CN113215034A

CN113215034A - Bifidobacterium breve capable of relieving Alzheimer's disease and increasing content of fecal acetic acid and application thereof

Info

Publication number: CN113215034A
Application number: CN202110481579.8A
Authority: CN
Inventors: 王刚; 朱广素; 陈卫; 赵建新; 张灏
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-04-30
Filing date: 2021-04-30
Publication date: 2021-08-06
Anticipated expiration: 2041-04-30
Also published as: CN113215034B

Abstract

The invention discloses a bifidobacterium breve capable of relieving Alzheimer's disease and increasing fecal acetic acid content and application thereof, and belongs to the field of microorganisms. The bifidobacterium breve CCFM1179 provided by the invention can obviously improve cognitive and memory disorders of mice with Alzheimer's disease, reduce the content of Abeta 1-42 in the brains of the mice with Alzheimer's disease, improve the levels of brain-derived neurotrophic factors and postsynaptic density proteins in the brains of the mice with Alzheimer's disease, and improve the content of 5-hydroxytryptamine in the sera of the mice with Alzheimer's disease; and can regulate intestinal flora and its metabolites. The bifidobacterium breve CCFM1179 provided by the invention can be used for preparing a pharmaceutical composition for relieving dementia and Alzheimer's disease and improving cognitive impairment, can also be used as a microecological preparation to be applied to medicines, fermented foods or health-care products, and has very wide application prospect.

Description

Bifidobacterium breve capable of relieving Alzheimer's disease and increasing content of fecal acetic acid and application thereof

Technical Field

The invention relates to a Bifidobacterium breve capable of relieving Alzheimer's disease and increasing fecal acetic acid content and application thereof, belonging to the field of microorganisms.

Background

Alzheimer's disease is also called senile dementia, is a neurodegenerative disease and is clinically manifested by the decline of learning and cognition ability and the gradual loss of self-care ability of life. The clinical characteristics of Alzheimer disease are that the disease is insidious and progressive, and the disease dies due to complications within 10 to 20 years. Patients with alzheimer's disease account for 60-80% of all dementia patients, and are the most common type of dementia.

With regard to the pathogenesis of alzheimer's disease, there are currently over ten hypotheses in modern medicine, and the studies are mainly made on the cholinergic loss theory, the Tau protein hyperphosphorylation theory, the oxidative stress theory, the beta amyloid toxicity theory, the inflammatory factor theory, and the like. The two most characteristic pathological changes of alzheimer's disease are senile plaques formed by a β deposition and neurofibrillary tangles caused by intracellular abnormally phosphorylated Tau protein aggregation. Since 1992, the amyloid cascade hypothesis has played an important role in explaining the pathogenesis of alzheimer's disease. A beta is considered to be a key factor of pathogenesis of Alzheimer's disease, wherein A beta 1-42 is easy to form fibrous amyloid protein aggregates which are called as main components of senile plaques.

Currently, about 5000 million people worldwide are afflicted with alzheimer's disease, and the number of this group is expected to continue to grow. However, the development of therapeutic drugs for Alzheimer's disease has been relatively slow. Current treatment modalities for Alzheimer's disease include drug therapy, immunotherapy, and dietary supplement natural extract therapy. Acetylcholinesterase inhibitors (AChEI) are by far the most widely used therapeutic drugs for alzheimer's disease in the clinic. Of the 5 drugs approved by the FDA for the treatment of alzheimer's disease, 4 of Tacrine (Tacrine), Donepezil (Donepezil), galantamine (Galanthamine), and Rivastigmine (Rivastigmine) are acetylcholinesterase inhibitors, except that memantine is an NMDA receptor antagonist. Clinically, 5 kinds of alzheimer disease treatment drugs approved by FDA belong to symptomatic treatment drugs, and drugs affecting the disease process are still in the preliminary research stage. In addition, the single medicine has no obvious effect and great side effect of neurogenic medicine. Therefore, it is important to explore a method for intervening in the early stage of Alzheimer's disease to delay the disease process, and the method has a very wide market potential.

