CN113215094A

CN113215094A - Mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, and preparation method and application thereof

Info

Publication number: CN113215094A
Application number: CN202110536528.0A
Authority: CN
Inventors: 陈丽; 何芹; 侯新国; 董明; 孙正; 闫飞; 王令舒; 刘福强; 宋佳; 崔晨; 郭星宏; 胡慧青; 臧楠; 杨蒙蒙
Original assignee: Qilu Hospital of Shandong University
Current assignee: Qilu Hospital of Shandong University
Priority date: 2021-05-17
Filing date: 2021-05-17
Publication date: 2021-08-06
Also published as: CN116042517A

Abstract

The invention provides a mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, a preparation method and application thereof, and belongs to the technical field of biomedicine. The preparation method of the mesenchymal stem cell exosome is simple, and the prepared mesenchymal stem cell exosome can effectively reduce fasting blood glucose of type 2diabetes, reverse islet beta cell dedifferentiation and achieve the effect of treating type 2 diabetes. Can be applied to the preparation of preparations for reducing the blood sugar content, preparations for reversing the dedifferentiation of islet beta cells, biological preparations for treating the islet function damage of type 2diabetes and medicines for treating type 2 diabetes.

Description

Mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, and preparation method and application thereof

Technical Field

The invention relates to the technical field of biomedicine, in particular to a mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, and a preparation method and application thereof.

Background

Type 2diabetes mellitus (T2DM) is a chronic metabolic disease with a complex etiology, and the ongoing complications associated with diabetes severely reduce the quality and longevity of patients.

The main pathogenesis of T2DM is hypofunction of islet beta cells and insulin resistance. The failure of beta cell function is mainly due to a decrease in the number and quality of beta cells. The traditional view is that the reduction in the number of beta cells is a consequence of premature apoptosis, and early research efforts have focused primarily on increasing beta cell survival.

Several studies in recent years have shown that beta cell dedifferentiation is a new mechanism explaining the loss of functional beta cells. The beta cell dedifferentiation means that the normal islet beta cell fades the characteristics and functions of mature cells, degenerates into precursor cells with multi-differentiation potential, or adapts to the phenomenon that the normal islet beta cell is reversely differentiated into other types of cells, and further loses part or all of the insulin secretion capacity. The higher the degree of islet beta cell "dedifferentiation", the more pronounced the decrease in insulin secretion. During the dedifferentiation process, beta cells do not undergo apoptosis, but lose the identity of the original mature beta cells with the reduction of the expression of key beta cell markers, and are converted into endocrine precursor cells expressing transcription factors such as nerve element 3(NGN3) and octamer binding protein-4 (OCT4)), so that the number of the beta cells and the secretion of insulin are further reduced. Therefore, inhibition of the decline in islet beta cell number and function is a very important strategy for treatment of T2 DM.

The stem cells have the characteristics of unique biological characteristics, extremely strong self-renewal capacity, multidirectional differentiation potential, secretion of various cytokines and the like, and are the best seed cells for realizing islet regeneration. The stem cell treatment can ensure that part of diabetics can stop insulin treatment or reduce the dosage of insulin, and the effectiveness and the safety of treating the diabetes are effectively verified. Although there is evidence that Mesenchymal Stem Cells (MSCs) can induce the islet endocrine lineage, there are reports that MSCs do not differentiate into beta cells in vivo, suggesting that MSCs can exert their effects through paracrine.

Exosomes (EXO) are extracellular nanoparticles secreted by cells, containing bioactive molecules, including proteins, lipids, and nucleic acids. Exosomes involved in diabetic glucose metabolism have attracted attention. The research finds that the fat-derived exosome can transfer miR-99b into liver cells, thereby regulating the expression of fibroblast growth factor 21(FGF-21) and participating in glucose metabolism. It has been found that cardiomyocyte-derived exosomes can directly transfer GLUT proteins and glycolytic enzymes to endothelial cells to regulate glucose transport. These studies suggest that exosomes carrying active ingredients may be key factors mediating the therapeutic effect of MSCs in diabetes. Evidence suggests that exosomes have many advantages over other nanoparticles, and may be a potential "smart" nanomedicine for diabetes treatment.

