CN113238051A - Application of human-derived MOB1 protein - Google Patents
Application of human-derived MOB1 protein Download PDFInfo
- Publication number
- CN113238051A CN113238051A CN202110206794.7A CN202110206794A CN113238051A CN 113238051 A CN113238051 A CN 113238051A CN 202110206794 A CN202110206794 A CN 202110206794A CN 113238051 A CN113238051 A CN 113238051A
- Authority
- CN
- China
- Prior art keywords
- mob1
- protein
- hepatocellular carcinoma
- liver cancer
- tissues
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
- G01N2333/4704—Inhibitors; Supressors
Abstract
The invention relates to an application of a preparation for detecting MOB1 protein in the preparation of a kit for diagnosing or/and prognosing hepatocellular carcinoma; and application of an inhibitor of the MOB1 protein in preparing a medicament for preventing or/and treating hepatocellular carcinoma. Based on the current state of the prior art, the invention provides the promoting effect of the MOB1 protein in hepatocellular carcinoma and the application of the protein serving as a target point in diagnosis, treatment and prognosis of hepatocellular carcinoma. According to the invention, through mining a TCGA database, the MOB1 gene expression is found to be remarkably increased in a hepatocellular carcinoma sample and is remarkably related to the low survival rate of a patient. In the self-established tumor sample library, the comparison of liver cancer samples and tissues beside the liver cancer shows that the MOB1 protein is significantly highly expressed in the hepatocellular carcinoma tissue samples, but has no obvious change in other liver cancer type cancer tissues. The cell line with the MOB1 protein knocked down and over-expressed shows that the MOB1 protein can obviously promote the proliferation of multiple liver cancer cell lines, and even in the presence of Rankine, the MOB1 protein can still promote the proliferation of liver cancer cells.
Description
Technical Field
The invention relates to the technical field of biological medicines, and particularly relates to application of a human MOB1 protein.
Background
Liver cancer is one of the most common malignant tumors, and includes various types of Hepatocellular carcinoma (HCC), hepatobiliary cancer, and the like, wherein Hepatocellular carcinoma is the most predominant type of liver cancer. According to the data of GLOBOCAN2018, 841,080 new liver cancer cases are totally found in 2018 globally, wherein 596,574 cases are male, and 244,506 cases are female. Liver cancer has become the sixth most common tumor worldwide and is the fourth leading cause of cancer death worldwide.
Hepatocellular carcinoma has the clinical characteristics of occult onset, rapid progress, early relapse, poor prognosis and the like, most patients have advanced to middle and late stages when seeing a doctor due to obvious symptoms, and most of Chinese patients have hepatitis B virus infection, so that liver functions are seriously damaged, the general state is poor, and the operation treatment opportunity is lost. Because of the multidrug resistance of hepatoma cells, chemotherapy is not a conventional treatment for hepatocellular carcinoma, and targeted drugs are often used as first-line drugs in the systemic treatment of advanced hepatocellular carcinoma. In 2007, the epoch-making multi-target tyrosine kinase inhibitor sorafenib is marketed and becomes a first-line drug for treating hepatocellular carcinoma, but the median survival time of hepatocellular carcinoma patients after sorafenib is only about 1 year. In 2018, a new generation of the targeted drug, ranvatinib, was marketed in china and approved for first-line treatment of hepatocellular carcinoma patients who could not undergo surgery. Compared with sorafenib, the median survival time of ranvatinib was prolonged by 4.8 months (15.0 months vs 10.2 months), the objective remission rate was improved by 28.2% (40.6% vs 12.4%), and the progression-free survival was improved by 3.7 months (7.4 months vs 3.6 months). However, the problems of strong drug resistance, rapid progression and high recurrence rate of hepatocellular carcinoma are not solved, and the treatment still has a huge gap.
Targeted drugs are of great interest because of their good specificity, high potency and tolerability. From sorafenib to lenvatinib, targeted drug therapy for hepatocellular carcinoma shows great potential. The molecular targeted therapy is a research hotspot of the hepatocellular carcinoma at present, also puts higher requirements on drug research and development, needs to explore a specific pathogenesis of the hepatocellular carcinoma from a molecular level, search a key target point influencing the occurrence and development of the hepatocellular carcinoma, and explore an intervention means of the key target point.
