CN113238036B

CN113238036B - Ochratoxin A double-color fluorescence detection method based on hybridization chain reaction and DNA tweezers

Info

Publication number: CN113238036B
Application number: CN202110132967.5A
Authority: CN
Inventors: 杨丽珠; 李煜婷; 张佳枫; 张澳
Original assignee: Wenzhou Medical University
Current assignee: Wenzhou Medical University
Priority date: 2021-02-01
Filing date: 2021-02-01
Publication date: 2022-03-11
Anticipated expiration: 2041-02-01
Also published as: CN113238036A

Abstract

The invention provides a method for detecting ochratoxin A by two-color fluorescence based on a hybridization chain reaction and DNA tweezers. Ochratoxin A binds to hairpin-locked aptamers and triggers a hybrid chain reaction to produce long double-stranded DNA. The side chains of the long duplex can hybridize to the two locking sequences of the DNA tweezer, respectively, resulting in the opening of the DNA tweezer and the recovery of the two-color fluorescent signal. The results show that the linearity is good within the range of 0.02-0.8 ppb, the detection limit of FAM fluorescence signal is 0.006ppb, the detection limit of Cy5 fluorescence signal is 0.014ppb, and the requirements of practical application are met. In addition, the method can greatly reduce the false positive rate. The detection of ochratoxin A in an actual food sample has good performance.

Description

Ochratoxin A double-color fluorescence detection method based on hybridization chain reaction and DNA tweezers

Technical Field

The invention relates to the field of detection of ochratoxin A, in particular to the field of fluorescence-based detection methods of ochratoxin A.

Background

Ochratoxins a (ota) are a class of mycotoxins produced primarily by aspergillus and penicillium in several improperly stored food products. Ochratoxin a has been shown to be nephrotoxic, hepatotoxic, neurotoxic, reproductive toxic and embryotoxic to humans and several animals. Many researchers have found that ochratoxin a is associated with idiopathic nephropathy in humans and animals and can also cause kidney disease and liver tumors. Ochratoxin a is transferred into the food chain because of its long half-life in food and animal feed. It is widely found in various everyday foods and beverages, including milk, wine, beer, fruit juices, beans, eggs, nuts, dried fruits, grains, coffee, and the like. Thus, according to the full evidence of experimental animals, international agency for research on cancer (IARC) classified ochratoxin a as a possible human carcinogen (group 2B). Therefore, the European Commission determined the maximum residual amount of ochratoxin A of 0.5-20 μ g kg-1 based on different food substrates.

To date, a number of analytical techniques have been developed for routine detection and identification of ochratoxin a, including High Performance Liquid Chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS) and ELISA analysis. In a laboratory with perfect equipment, the method has a standard analysis method with high accuracy, high sensitivity and high reliability. However, these methods are limited due to high cost, complicated pretreatment, and experience of operators. The aptamer is a single-stranded nucleic acid capable of binding with a target molecule and has strong affinity. Recently, many analytical methods have been used for ochratoxin a detection by using aptamers for ochratoxin a recognition, including colorimetry, fluorescence, electrochemistry, Surface Enhanced Raman Scattering (SERS), and the like, and although great progress has been made, the search for a new method for ochratoxin a detection having ultra-high sensitivity and ultra-high selectivity is still of great significance for the fields of food safety and public health.

Disclosure of Invention

In order to solve the problems, the invention provides a method for detecting ochratoxin A by two-color fluorescence based on a hybridization chain reaction and DNA tweezers.

The invention comprises the following steps.

A ochratoxin A two-color fluorescence detection method based on hybridization chain reaction and DNA tweezers comprises the following 4 steps:

1) respectively dissolving the hairpin locked aptamer sequence, the hybrid hairpin 1 sequence and the hybrid hairpin 2 sequence, heating to 90 ℃, and slowly cooling to room temperature to form respective hairpin structures, wherein the hairpin locked aptamer sequence (5 'to 3') is GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACACCTGATGTCCGATGCT, the hybrid hairpin 1 sequence (5 'to 3') is TCTATATATTGTCCGATGCTCGTAAAGCATCGGACATCAGGGTCCGATGC, and the hybrid hairpin 2 sequence (5 'to 3') is AAGTCGTATTTACGAGCATCGGACACCTGATGTCCGATGCTCTGCACTTT;