It has now been found that mesenchymal stem cell exosomes can reduce blood glucose levels in T2DM rats by enhancing peripheral organ insulin sensitivity and reducing islet destruction, can restore T2DM glucose homeostasis by promoting GLUT4 expression and membrane transport in muscle and insulin-dependent hepatic glycogen storage, and can also alleviate insulin secretion dysfunction in T2DM by inhibiting STZ-induced β -cell apoptosis. However, the effect of the mesenchymal stem cell exosome on islet beta cell dedifferentiation has not been studied yet, and the obtained bone marrow mesenchymal stem cell exosome for reversing the islet beta cell dedifferentiation of type 2diabetes has important significance for promoting the islet function of type 2diabetes and improving the treatment effect of diabetes.

Disclosure of Invention

The invention aims to provide a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes, and a preparation method and application thereof, so as to solve at least one technical problem in the background technology.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells with type 2diabetes, wherein the exosome is an exosome containing miR-146a secreted by mesenchymal stem cells.

Preferably, the exosome is an exosome containing miR-146a secreted by bone marrow mesenchymal stem cells.

Preferably, the exosome is an exosome containing miR-146a secreted by umbilical cord mesenchymal stem cells.

In a second aspect, the invention provides a preparation method of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes, wherein the exosome is an exosome containing miR-146a secreted by mesenchymal stem cells and comprises the following steps:

flushing the marrow cavity with complete culture medium to obtain marrow;

inoculating and culturing the marrow fluid, and replacing a new complete culture medium after a certain time; the culture was carried out in the subsequent culture using DMEM/F12 complete medium for FBS + double antibody;

culturing to a target fusion degree and then carrying out passage; washing the cell surface with PBS, adding appropriate pancreatin to digest the cell, and subculturing;

when subculture is carried out until the 3 rd to 4 th generation reaches the target fusion degree, replacing the subculture with a complete culture medium containing no exosome serum, and collecting cell supernatant after culturing for a certain time;

centrifuging the supernatant, removing residual cells and debris, filtering, adding an exosome extraction reagent, centrifuging, and precipitating to obtain exosomes.

Preferably, exosome is extracted using the exosome-extracting reagent, exotquick-TCTM.

In a third aspect, the invention provides a preparation method of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes, wherein the exosome is an exosome containing miR-146a secreted by mesenchymal stem cells and comprises the following steps:

cutting the umbilical cord into small segments under aseptic conditions, fully washing, and removing arteriovenous of the umbilical cord;

cutting the umbilical cord into small sections, adhering the umbilical cord sections to the wall in a culture dish, and placing the umbilical cord sections in a culture box for culture;

carrying out amplification culture on umbilical cord mesenchymal stem cells in an in-vitro culture system, collecting supernatant after the amplification culture, carrying out ultragradient centrifugation, and extracting by using an exosome extraction reagent to obtain exosomes.

In a fourth aspect, the invention provides an application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a preparation for reducing blood content, wherein the exosome is an exosome secreted by mesenchymal stem cells.

In a fifth aspect, the invention provides an application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a preparation for reversing de-differentiation of the islet beta cells, wherein the exosome is an exosome secreted by the mesenchymal stem cells.

In a sixth aspect, the invention provides an application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a biological preparation for treating islet function injury of type 2diabetes, wherein the exosome is an exosome secreted by the mesenchymal stem cells.

In a seventh aspect, the invention provides an application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a medicament for treating type 2diabetes, wherein the exosome is an exosome secreted by mesenchymal stem cells.

The invention has the beneficial effects that: the new application of the mesenchymal stem cell exosome in preparing the medicament for treating type 2diabetes and the new application in preparing the medicament for reversing islet beta dedifferentiation are put forward for the first time; can effectively reduce fasting blood glucose of type 2diabetes, promote insulin secretion, reverse dedifferentiated beta cells, improve pancreatic islet hypofunction to a certain extent, and achieve the effect of treating type 2 diabetes; the preparation method of the miR-146 a-rich mesenchymal stem cell exosome is simple to operate and high in efficiency.

Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a transmission electron microscope image of exosome of bone marrow-derived mesenchymal stem cells according to example 1 of the present invention; the scale in the figure is 100 nm.

FIG. 2 is a schematic diagram showing the identification result of the exosome-marker western-blot described in embodiment 1 of the present invention.

FIG. 3 is a schematic diagram of the change of the exosome intervention therapy versus the blood glucose curve according to example 1 of the present invention.

Fig. 4 is a graphical representation of the results of the effect of exosome intervention on glucose tolerance as described in example 1 of the present invention.

FIG. 5 is a graphical representation of the results of the effect of the exosome-depleting therapy described in example 1 of the present invention on insulin sensitivity.

FIG. 6 is a schematic representation of serum insulin levels as described in example 1 of the present invention.

FIG. 7 is a graphical representation of the effect of the exosome-depleting therapy described in example 1 of the present invention on islet beta cell dedifferentiation.

FIG. 8 is a schematic diagram showing the effect of miR-146 a-knocked-down exosomes on blood glucose curve change in example 1 of the present invention.

FIG. 9 is a schematic diagram showing the effect of miR-146a knock-down exosomes on islet beta cell dedifferentiation in example 1 of the present invention.

FIG. 10 is a diagram of induced differentiation of umbilical cord mesenchymal stem cells according to example 2 of the present invention.

FIG. 11 is a schematic diagram of the phenotypic identification of umbilical cord mesenchymal stem cells according to example 2 of the present invention.

FIG. 12 is a transmission electron micrograph of exosomes according to example 2 of the present invention; the scale in the figure is 100 nm.

FIG. 13 is a schematic diagram showing the result of identifying an exosome-marker western-blot in example 2 of the present invention.

FIG. 14 is a graphical representation of the effect of the exosome-depleting therapy of example 2 of the present invention on islet beta cell dedifferentiation.

FIG. 15 is a graph showing the effect of exosomes according to example 2 on the change of blood glucose curve.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below by way of the drawings are illustrative only and are not to be construed as limiting the invention.

It will be understood by those skilled in the art that, unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the prior art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

As used herein, the singular forms "a", "an", "the" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and/or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

For the purpose of facilitating an understanding of the present invention, the present invention will be further explained by way of specific embodiments with reference to the accompanying drawings, which are not intended to limit the present invention.

It should be understood by those skilled in the art that the drawings are merely schematic representations of embodiments and that the elements shown in the drawings are not necessarily required to practice the invention.

Example 1

Bone marrow-derived mesenchymal stem cells (bmmscs) exist in the bone marrow stroma, and have self-renewal and multipotentiality. The bmMSC can be induced and differentiated into different tissue cells such as bone, cartilage, fat, nerve, myoblast and the like in vitro, and is a hotspot and key point of research on tissue repair and regeneration medicine. bmMSC exosomes (exosomes, bmMDEs) are considered as promising cell-free therapies as important manifestations of the paracrine pathway due to their diverse biological activities and intercellular communication functions. The RNA carried by the exosomes is mainly miRNA, and the miRNA is proved to play a crucial role in regulating the function of islet beta cells. Exosomes (exosomes) are vesicles of about 100nm in diameter, encapsulated by a lipid bilayer. Cell-to-cell communication is performed by transmitting RNA (mRNA, miRNA and other RNA), proteins and lipids contained in the vesicles, affecting various vital activities including cytokine production, cell proliferation, apoptosis and metabolism.