The MOB1(Mps one binder1) protein was traditionally thought to have a cancer-suppressing effect. The MOB1 protein was originally found in budding yeast, and MOB1 binds to the phosphorylated protein kinase Dbf2, and acts as an effector mediating the Mitotic Exit Network (MEN) inhibiting the proliferation process of cells. In drosophila melanogaster, the MOB1 protein is further found to belong to a classical Hippo signal pathway, and plays an important role in the processes of regulating the size of organs, inhibiting tissue proliferation and inhibiting tumorigenesis by inhibiting the phosphorylation and nuclear entry levels of downstream effector protein YAP and its paralogous protein TAZ. In mammalian cells, various studies have also reported the cancer-suppressing effect of MOB1 protein mediated by YAP protein. For example, in colon cancer, the expression level of MOB1 is significantly reduced, with low expression closely associated with distant and lymphatic metastasis and with reduced survival in patients. Further mechanistic studies also demonstrated that MOB1 can affect the phosphorylation and nuclear entry of YAP proteins, inhibiting the proliferation and migration ability of tumor cells.
In recent years, more and more research has indicated that the same protein may play different roles in different cells. For example, the functional deletion of MST1/2, a key protein of the Hippo signaling pathway, does not cause the hyperproliferation of immune cells, but rather the dysfunction of the immune system. The MOB1 protein was relatively rare compared to other members of the Hippo signaling pathway, whereas the MOB1 protein's effect on tumor cells was not agreed upon in academia and the MOB1 protein was found to play a different role in different tumors. For example, the protein level of MOB1 was highly expressed in 51.2% of lung cancer samples (205 cases in total), and the highly expressed MOB1 was closely related to vascular invasion in tumors and low survival rate of patients. In addition, it was found that MOB1 overexpression promotes invasion of human lung cancer cell lines H1299 and PC9, while knockdown MOB1 significantly inhibits invasion of both cell lines. Notably, the role of MOB1 protein in liver cancer has not been reported.
Disclosure of Invention
The invention aims to provide an application of a human MOB1 protein aiming at the defects in the prior art.
In order to achieve the purpose, the invention adopts the technical scheme that:
the invention provides application of a preparation for detecting MOB1 protein in preparation of a kit for diagnosis or/and prognosis of hepatocellular carcinoma.
The second aspect of the invention provides application of an inhibitor of MOB1 protein in preparation of a drug for preventing or/and treating hepatocellular carcinoma.
Preferably, the MOB1 protein is a human MOB1 protein, including a highly homologous MOB1a protein, PubmedGene ID: 55233 and MOB1b proteins, Pubmed GeneID: 92597.
preferably, the hepatocellular carcinoma is primary hepatocellular carcinoma or recurrence thereof or metastasis thereof.
By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:
based on the current state of the prior art, the invention provides the promoting effect of the MOB1 protein in hepatocellular carcinoma and the application of the protein serving as a target point in diagnosis, treatment and prognosis of hepatocellular carcinoma. According to the invention, through mining a TCGA database, the MOB1 gene expression is found to be remarkably increased in a hepatocellular carcinoma sample and is remarkably related to the low survival rate of a patient. In the self-established tumor sample library, the comparison of liver cancer samples and tissues beside the liver cancer shows that the MOB1 protein is significantly highly expressed in the hepatocellular carcinoma tissue samples, but has no obvious change in other liver cancer type cancer tissues. The cell line with the MOB1 protein knocked down and over-expressed shows that the MOB1 protein can obviously promote the proliferation of multiple liver cancer cell lines, and even in the presence of Rankine, the MOB1 protein can still promote the proliferation of liver cancer cells.