The "brain-gut axis" is a new concept proposed in recent years, which regulates the function and behavior of the brain mainly through the neural, endocrine and immune pathways as a two-way communication system between intestinal bacteria and the brain. With the continuous and intensive research on the brain-intestine axis, it is found that the probiotics can regulate the composition of intestinal flora through vagus nerve, nerve immune system, neurotransmitter, microorganism metabolites and the like, so as to relieve the neurological diseases. Clinical tests prove that the composition of the intestinal flora can be adjusted through probiotic bacteria, prebiotics and fecal bacteria transplantation treatment, and the nervous diseases of rodent such as depression and autism can be effectively improved. At present, the variety of the known 'mental probiotics' for preventing and treating the neurological diseases is too deficient; secondly, the complexity of the intestinal flora and the difficulty of the research method are few in clinical research on the intestinal flora, and the mechanism of the intestinal flora participating in organism metabolism and interaction is not clear; therefore, screening out a probiotic which can mediate intestinal flora to relieve Alzheimer's disease, deeply excavating the function of the probiotic and developing a probiotic product with higher health care value is very important. In addition, the development of probiotic bacteria will open up new ways and solutions for alleviating alzheimer's disease through dietary intervention.

Disclosure of Invention

The first purpose of the invention is to provide a Bifidobacterium breve strain CCFM1179(Bifidobacterium breve), which is preserved in Guangdong province microorganism strain preservation center at 31/3/2021, with the preservation address of Guangzhou city Michelo No. 100 college No. 59 building No. 5 building Guangdong province microorganism research institute, and the preservation number is GDMCC No. 61589.

The strain of the invention has the following functions:

(1) improving learning and cognitive disorders in a mammal;

(2) delaying the progression of Alzheimer's disease in a mammal;

(3) mediates the function of regulating intestinal flora and metabolites thereof by the brain intestinal axis.

It is a second object of the present invention to provide a composition comprising said bifidobacterium breve CCFM 1179.

In one embodiment, the number of cells of Bifidobacterium breve subspecies longum in the composition is not less than 1X 10⁸CFU/g or 1X 10⁸CFU/mL。

In one embodiment, the composition is a functional food or a medicament.

In one embodiment, the functional food is prepared by fermentation of said bifidobacterium breve.

In one embodiment, the composition is a fermented food product, including a solid food product, a liquid food product, or a semi-solid food product.

In one embodiment, the type of fermented food product comprises a dairy product, a soy product, or a fruit and vegetable product.

In one embodiment, the dairy product comprises fermented milk, flavored fermented milk, fermented milk beverages, and the like, cream, cheese, milk-containing beverages, or milk powder; the bean product comprises soymilk or soymilk powder; the fruit and vegetable product comprises a fruit and vegetable product prepared from at least one of Chinese cabbage, white radish, cucumber, beet, yellow peach or waxberry product.

In one embodiment, the medicament further comprises a pharmaceutically acceptable carrier.

In one embodiment, the carrier includes one or more of fillers, binders, wetting agents, disintegrants, lubricants, flavoring agents, which are generally used in medicine.

In one embodiment, the dosage form of the medicament is granules, capsules, tablets, pills or oral liquid.

The invention also provides application of the bifidobacterium breve in preparing fermented food and health care products for relieving cognitive impairment, delaying the progress of Alzheimer's disease and regulating intestinal flora.

In one embodiment, the use is for the manufacture of a food or pharmaceutical product for ingestion into a human being comprising said bifidobacterium breve as a major component.

In one embodiment, the delaying of the progression of alzheimer's disease comprises at least one of (a) - (d):

(a) reducing beta-amyloid polypeptide-42 (a β 1-42) deposition in the brain of a mammal;

(b) increasing neurotransmitter levels in the brain of the mammal;

(c) increasing the level of synaptic protein in the brain of the mammal;

(d) increasing the level of 5-hydroxytryptamine (5-HT) in the serum of a mammal;

in one embodiment, the intestinal flora includes, but is not limited to, Akkermansia muciniphila (Akkermansia muciniphila).

In one embodiment, the mammal includes, but is not limited to, a human.

The invention also provides a microbial inoculum containing the bifidobacterium breve CCFM1179, which is powder obtained by drying a bacterial liquid containing the bifidobacterium breve CCFM 1179.

In one embodiment, the drying is vacuum freeze drying or other bacterial liquid drying process.

In one embodiment, the microbial inoculum contains Bifidobacterium breve cells in an amount of 1 × 10 or more⁸CFU/g。

The invention also provides a method for preparing the Bifidobacterium breve CCFM1179 microbial inoculum, which comprises the steps of inoculating 2-4% of the Bifidobacterium breve CCFM1179 by mass of the culture medium into the culture medium, then culturing for 24-48h under the anaerobic condition at the temperature of 35-39 ℃, washing for 2-4 times by using phosphate buffer solution with the pH value of 6.8-7.2, and re-suspending by using a cell protective agent to ensure that the microbial concentration reaches 10¹⁰CFU/mL; then, the suspension is pre-cultured for 50-70min under the anaerobic condition at the temperature of 37 ℃, then is pre-frozen for 8-14h at the temperature of-15 to-20 ℃, and finally is subjected to vacuum freeze drying to obtain the zymophyte agent.