In embodiment 1 of the present invention, a type 2diabetes model is established by high fat diet + STZ induction, bmMSC-derived exosome stem prognosis is performed, and changes in blood glucose, glucose tolerance, insulin sensitivity, serum insulin level, and islet β cell dedifferentiation level of a rat after the exosome stem prognosis are detected, respectively. Functional miR-146a is screened out according to miRNA high-throughput sequencing, an exosome stem is extracted to pre-treat type 2 diabetic rats by establishing a miR-146a stable knockdown cell line, and the miR-146a has a positive effect on the aspect that exosome reverses islet beta cell dedifferentiation. miR-146a rich in bmMSC exosome can improve blood sugar of type 2diabetes rats, reverse islet beta cell dedifferentiation and play a role in treating type 2 diabetes.

In this example 1, the test materials used were all conventional in the art and commercially available.

In this example 1, the extraction and isolation of mesenchymal stem cells (bmmscs) from bone marrow comprises:

(1) separation of the femur: male SD rats of about 4 weeks of age were selected, sacrificed with excess anesthetic, soaked in 75% ethanol for 5 minutes, then transferred to a clean bench and the bilateral femurs and tibiae of the rats were separated under sterile conditions.

(2) Obtaining bone marrow: the ends of the femur were cut off, the marrow cavity was exposed, the cavity was flushed with complete medium (79% DMEM/F12 medium + 20% FBS + 1% double antibody) drawn up with a 5ml syringe, and the bone marrow was harvested by repeated tapping 2-3 times.

(3) Plate preparation: plating was performed on the basis of inoculating one of six well plates with approximately 2.5ml of bone marrow fluid extracted from one femur per well. The cells were incubated overnight at 37 ℃ in a 5% CO2 cell incubator and 24 hours later the complete medium was replaced with a fresh one. The culture was performed in the subsequent culture using 10% FBS + 1% double antibody DMEM/F12 complete medium.

(4) Passage: when the cell fusion degree reaches 90%, passage can be carried out. The cell surface was washed with PBS, cells were digested with the appropriate trypsin and subcultured as per well as transferred to a 25cm2 flask. Passage 3-4 cells were selected for subsequent experiments.

In this embodiment, the extraction and identification of bmMSC-derived exosomes includes:

when the bmMSCs fused to around 50% in the 3-4 th passages, the medium was replaced with a complete medium containing no exosome-containing serum, and the cell supernatant was collected after 48 hours. The supernatant was centrifuged at 2000g for 20 min at 4 ℃ to remove residual cells and debris. Filtering with a 0.22 mu m sterile filter, transferring the conditioned medium into a new 15ml centrifuge tube, adding an Exoquick-TCTM exosome extraction reagent, centrifuging at 4 ℃ for 30 minutes at 5000g after overnight at 4 ℃, and precipitating to obtain the exosome. All exosome-containing pellets were resuspended in PBS or dissolved in RNA lysis buffer and stored at-80 ℃ for subsequent experiments.

Detecting the size and shape of the extracted exosome directly by using a transmission electron microscope method, wherein the result is shown in figure 1; the exosome markers TSG101, CD9 and the endoplasmic reticulum marker protein Calnexin were detected by a western-blot method and further identified, and the results are shown in FIG. 2.

In this example 1, an experiment was conducted to investigate the effect of bmMSC-derived exosomes on the dedifferentiation of islet beta cells in type 2 diabetic rats, as follows:

(1) establishment of type 2diabetes model and exosome intervention induced by high fat diet and STZ

Male SD rats of 4 weeks of age were used to construct a model of type 2 diabetes. After one week of adaptive feeding, feeding with high fat diet for 4 weeks, weighing after 12 hr of fasting, and then dosing at 30mg/kgInjecting STZ into abdominal cavity, and continuing high fat diet. The fasting blood glucose of the rat is measured every other day after the STZ injection, and the fasting blood glucose measured for 2 times continuously is more than or equal to 16.7mmol/L, namely the model establishment success of the type 2diabetes (T2 DM). Starting on day 5 after STZ injection, tail vein was injected with bmMSCs (5X 10)⁶Cells/rat, bi-weekly for 5 cycles) or bmMSCs-derived exosomes (bmMDEs, 10mg/kg, injected every 3 days for 10 weeks). The normal control group and the T2DM group were injected with an equal volume of PBS (0.2ml) into the tail vein once every 3 days for 10 weeks.