Drawings
FIG. 1 shows the relationship between MOB1 protein and hepatocellular carcinoma mined from TCGA database; wherein (A, B) is the expression level of MOB1a and MOB1B genes in normal tissues and hepatocellular carcinoma tissues; (C, D) is the relation between the expression level of MOB1a and MOB1b genes and the survival rate of patients;
FIG. 2 shows the expression level of MOB1 in liver cancer tissues from a self-established sample bank; wherein (A) is the protein expression level of MOB1 in cancer tissues and tissues beside the cancer of hepatocellular carcinoma patients; (B) the protein expression level of MOB1 in the cancer tissue and the tissue beside the cancer of the hepatobiliary duct cancer patient; (C) the protein expression level of MOB1 in cancer tissues and tissues beside the cancer of patients with liver vascular cancer; (D) the protein expression level of MOB1 in cancer tissues and tissues beside the cancer of the liver cell adenocarcinoma patients; (E) the protein expression level of MOB1 in cancer tissues and tissues beside the cancer of patients with fibro-hepatic carcinoma; (F) the protein expression level of MOB1 in liver cancer tissues and tissues beside cancer after liver metastasis of rectal cancer and breast cancer; (G) the protein expression quantity of MOB1 in cancer tissues and tissues beside the cancer of hepatocellular carcinoma patients; (H) the protein expression quantity of MOB1 in cancer tissues and tissues beside the cancer of other liver cancer patients;
figure 3 is the effect of MOB1 knockdown on proliferation of liver cancer cell lines; wherein (A) is Western blot for detecting the knocking-down effect of the MOB1 in HepG2 cells; (B) effect of MOB1 knockdown on HepG2 cell proliferation; (C) detecting the knockdown effect of the MOB1 in Huh-7 cells for Western blot; (D) effects of MOB1 knockdown on Huh-7 cell proliferation;
FIG. 4 is a graph of the effect of over-expression of MOB1 on the proliferation of liver cancer cell lines; wherein (A) is Western blot for detecting the over-expression effect of the MOB1 in HepG2 cells; (B) is the effect of MOB1 overexpression on HepG2 cell proliferation; (C) to the effect of MOB1 overexpression on HepG2 cell proliferation in the presence of lenvatinib; (D) detecting the overexpression effect of MOB1 in Huh7 cells for Western blot; (E) effects of MOB1 overexpression on proliferation of Huh7 cells; (F) to the effect of MOB1 overexpression on Huh7 cell proliferation in the presence of lenvatinib.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
It should be noted that the experimental methods in the following examples are all conventional methods unless otherwise specified; materials, reagents, and the like used in the following examples are commercially available from public unless otherwise specified; the embodiments and features of the embodiments of the present invention may be combined with each other without conflict.
The invention is further described with reference to the following drawings and specific examples, which are not intended to be limiting.
Examples: the effect of a new target MOB1 protein on proliferation of hepatocellular carcinoma is explored.
(I) an experimental method
1) TCGA database mining
The human MOB1 includes a highly homologous MOB1a protein (PubmedGene ID: 55233) and MOB1b protein (Pubmed Gene ID: 92597). RNA sequencing information and survival rate information of 50 normal liver tissues and 371 hepatocellular carcinoma tissues are obtained from a TCGA database, the expression quantities (TPM) of MOB1a and MOB1b in the normal tissues and the hepatocellular carcinoma tissues are counted, and the survival rates of hepatocellular carcinoma patients with different expression quantities of MOB1a and MOB1b are analyzed.
2) Self-built liver cancer sample library
28 liver cancer tissues and paracarcinoma tissues are collected from Shenzhen national hospital from 01 month to 12 month of 2020 by surgical resection specimens, including 15 samples of hepatocellular carcinoma, 5 samples of cholangiocarcinoma, 3 samples of hepatic vascular cancer, 1 sample of hepatocellular adenocarcinoma, 2 samples of fibrous liver cancer, 1 sample of liver metastasis of rectal cancer and 1 sample of liver metastasis of breast cancer, all of which have definite pathological diagnosis reports. The paracancerous tissues were paired with cancerous tissues for each patient. Samples were taken, cut into small pieces immediately, aliquoted, and stored in liquid nitrogen until use. Approximately 50mg of tissue was taken and added to RIPABuffer containing protease inhibitors and protein phosphatase inhibitors, after high speed trituration and lysis on ice, 12000g was centrifuged for 15 minutes, the supernatant was taken for protein quantification and added to Loading Buffer and boiled for 15 minutes and stored at-80 ℃.
