sequencing library | |
| CN107354211B (en) | Forest musk deer four-base microsatellite genetic marker locus and screening method thereof | |
| Silflow et al. | Sequence complexity of polyadenylated ribonucleic acid from soybean suspension culture cells | |
| KR20140075635A (en) | Method of simultaneous synthesis of DNA library using high-throughput parallel DNA synthesis method | |
| KR20160098097A (en) | A kit and method for detecting miDNA | |
| CN113249438B (en) | DNA molecular weight standard fragment amplification single-chain primer, amplification method and preparation method of DNA molecular weight standard | |
| CN109971843B (en) | Sequencing method of single cell transcriptome | |
| CN113481194A (en) | DNA synthesis method | |
| CN101177697B (en) | Method for preparing nucleic acid molecular weight label | |
| CN115873928B (en) | Rolling circle amplification method based on double-chain-ring template and application thereof | |
| CN107083427B (en) | DNA ligase mediated DNA amplification technology | |
| CN116004773A (en) | Linear displacement isothermal amplification method and application thereof | |
| CN101575601A (en) | Super plasmid of DNA molecular weight standard for producing even 200 bp gradient and preparation method thereof | |
| CN110714053B (en) | Preparation method of 100bp DNA molecular weight standard substance, primer group and application thereof | |
| CN116135982A (en) | Application method and kit for gene fragment ligation | |
| CN113174406A (en) | Preparation method of zebra fish LGP2 gene knockout homozygote | |
| CN108504655B (en) | Primer pair, DNA fragment and method for preparing DNA Ladder | |
| CN113122616A (en) | Method for amplifying and determining target nucleotide sequence | |
| CN105603055B (en) | Multiplex polymerase chain reaction method and application thereof | |
| WO2022170705A1 (en) | Method for preparing long-chain rna modified at specific site | |
| CN112322622B (en) | Application of lncRNA17978 in improvement of disease resistance of rice | |
| RU2616279C1 (en) | Method for production of marker ladders for gel electrophoretic determination of nucleic acid fragment sizes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 100176 Floor 6, West Half Unit, Building 3, Yard 105, Jinghai 3rd Road, Daxing District, Beijing Economic-Technological Development Area Patentee after: Beijing Qingke Biotechnology Co.,Ltd. Address before: 100176 Room 401, building 5, yard 156, Jinghai 4th Road, Daxing Economic and Technological Development Zone, Beijing Patentee before: Beijing Qingke Biotechnology Co.,Ltd. |