2) mixing the sequence I-II with a PBS solution containing NaCl to form the DNA tweezers, wherein the sequence I-II (5 'to 3') is respectively Cy5-TATATAGTCCTATCTATGATGG CCCC TTTGTAGACTCAGGATTCGACT-DABCYL; FAM-GTCGTAATGACACATCACTAGGCCCCGTTGGAGCGACATTAGTCCGAT-BHQ 3; CTAATGTCGCTCCAACAACCATCATAGATAGGAC, respectively; ATCCTGAGTCTACAAATACCTAGTGATGTGTCAT, respectively; GCATCGGACATATATAGA, respectively; AAAGTGCAGATACGACTT, respectively;

3) culturing a sample to be tested and a mixture of a proper amount of hairpin locked aptamer, a hybrid hairpin 1 solution and a hybrid hairpin 2 solution for 2 hours under a certain condition;

4) adding a proper amount of DNA forceps obtained in the step 2) into the solution obtained in the step 3), incubating, directly recording fluorescence signals of FAM and Cy5 by using a fluorescence spectrophotometer, and calculating the concentration of ochratoxin A in the solution to be detected by using a standard curve method.

Preferably, step 1) is specifically: the hairpin-locked aptamer sequence, hybrid hairpin 1 sequence and hybrid hairpin 2 sequence were dissolved in 10mM PBS (pH 7.5) solution containing 0.1mM NaCl, respectively, and then they were heated to 90 ℃ for 5 minutes and cooled to room temperature to form the designed hairpin structure.

Preferably, step 2) is specifically: (ii) mixing (i) - (c) of the same concentration as the sequence with a 10mM PBS (pH 7.5) solution containing 0.1mM NaCl to form a DNA tweezer, and then heating the solution to 90 ℃ for 5 minutes and slowly cooling to room temperature to form a DNA tweezer structure.

Preferably, step 3) is specifically: the test sample was incubated with a mixture of 100nM hairpin aptamer, 50nM hybrid hairpin 1 and 50nM hybrid hairpin 2 at 30 ℃ in a solution of 10mM PBS (pH 7.5) containing 0.1mM NaCl for 2 hours.

Preferably, the step 4) is specifically: adding the 300nm DNA forceps obtained in the step 2) into the solution obtained in the step 3), incubating for 30min at 30 ℃, finally, recording fluorescence signals of FAM and Cy5 by a fluorescence spectrophotometer, exciting the fluorescence signal of FAM at 486nm, monitoring at 510nm to 600nm, exciting the fluorescence signal of Cy5 at 640nm, measuring at 650nm to 750nm, and calculating the concentration of ochratoxin A in the solution to be detected by using a standard curve method.

The invention provides a method for detecting ochratoxin A by two-color ultrasensitive fluorescence based on a hybridization chain reaction and DNA tweezers. Ochratoxin A has strong affinity and can be specifically combined with hairpin-type aptamer. An open hairpin can trigger a chain hybridization reaction between two alternating hairpins (hybrid hairpin 1, hybrid hairpin 2) to form a long biphasic structure. The long double-stranded structure formed makes the two tails of the hairpin sufficiently tight to form two complete side-chain DNAs on either side of the long double-stranded structure. The two side chain DNAs formed are complementary to the two locking sequences (c and c) on both sides of the DNA tweezer, respectively, resulting in the escape of the two locking sequences and the opening of the DNA tweezer. Thus, the two-color fluorescence signal of the DNA tweezers was significantly restored. The bicolor fluorescence intensity can be used for quantitative analysis of ochratoxin A concentration. The method adopts a chain type hybridization reaction amplification strategy, has high sensitivity and low false positive rate of a two-color fluorescent signal. In addition, the method has been successfully applied to detection of ochratoxin A in different food substrates, and has good specificity and selectivity.

Drawings

FIG. 1 is a schematic diagram of the detection process of the present invention.