3) Western blot detection of MOB1 protein expression level of liver cancer tissue
An equal amount of protein sample was subjected to SDS-PAGE, followed by wet transfer of the protein to a 0.45 μm PVDF membrane and blocking with 5% skim milk for 1 hour. The membrane was then washed 3 times with TBST, followed by addition of either the MOB1 antibody or the β -actin antibody for 1 hour at room temperature or overnight at 4 ℃. HRP-labeled secondary antibody was added, incubation was continued for 1 hour at room temperature, the membrane was washed 3 times with TBST, and then developed with ECL chemiluminescence kit. Results of protein quantification grayscale values of the bands were analyzed using Image J software.
4) Cell culture and cell line construction
All cells were cultured in DMEM medium containing 10% FBS and 1% penicillin/streptomycin at 37 ℃ in a cell culture chamber containing 5% CO 2.
The knockdown cell line was constructed using lentivirus-mediated CRISPR/Cas9 technology. sgRNAs (MOB1bsgRNA forward: CACCGGACCAAAGAAGAACATTCC AG, MOB1bsgRNA reverse: AAACCTGGAATGTTCTTCTTTGGTCC) are respectively designed according to the sequence of MOB1, and are respectively connected to a LentiCRISPR v2 vector to determine the sequence correctness through sequencing. The psPAX2 and pMD2.G and the plasmid of interest were co-transfected into 293T cells for virus packaging, and virus-containing supernatants were collected at 48 hours and 72 hours and filtered through a 0.45 μm filter. Adding virus liquid into target cells, transfecting for 48 hours, screening by puromycin until untransfected control cells are all dead, and establishing a stable transfected cell line. Cells transfected with lentiCRISPR v2 vector (Cas9) served as controls. The method of Western blot is used for identifying the knocking-down effect of the MOB 1.
A stable over-expressed cell line was constructed using the lentivirus-mediated over-expression plasmid pLVX-3 Flag-puro. The coding sequence of full-length MOB1a was cloned into pLVX-3Flag-puro plasmid and sequenced to confirm sequence correctness. Methods for lentivirus packaging and stable cell line construction are described above. Cells transfected with pLVX-3Flag-puro vector (pLVX) served as control. The overexpression effect of Flag-MOB1a was identified by Western blot method.
5) Cell growth curve
The cells were inoculated into 96-well plates for culture, wherein the density of HepG2 cells was 5X 103Density of Huh7 was 5 × 10 per well3Each well. After 12, 24, 48, 72 of the culture, CCK-8 solution was added in an amount of 10% of the total volume, and after further incubation for 3 hours, absorbance was measured at 450 nm.
② experimental results
1) Mining of MOB1 relationship to hepatocellular carcinoma in TCGA database
The human MOB1a and MOB1b are two homologous proteins of MOB1, both having 95% amino acid homology. The invention firstly carries out data mining in a TCGA tumor database, and by comparing 50 cases of normal tissues with 371 cases of hepatocellular carcinoma tissues, we find that two genes, namely MOB1A and MOB1B, are remarkably up-regulated in the hepatocellular carcinoma tissues (figures 1A and 1B). Hepatocellular carcinoma patients were divided into high-expression and low-expression groups of MOB1, and the survival rates of both MOB1a and MOB1b high-expression group patients were found to be significantly reduced (FIGS. 1C and 1D). The results show that the MOB1 protein may have the function of promoting the occurrence and development of hepatocellular carcinoma.