(2) The blood glucose changes of the rats were measured.

Rats were monitored for blood glucose weekly before and after STZ injection, data were recorded and blood glucose curves were generated for statistical analysis. The results are shown in FIG. 3, after STZ injection, model rats rapidly elevated fasting plasma glucose and >16.7 mmol/L. bmMSC-derived exosomes significantly improved hyperglycemia compared to the T2DM group, and blood glucose remained in a sustained low-level state after the intervention was ended.

(3) Detecting the glucose tolerance and the insulin sensitivity of the rats.

The test was performed 1 week after the last intervention. And (3) detecting glucose tolerance: before the experiment, rats are fasted and are not forbidden to drink for 14-16 hours, and after the weight is weighed, 50% glucose solution is injected into the abdominal cavity according to the dose of 1.5 g/kg. Rats were monitored for blood glucose at 0, 30, 60, 120, 180 minutes, respectively. And (3) detecting insulin sensitivity: before the experiment, rats are fasted and are not forbidden to drink for 4-6 hours, and insulin is injected into the abdominal cavity according to the dose of 2IU/kg after weighing the weight. Rats were monitored for blood glucose at 0, 30, 60, 120, 180 minutes, respectively. As can be seen from fig. 4 and 5, the bmMSC-derived exosome intervention group T2DM rats had a significant improvement in impaired glucose tolerance and impaired insulin sensitivity, mainly manifested by a decrease in fasting blood glucose level, a significant decrease in the increase/decrease in glucose/insulin load amplitude compared to the T2DM group, and a more rapid peak recovery with a lower area under the curve compared to the model group.

(4) Rat serum insulin levels were measured.

Rats are fasted overnight without drinking prohibition, and after anesthesia with 10% chloral hydrate, the thoracic cavity is opened rapidly layer by layer, the apex of the heart is punctured for blood collection, and serum insulin levels are detected by using an Elisa kit. As can be seen from FIG. 6, the level of serum insulin was significantly increased after the exosome was dried. In fig. 6, the leftmost border is Control + PBS, the middle border is T2DM + PBS, and the rightmost border is T2DM + bmMDEs.

(5) Detecting the dedifferentiation condition of the islet beta cells.

Rat pancreatic tissue paraffin section line insulin and islet beta cell marker PDX1/FOXO1, islet progenitor cell marker NGN3/OCT4 immunofluorescence staining. As shown in the results of fig. 7, the expression of the T2DM islet beta cell markers (PDX1, FOXO1) was decreased and the expression of the islet progenitor cell markers (NGN3, OCT4) was significantly increased compared to the normal control group; after 10 weeks of exosome intervention, PDX1, FOXO1 expression were up-regulated, NGN3, OCT4 expression were down-regulated. The above results indicate that bmMSC-derived exosomes are able to reverse islet beta cell dedifferentiation. In fig. 7, the leftmost border is Control + PBS, the middle border is T2DM + PBS, and the rightmost border is T2DM + bmMDEs.

In this example 1, in order to study the mechanism of mesenchymal stem cell exosome for reversing islet beta cell dedifferentiation, influence of miR-146a enriched in exosome on islet beta cell dedifferentiation of type 2diabetes rat is determined, sponge inhibitor transfection is performed on bone marrow mesenchymal stem cells, and exosome stem is extracted from type 2diabetes rat. The expression of miRNA-146a in the exosome is reduced by transfecting the stem cells, the effect of the exosome on reversing beta cells is reduced after the miRNA-146 is reduced, and the importance of miRNA-146a in the function of the exosome is reversely proved.

(1) Lentivirus transfection of bmMSCs and exosome extraction

1) After being trypsinized, the 2 nd generation bmMSCs with good cell state were cultured in a 12-well plate at 37 ℃ in a cell culture box containing 5% CO 2.