FIG. 2 shows fluorescence intensities of different samples. Fluorescence intensity of different samples: (1) DNA tweezers + hairpin aptamer + hybrid hairpin 1, hybrid hairpin 2 (without ochratoxin a), (2) DNA tweezers + ochratoxin a + hybrid hairpin 1, hybrid hairpin 2 (without hairpin aptamer), (3) DNA tweezers + ochratoxin a + hairpin aptamer + hybrid hairpin 1, hybrid hairpin 2, (4) DNA tweezers + ochratoxin a + hairpin aptamer + hybrid hairpin 1, hybrid hairpin 2 (half incubation time), (5) DNA tweezers + ochratoxin a + hairpin locked aptamer + hybrid hairpin 1', hybrid hairpin 2, (6) the samples of the best examples.

Fig. 3 is a graph of the analytical performance of the method. FIG. 3A is a graph showing fluorescence intensity of FAM and Cy5, i.e., ochratoxin A concentration; FIGS. 3B and 3C are linear plots of fluorescence intensity and ochratoxin A concentration. Fig. 3D is a diagram of the anti-interference detection result of the method.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The present invention will be described in further detail with reference to examples.

Materials and reagents are prepared.

Phosphate Buffered Saline (PBS), ochratoxin A (OTA), aflatoxin B1 (AFB 1), aflatoxin M1 (AFM 1), Deoxynivalenol (DON) and Zearalenone (ZEA) were prepared. DNA sequences were prepared and the sequence details are given in the following table.

Preparation of hairpin-locked aptamers, hairpins and DNA tweezers

The hairpin-locked aptamer sequence, hybrid hairpin 1 sequence and hybrid hairpin 2 sequence were dissolved in 10mM PBS (pH 7.5) solution containing 0.1mM NaCl, respectively, and then they were heated to 90 ℃ for 5 minutes and cooled to room temperature to form the designed hairpin structure.

(ii) mixing (i) - (c) of the same concentration as the sequence with a 10mM PBS (pH 7.5) solution containing 0.1mM NaCl to form a DNA tweezer, and then heating the solution to 90 ℃ for 5 minutes and slowly cooling to room temperature to form a DNA tweezer structure.

The test sample was incubated with a mixture of 100nM hairpin aptamer, 50nM hybrid hairpin 1 and 50nM hybrid hairpin 2 at 30 ℃ in a solution of 10mM PBS (pH 7.5) containing 0.1mM NaCl for 2 hours.

Adding the 300nm DNA forceps obtained in the step 2) into the solution obtained in the step 3), incubating for 30min at 30 ℃, finally, recording fluorescence signals of FAM and Cy5 by a fluorescence spectrophotometer, exciting the fluorescence signal of FAM at 486nm, monitoring at 510nm to 600nm, exciting the fluorescence signal of Cy5 at 640nm, measuring at 650nm to 750nm, and calculating the concentration of ochratoxin A in the solution to be detected by using a standard curve method.

The above method is the best embodiment of the present invention.

The detection principle of this method is shown in fig. 1. Ochratoxin a aptamers are locked by hairpin structures. Hairpin-locked aptamers can be opened and release the stem-loop portion of the hairpin in the presence of ochratoxin a. The released sequence can trigger a chain hybridization reaction between two alternating hairpins, forming a long biphasic structure. The two tails of the hairpin can be close together, forming two complete side-chain sequences on both sides of the long duplex. The two side chain DNAs formed are complementary to the two lock sequences on both sides of the DNA tweezers, respectively. The DNA tweezer will open without the locking sequence, resulting in separation of the fluorophore and quencher. Thus, the two-color fluorescence signal of the DNA tweezers is greatly recovered. The concentration of ochratoxin A can be quantitatively detected by using the two fluorescence intensities.

The feasibility of this method was investigated below using samples of different conditions (fig. 2). Sample 1 shows background fluorescence intensity of FAM and Cy5 without ochratoxin a, indicating that DNA tweezers cannot be opened without ochratoxin a. Sample 2 without aptamer showed similar fluorescence intensity as sample 1, indicating that the chain hybridization reaction could not be triggered and the DNA tweezers were still turned off. When the

hybridization hairpins

1 and 2 in sample 3 were replaced by hybridization hairpins 1 and 2 (without two tails), the fluorescence signal was still low, indicating that the long double stranded structure without side chain DNA failed to open the DNA tweezer. The incubation time for the chain hybridization reaction of sample 4 was only half of normal, showing a strong fluorescence signal, indicating that the chain hybridization reaction was partially complete and therefore not all DNA tweezers were opened. Sample 5 also showed strong signal intensity at one channel, since one of the side chains was changed by replacing the tail of the hybridization hairpin 1 with the hybridization hairpin 1', resulting in the recovery of a fluorescent signal. Sample 6, tested according to the best embodiment, showed strong fluorescent signals on both the FAM and Cy5 channels, indicating that the chain hybridization reaction had been successfully initiated and that the DNA tweezers had been completely closed and opened.