2) Verifying the relation between MOB1 and liver cancer in a self-built liver cancer sample library
The basic information of 28 patients in the self-established liver cancer sample library is shown in Table 1. The protein expression levels of MOB1 in 28 liver cancer samples and matched paracancerous tissues in the self-constructed liver cancer sample bank were measured by Western blot, and as a result, as shown in fig. 2, 13 of the 15 liver cancer samples were found to have high expression (86.7%) of MOB1 protein level, while 13 of the other liver cancer samples were found to have high expression (46.2%) of MOB1 protein level. After chi-square test analysis, it was demonstrated that there was significantly high expression of MOB1 protein levels in hepatocellular carcinoma (p <0.05) compared to other types of liver cancer (table 2). Quantitative statistics of the expression level of each sample was performed by Image J software, and it was found that the protein level of MOB1 was significantly increased in hepatocellular carcinoma samples, but was not significantly changed in other liver cancer samples (fig. 2G and 2H).
Table 1 summary of information from 28 patients with liver cancer (hepatocellular carcinoma and other liver cancers) in a self-established sample library.
Table 2 statistics of the expression of MOB1 protein in tumor samples of 28 patients with liver cancer;
3) MOB1 promoting proliferation of liver cancer cell lines
The liver cancer cell lines Huh7 and HepG2 are used for further verifying the influence of the MOB1 on liver cancer cells, and the proliferation speed of two MOB1 knocked-down cell lines is obviously reduced compared with that of an unloaded plasmid control after the MOB1 protein is knocked down by using a CRISPR/Cas9 technology (FIG. 3). Whereas the proliferation rates of Huh7 and HepG2 cells were significantly enhanced after overexpression of Flag-MOB1a protein (fig. 4A, 4B, 4D and 4E), and MOB1 was still able to promote the proliferation rates of Huh7 and HepG2 cells in the presence of ranvatinib (fig. 4C and 4F).
In summary, the present patent found the promoting effect of MOB1 on the proliferation of hepatocellular carcinoma. In view of the importance of targeted therapy of hepatocellular carcinoma, the patent provides a new strategy for treating hepatocellular carcinoma by taking MOB1 as a target point, and provides a new application of chemical (such as small molecule inhibitors) and biological (such as antibodies, CRISPR/Cas9, shRNA, siRNA and the like) inhibitors targeting MOB1 in treatment of hepatocellular carcinoma.
While the invention has been described with reference to a preferred embodiment, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention.
Claims (4)
1. An application of a preparation for detecting MOB1 protein in preparing a kit for diagnosing or/and prognosing hepatocellular carcinoma.
2. An application of an inhibitor of MOB1 protein in preparing a medicine for preventing or/and treating hepatocellular carcinoma is disclosed.
3. The use according to claim 1 or 2, wherein said MOB1 protein is human MOB1 protein, including the highly homologous MOB1a protein, PubmedGene ID: 55233 and MOB1b proteins, Pubmed GeneID: 92597.
4. use according to claim 1 or 2, wherein the hepatocellular carcinoma is primary hepatocellular carcinoma or a recurrence thereof or a metastasis thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110206794.7A CN113238051A (en) | 2021-02-24 | 2021-02-24 | Application of human-derived MOB1 protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110206794.7A CN113238051A (en) | 2021-02-24 | 2021-02-24 | Application of human-derived MOB1 protein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113238051A true CN113238051A (en) | 2021-08-10 |
Family
ID=77130287
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110206794.7A Pending CN113238051A (en) | 2021-02-24 | 2021-02-24 | Application of human-derived MOB1 protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113238051A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140045915A1 (en) * | 2010-08-31 | 2014-02-13 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| US20140342946A1 (en) * | 2011-12-31 | 2014-11-20 | Moni Abraham Kuriakose | Diagnostic tests for predicting prognosis, recurrence, resistance or sensitivity to therapy and metastatic status in cancer |