2) Medium was changed when cell fusion reached around 50%, replaced with new complete medium, lentiviral negative control (sponge inhibitor NC sequence: 5 'TTCTCCGAACGTGTCACGT 3') of a gas turbine engine,

The miR-146a knockdown lentivirus (miR-146a sphere inhibitor sequence: 5 'TAACCCATGGAATTCAGTTCTCACGATAACCCATGGAATTCAGTTCTCAACCGGTAACCCATGGAATTCAGTTCTCATCACAACCCATGGAATTCAGTTCTCATTTTTTC 3') was cultured continuously in a cell culture box containing 5% CO2 at 37 ℃.

3) The medium was replaced with new one after 12 hours.

4) After 48 hours of transfection, puromycin was added to each well to establish a miR-146a knockout stable transgenic cell line. RNA/protein extraction was performed to examine transfection efficiency.

5) Adding an Exoquick-TCTM exosome extraction reagent to extract miR-NC KD group exosomes (bmMDEs)^miR-NC ^KD) And miR-146a KD (bmMDEs)^miR-146a ^KD) Group exosomes.

(2) Action of miR-146a on dedifferentiation of blood sugar and islet beta cells of type 2 diabetic rat

After STZ injection, the fasting blood sugar of rats is more than or equal to 16.7 mmol/L. Except for the first portion of rats used, the remaining rats were divided into the following 4 groups (n-7/group): normal control group, T2DM group, T2DM + bmMDEs^miR-NC ^KDGroup, T2DM + bmMDEs^miR-146a ^KDAnd (4) grouping. Starting on day 5 after STZ injection, two bmMDEs (10mg/kg) were resuspended in 0.2ml PBS and injected via tail vein into rats every 3 days for 10 weeks. The normal control group and the T2DM group were injected with an equal volume of PBS into the tail vein once every 3 days for 10 weeks.

The results are shown in FIG. 8, and the average increase of the fasting plasma glucose level 1 week after all the STZ-injected rats was observed

With T2DM + PBS group and bmMDEs^miR-146a ^KDComparison of intervention groups, bmMDEs^miR-NC ^KDThe fasting blood glucose of the rats in the pre-treated group is obviously reduced. Rat pancreatic tissue paraffin section line insulin and islet beta cell marker PDX1/FOXO1, islet progenitor cell marker NGN3/OCT4 immunofluorescence staining. As shown by the results in FIG. 9, the samples were compared with the T2DM + PBS group and the T2DM + bmMDEs^miR-146a ^KDGroup comparisons, bmMDEs^miR-NC ^KDThe expression levels of PDX1 and FOXO1 in the islets of rats after treatment were elevated in T2DM, while the expression of NGN3 and OCT4 was reduced. These data indicate that miR-146a carried by bmMDEs improves T2DM ratsBlood sugar and the reversal of beta cell dedifferentiation have important roles. In FIG. 9, the four vertical boxes are, from left to right, Control + PBS, T2DM + PBS, T2DM + bmMDEs^miR-NC ^KD，T2DM+bmMDEs^miR-146a ^KD。

The results show that the exosome from the bmMSC can improve the blood sugar of a type 2 diabetic rat, promote the secretion of insulin, reverse the dedifferentiation of islet beta cells, further recover the hypofunction of the islet, and achieve the effect of treating type 2diabetes, and miR-146a rich in the exosome plays an important role in the process.

Example 2

In embodiment 2 of the present invention, the mesenchymal stem cell exosome is prepared by the following method:

(1) under aseptic conditions, the cord was cut into small pieces, washed thoroughly, and the arteriovenous passages of the cord were removed.

(2) Cutting the umbilical cord segment, placing in a culture dish, directly attaching to the wall of the dish bottom, culturing in a 5% CO2 incubator at 37 deg.C, and adding complete culture medium after 4 hr. The liquid was changed every 3 days.

(3) And performing amplification culture on the umbilical cord mesenchymal stem cells in an in-vitro culture system, collecting supernatant after the amplification culture, and performing ultragradient centrifugation to obtain the umbilical cord source mesenchymal stem cell exosome.