Analysis performance of ochratoxin A double-color ultrasensitive fluorescence detection method.

The analytical performance of the method was investigated under the above-described optimized conditions. As shown in FIG. 3A, the fluorescence intensity of both FAM and Cy5 increased with increasing ochratoxin A concentration. For FAM (R2 = 0.995) and Cy5 (R2 = 0.994), there was a good linear relationship between fluorescence intensity and ochratoxin a concentration (fig. 3B and 3C). The detection limits of FAM and Cy5 were calculated to be 0.006ppb and 0.014ppb, respectively, according to the 3 σ standard. The detection limit is far lower than the maximum residue limit of ochratoxin A specified by the European Union Commission, and the requirement of practical application is met.

The interference resistance and selectivity of the method are evaluated by using related mycotoxins such as ochratoxin A (OTA), aflatoxin B1 (AFB 1), aflatoxin M1 (AFM 1), Deoxynivalenol (DON) and Zearalenone (ZEA). Only the ochratoxin A sample or a sample mixed with ochratoxin A (sample: mixed 2) showed strong fluorescence signals of FAM and Cy 5. Furthermore, the sample without ochratoxin a showed weak background fluorescence intensity, and the detection of ochratoxin a in the sample (mix 1) did not significantly interfere with the presence of other related mycotoxins (fig. 3D). The result shows that the aptamer has good specificity and anti-interference performance on ochratoxin A.

And (3) detecting ochratoxin A in a food sample.

The practical application of the method was evaluated using positive and labeled foods as examples. Positive samples were provided by the institute for metrological quality testing, Chongqing. Food samples were purchased randomly from local supermarkets, solid samples were stored in sterilized polyethylene bags, and liquid samples were stored in sterilized glass bottles. Ochratoxin a is only detected in maize and the results obtained by this method are very close to those of HPLC detection. And adding two different concentrations of ochratoxin A into the sample to perform recovery rate, precision and accuracy tests. The recovery rate of the method is improved to 105.5 percent from 93.0 percent, the relative standard deviation is improved to 8.2 percent from 2.4 percent, and the requirement of practical application is met. In addition, the results were confirmed by standard HPLC methods, which showed good analytical performance compared to the standard HPLC methods. The method does not require complex extractive pretreatment and post-column derivatization.

TABLE 2 application of two-color fluorescence method in ochratoxin A assay in food (n ═ 3)

In summary, we developed a two-color ultrasensitive fluorescence detection method for ochratoxin a based on hybridization chain reaction and DNA tweezers. The method shows high specificity of the aptamer and provides high sensitivity through a chain hybridization amplification method. In addition, a two-color fluorescence signal pattern provides a lower false positive rate. In addition, the method has been successfully applied to detection of ochratoxin A in different food substrates, and has good specificity and selectivity.

Sequence listing

<110> Wenzhou university of medical science

<120> ochratoxin A double-color fluorescence detection method based on hybridization chain reaction and DNA tweezers

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatcgggtgt gggtggcgta aagggagcat cggacacctg atgtccgatg ct 52

<210> 2

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tctatatatt gtccgatgct cgtaaagcat cggacatcag ggtccgatgc 50

<210> 3

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aagtcgtatt tacgagcatc ggacacctga tgtccgatgc tctgcacttt 50

<210> 4

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtccgatgc tcgtaaagca tcggacatca gg 32

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttacgagcat cggacacctg atgtccgatg ct 32

<210> 6

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaaaaaaat gtccgatgct cgtaaagcat cggacatcag gaaaaaaaaa 50

<210> 7

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cytatatagt cctatctatg atggcccctt tgtagactca ggattcgact dabcy 55

<210> 8

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

amgtcgtaat gacacatcac taggccccgt tggagcgaca ttagtccgat bh 52

<210> 9

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctaatgtcgc tccaacaacc atcatagata ggac 34