| CN106581676A (en) * | 2017-01-05 | 2017-04-26 | 昆山彭济凯丰生物科技有限公司 | Cancer marker, drug component for treating cancers and application |
| WO2019144012A1 (en) * | 2018-01-18 | 2019-07-25 | Emory University | Mast1 and uses for diagnosing and treating cancer |
-
2021
- 2021-02-24 CN CN202110206794.7A patent/CN113238051A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140045915A1 (en) * | 2010-08-31 | 2014-02-13 | The General Hospital Corporation | Cancer-related biological materials in microvesicles |
| US20140342946A1 (en) * | 2011-12-31 | 2014-11-20 | Moni Abraham Kuriakose | Diagnostic tests for predicting prognosis, recurrence, resistance or sensitivity to therapy and metastatic status in cancer |
| CN106581676A (en) * | 2017-01-05 | 2017-04-26 | 昆山彭济凯丰生物科技有限公司 | Cancer marker, drug component for treating cancers and application |
| WO2019144012A1 (en) * | 2018-01-18 | 2019-07-25 | Emory University | Mast1 and uses for diagnosing and treating cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liao et al. | BRAF-activated LncRNA functions as a tumor suppressor in papillary thyroid cancer | |
| Zhang et al. | MicroRNA‐657 promotes tumorigenesis in hepatocellular carcinoma by targeting transducin‐like enhancer protein 1 through nuclear factor kappa B pathways | |
| CN105435228B (en) | New anti-tumor application of arsenic trioxide and anti-tumor preparation | |
| Gong et al. | DYNC1I1 promotes the proliferation and migration of gastric cancer by up-regulating IL-6 expression | |
| Huang et al. | Uridine‐cytidine kinase 2 upregulation predicts poor prognosis of hepatocellular carcinoma and is associated with cancer aggressiveness | |
| Shi et al. | Panx1 promotes invasion-metastasis cascade in hepatocellular carcinoma | |
| CN108707668A (en) | A kind of long non-coding RNA SNHG15 and its application in preparing diagnosis and treatment cancer drug | |
| Zhang et al. | DUOX2 promotes the progression of colorectal cancer cells by regulating the AKT pathway and interacting with RPL3 | |
| Zhong et al. | Ubiquitin-specific protease 15 contributes to gastric cancer progression by regulating the Wnt/β-catenin signaling pathway | |
| Yong et al. | Overexpression of Semaphorin-3E enhances pancreatic cancer cell growth and associates with poor patient survival | |
| Guo et al. | E2F7 transcriptionally inhibits MicroRNA-199b expression to promote USP47, thereby enhancing colon cancer tumor stem cell activity and promoting the occurrence of colon cancer | |
| Guo et al. | Oncogenic chromatin modifier KAT2A activates MCT1 to drive the glycolytic process and tumor progression in renal cell carcinoma | |
| Huang et al. | ZC3HAV1 promotes the proliferation and metastasis via regulating KRAS in pancreatic cancer | |
| Chen et al. | Overexpression of HACE 1 in gastric cancer inhibits tumor aggressiveness by impeding cell proliferation and migration | |
| Zhu et al. | Asialoglycoprotein receptor 1 functions as a tumor suppressor in liver cancer via inhibition of STAT3 | |
| Dong et al. | miR-369 inhibits Liver Cancer progression by targeting ZEB1 pathway and predicts the prognosis of HCC patients | |
| Peng et al. | miR‑224‑5p regulates the proliferation, migration and invasion of pancreatic mucinous cystadenocarcinoma by targeting PTEN | |
| Ge et al. | DCLK1-short splice variant promotes esophageal squamous cell carcinoma progression via the MAPK/ERK/MMP2 pathway | |
| Maekawa et al. | Expression and localization of FOXO1 in non-small cell lung cancer | |
| Wang et al. | HBXIP: a potential prognosis biomarker of colorectal cancer which promotes invasion and migration via epithelial-mesenchymal transition | |
| Guo et al. | ACADL functions as a tumor suppressor in hepatocellular carcinoma metastasis by inhibiting matrix metalloproteinase 14 | |
| Yu et al. | EIF4A3 Acts on the PI3K–AKT–ERK1/2–P70S6K Pathway through FLOT1 to Influence the Development of Lung Adenocarcinoma | |
| CN108619530B (en) | Application of SNORA18L5 in early warning of liver cancer risk and siRNA for inhibiting SNORA18L5 in inhibiting liver cancer growth | |
| Tian et al. | The deubiquitinating enzyme USP19 facilitates hepatocellular carcinoma progression through stabilizing YAP | |
| CN113238051A (en) | Application of human-derived MOB1 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210810 |