In the step (1), the washing liquid is: sterile saline + 1% double antibody.

In the step (2), the complete culture medium for culture is 20% FBS + 1% double-antibody low-sugar alpha-MEM culture solution.

In the step (3), before collecting the supernatant and extracting the exosomes, the culture medium is replaced by 10% exosome-free FBS + 1% green chain double-antibody low-sugar alpha-MEM culture solution.

The umbilical cord-derived mesenchymal stem cell exosome has the markers of CD44 and CD 90.

The umbilical cord-derived mesenchymal stem cell exosome is derived from a human umbilical cord.

In this example 2, the apparatus and reagents and materials used are well known to those skilled in the art and commercially available. The methods used, such as HE staining, Western blot and the like, are all methods well known in the art, and can be performed through descriptions of textbooks or related documents, and are not described in detail.

In this example 2, the isolation and identification of human mesenchymal stem cells includes:

under the aseptic condition, cutting the umbilical cord into small sections, fully washing, removing the artery and vein of the umbilical cord, cutting the small sections of the umbilical cord into pieces, placing the small sections of the umbilical cord into a culture dish, directly attaching the small sections of the umbilical cord to the wall of the culture dish, placing the small sections of the umbilical cord into a culture box at 37 ℃ and 5% CO2 for culture, and adding 20% FBS and 5% green chain double-resistant low-sugar alpha-MEM culture solution after 4 hours. After 3d, the culture medium was changed every 3 d. And after 70-80% of MSC is fused, digesting with 0.25% of pancreatin, subculturing, and taking P3 generation cells for experiment. Fig. 10 shows the osteogenic induction of adipogenic cells by taking P3 generation cells, wherein fig. 10(a) shows adipogenic differentiation, fig. 10(b) shows osteogenic differentiation, and phenotypes of CD44, CD90, CD34 and CD45 are identified, as shown in fig. 11, and the results prove that the isolated cells are mesenchymal stem cells.

In this example 2, the P3 generation MSC was planted in a culture dish, when the cell fusion reached 60-80%, the cell was washed with PBS, the culture medium without exosome serum was replaced, and after culturing for 48-72 h, the cell supernatant was collected, centrifuged at 2000rpm for 10min, and then at 10000rpm for 30min to remove the cell or cell debris. MSC exosomes were isolated and extracted using exosome extraction kit according to the instructions and observed under an electron microscope (as shown in FIG. 12). Western blot is used for identifying the expression of MSC exosome-associated proteins CD63 and CD81, the result is shown in figure 13, and the collected proteins express CD81 and CD63, which indicates that mesenchymal stem cell exosomes are obtained by separation.

Effect of MSCs exosomes on islet β cell dedifferentiation in vitro:

after the islet beta cell strains are cultured in a high-sugar medium for 72h, different concentrations of EXO (0, 10, 20 and 30 mu g/ml) are respectively intervened for 24h, and the mRNA expression levels of PDX1, MafA, INS1, INS2, Ngn3, Nanog and Oct4 genes of the beta cells of each group are detected. As shown in fig. 14, the high sugar decreased the expression of the β cell surface markers (PDX1, MafA, INS1, INS2) and increased the expression of the dedifferentiation markers (Ngn3, Nanog, Oct4) compared to the control group; following EXO, the extent of glycotoxicity-induced beta cell dedifferentiation was reduced.

In FIG. 14, the effect of MSCs exosomes on islet beta cell de-differentiation in vitro (PDX 1: a key regulator of insulin gene expression, binding to the A3 element of insulin gene, regulating insulin gene expression; MafA: a transcription factor of basic leucine zipper (bZIP) structure, binding to the promoter of insulin gene, initiating insulin gene expression; Ngn 3: an activator of endocrine precursor cell gene transcription, mainly functioning; Nanog: embryonic stem cell core transcription factor; Oct 4: octamer binding protein-4, both classical markers reflecting cell pluripotency.)