<210> 10

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atcctgagtc tacaaatacc tagtgatgtg tcat 34

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcatcggaca tatataga 18

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aaagtgcaga tacgactt 18

Claims

1. A ochratoxin A two-color fluorescence detection method based on hybridization chain reaction and DNA tweezers comprises the following 4 steps:

step 1, respectively dissolving the hairpin locked aptamer sequence, the hybrid hairpin 1 sequence and the hybrid hairpin 2 sequence, heating to 90 ℃, and slowly cooling to room temperature to form respective hairpin structures, wherein the hairpin locked aptamer sequence (5 'to 3') is GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACACCTGATGTCCGATGCT, the hybrid hairpin 1 sequence (5 'to 3') is TCTATATATTGTCCGATGCTCGTAAAGCATCGGACATCAGGGTCCGATGC, and the hybrid hairpin 2 sequence (5 'to 3') is AAGTCGTATTTACGAGCATCGGACACCTGATGTCCGATGCTCTGCACTTT;

step 2, mixing the sequence I-II with a PBS solution containing NaCl to form the DNA tweezers, wherein the sequence I-II (5 'to 3') is respectively Cy 5-TATATAGTCCTATCTATGATGGCCCCTTTGTAGACTCAGGATTCGACT-DABCYL; FAM-GTCGTAATGACACATCACTAGGCCCCGTTGGAGCGACATTAGTCCGAT-BHQ 3; CTAATGTCGCTCCAACAACCATCATAGATAGGAC, respectively; ATCCTGAGTCTACAAATACCTAGTGATGTGTCAT, respectively;

GCATCGGACATATATAGA；AAAGTGCAGATACGACTT；

step 3, culturing a sample to be detected and a mixture of a proper amount of hairpin locked aptamer, the hybrid hairpin 1 and the hybrid hairpin 2 solution for 2 hours under a certain condition;

and 4, adding a proper amount of DNA forceps obtained in the step 2 into the solution obtained in the step 3, incubating, directly recording fluorescence signals of FAM and Cy5 by using a fluorescence spectrophotometer, and calculating the concentration of ochratoxin A in the solution to be detected by using a standard curve method.

2. The ochratoxin A two-color fluorescence detection method based on the hybridization chain reaction and DNA tweezers as claimed in claim 1, wherein the step 1 is specifically as follows: the hairpin-locked aptamer sequence, the hybrid hairpin 1 sequence and the hybrid hairpin 2 sequence were dissolved in 10mM PBS solution containing 0.1mM NaCl, respectively, and then they were heated to 90 ℃ for 5 minutes and cooled to room temperature to form the designed hairpin structure; wherein the pH of the PBS solution is 7.5.

3. The ochratoxin A two-color fluorescence detection method based on the hybridization chain reaction and DNA tweezers as claimed in claim 1, wherein the step 2 is specifically as follows: mixing the sequence of (i) - (c) with the same concentration with a 10mM PBS solution containing 0.1mM NaCl to form a DNA tweezer, and then heating the solution to 90 ℃ for 5 minutes and slowly cooling to room temperature to form a DNA tweezer structure; wherein the pH of the PBS solution is 7.5.

4. The ochratoxin A two-color fluorescence detection method based on the hybridization chain reaction and DNA tweezers as claimed in claim 1, wherein the step 3 is specifically as follows: incubating the test sample with a mixture of 100nM hairpin-locked aptamer, 50nM hybrid hairpin 1, and 50nM hybrid hairpin 2 at 30 ℃ in a 10mM PBS solution containing 0.1mM NaCl for 2 hours; wherein the pH of the PBS solution is 7.5.

5. The ochratoxin A two-color fluorescence detection method based on the hybridization chain reaction and DNA tweezers as claimed in claim 1, wherein the step 4 is specifically as follows: and (3) adding the 300nm DNA forceps obtained in the step (2) into the solution obtained in the step (3), incubating for 30min at 30 ℃, finally, recording fluorescence signals of FAM and Cy5 by a fluorescence spectrophotometer, exciting the fluorescence signal of FAM at 486nm, monitoring at 510nm to 600nm, exciting the fluorescence signal of Cy5 at 640nm, measuring at 650nm to 750nm, and calculating the concentration of ochratoxin A in the solution to be detected by using a standard curve method.