In this example 2, umbilical cord MSC exosomes reduced STZ-induced fasting plasma glucose in T2DM rats as follows:

establishment of STZ-induced T2DM rat model:

selecting about 60g SD rats with the age of 4 weeks, feeding the SD rats with High Fat Diet (HFD) for 4 weeks, then fasting for 12 hours, carrying out intraperitoneal injection of STZ citric acid solution once according to the dose of 30mg/kg, and after 72 hours, determining that the tail vein whole blood glucose is more than 16.7mmol/L, which indicates that the model building of the diabetes mellitus model is successful; the control group was injected with an equal amount of citrate buffer.

Tail intravenous administration of MSC exosomes reduced STZ-induced fasting plasma glucose in T2DM rats:

STZ-induced T2DM model, 100 μ l of 10 μ g/ml MSCs exosomes were infused into the tail vein on day 5 after STZ injection, once every other day for 10 weeks; the fasting blood glucose of the rats was measured, and the results are shown in fig. 15, and the fasting blood glucose of the rats in the MSC exosome treated group is obviously lower than that in the untreated group (P < 0.05).

In this embodiment 2, the preparation method of the umbilical cord-derived mesenchymal stem cell exosome is simple and feasible to operate, and provides a new application of the umbilical cord-derived mesenchymal stem cell exosome in preparation of a medicament for treating type 2diabetes and a new application of the umbilical cord-derived mesenchymal stem cell exosome in preparation of a preparation for reversing islet beta cell dedifferentiation, and the umbilical cord-derived mesenchymal stem cell exosome can effectively reduce fasting blood glucose of type 2diabetes, reverse islet beta cell dedifferentiation, and achieve an effect of treating type 2 diabetes.

The above description is only a preferred embodiment of the present disclosure and is not intended to limit the present disclosure, and various modifications and changes may be made to the present disclosure by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present disclosure should be included in the protection scope of the present disclosure.

Although the present disclosure has been described with reference to the specific embodiments shown in the drawings, it is not intended to limit the scope of the present disclosure, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive faculty based on the technical solutions disclosed in the present disclosure.

Claims

1. The mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes is characterized in that the exosome is an exosome containing miR-146a secreted by the mesenchymal stem cells.

2. A mesenchymal stem cell exosome for reversing de-differentiation of type 2diabetes islet beta cells according to claim 1, wherein the exosome is miR-146 a-containing exosome secreted by bone marrow mesenchymal stem cells.

3. The mesenchymal stem cell exosome for reversing de-differentiation of type 2diabetes islet beta cells according to claim 1, wherein the exosome is a miR-146 a-containing exosome secreted by umbilical cord mesenchymal stem cells.

4. A preparation method of a mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, wherein the exosome is an exosome containing miR-146a secreted by the mesenchymal stem cells, and is characterized by comprising the following steps of:

flushing the marrow cavity with complete culture medium to obtain marrow;

5. The method for preparing mesenchymal stem cell exosomes for reversing de-differentiation of islet beta cells for type 2diabetes according to claim 4, wherein exosomes are extracted using exosome extraction reagent Exoquick-TCTM.

6. A preparation method of a mesenchymal stem cell exosome for reversing dedifferentiation of islet beta cells of type 2diabetes, wherein the exosome is an exosome containing miR-146a secreted by the mesenchymal stem cells, and is characterized by comprising the following steps of:

7. The application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparing a preparation for reducing blood sugar content is characterized in that the exosome is an exosome secreted by mesenchymal stem cells.

8. An application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a preparation for reversing de-differentiation of the islet beta cells is characterized in that the exosome is an exosome secreted by the mesenchymal stem cells.

9. An application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a biological preparation for treating islet function injury of type 2diabetes is characterized in that the exosome is an exosome secreted by mesenchymal stem cells.

10. An application of a mesenchymal stem cell exosome for reversing de-differentiation of islet beta cells of type 2diabetes in preparation of a medicament for treating type 2diabetes is characterized in that the exosome is an exosome secreted by mesenchymal stem cells.