In one embodiment, the medium is MRS medium containing 0.05% L-cysteine hydrochloride at a pH of 6.8 ± 0.2.

In one embodiment, the medium is sterilized at 123 ℃ for 15-25 min.

In one embodiment, the protectant is a lyoprotectant prepared from a solution containing 100g/L to 150g/L skimmed milk powder, 100g/L to 150g/L maltodextrin, 140g/L to 160g/L trehalose.

The invention has the beneficial effects

The bifidobacterium breve CCFM1179 has good growth characteristics, can obviously improve cognitive and memory disorders of mice with Alzheimer's disease, reduce the content of Abeta 1-42 in the brains of the mice with Alzheimer's disease, improve the levels of brain-derived neurotrophic factors and postsynaptic density proteins in the brains of the mice with Alzheimer's disease, obviously improve the content of 5-hydroxytryptamine in the sera of the mice with Alzheimer's disease, improve the level of a flora metabolite acetic acid in the feces of the mice with Alzheimer's disease, effectively regulate the structure of intestinal flora of the mice with Alzheimer's disease, improve the diversity degree of species of the intestinal flora and improve the relative abundance of the beneficial intestinal bacterium, namely, the akkermansoniphila. Therefore, the bifidobacterium breve CCFM1179 can be used for preparing a pharmaceutical composition for relieving dementia and Alzheimer's disease and improving cognitive impairment, can also be used as a microecological preparation to be applied to medicines, fermented foods or health-care products, and has very wide application prospect.

Biological material preservation

Bifidobacterium breve CCFM1179(Bifidobacterium breve) is classified and named as Bifidobacterium breve, and is preserved in Guangdong province microorganism strain preservation center at 31.3.2021, with the preservation address of Guangzhou city Michelo No. 100 college No. 59 building, Guangdong province microorganism research institute, and the preservation number is GDMCC No. 61589.

Drawings

FIG. 1 shows the behavioral changes of mice after the Bifidobacterium breve CCFM1179 has been dried. (A) Percent free alternation in the Y maze experiment; (B) in the water maze experiment, mice in each group escape from the incubation period; (C) in the water maze experiment, the residence time ratio of each group of mice in the quadrant where the original platform is located; (D) latency of mice in the memory retention test in the darkness avoidance experiment; wherein P <0.05 and P <0.01, compared to the model group.

FIG. 2 shows the levels of amyloid-beta (A.beta.1-42) in hippocampal tissues of mice after the prognosis of Bifidobacterium breve CCFM 1179. Wherein P <0.05 compared to model group.

FIG. 3 shows the change in the content of synaptophysin in hippocampal tissues of mice after the prognosis of Bifidobacterium breve CCFM 1179. (A) The content of Brain Derived Neurotrophic Factor (BDNF); (B) the content of postsynaptic density protein 95(PSD 95); wherein P <0.05, P <0.01, P <0.001, compared to the model group.

FIG. 4 shows the change in the serum content of 5-hydroxytryptamine (5-HT) in mice after the prognosis of Bifidobacterium breve CCFM 1179. Wherein P <0.05 compared to model group.

FIG. 5 shows the change in concentration of acetic acid in mouse feces after the Bifidobacterium breve CCFM1179 had been dried. Wherein P <0.05, P <0.01, P <0.001, compared to the model group.

FIG. 6 shows the change in the microbiota alpha diversity in the faeces of mice following a dry prognosis with Bifidobacterium breve CCFM 1179. Wherein P <0.01, P <0.001, compared to the model group.

FIG. 7 is a graph showing the change in the microbiota beta diversity in the feces of mice following a dry prognosis with Bifidobacterium breve CCFM 1179. Non-parametric multivariate analysis of variance (PERMANOVA) P <0.004 based on principal coordinate analysis of the Bray-Curtis distance. Wherein dots of the same color represent samples from the same group; the further the distance between samples in the two-dimensional coordinate axis, the greater the abundance difference of the representative species.

FIG. 8 shows the change in relative abundance of Ackermansia viscovorans (Akkermansia muciniphila) in the intestinal tract of mice after the prognosis of Bifidobacterium breve CCFM 1179. Wherein P <0.05 and P <0.01, compared to the model group.

Detailed Description

Example 1 screening and identification of Bifidobacterium breve CCFM1179

Separating and screening strains:

(1) collecting feces of a pure breast-fed male infant with 10 months old in Wuxi city, Jiangsu province by using a disposable sterile feces sampling device, placing a feces sample in a culture medium containing MRS + cysteine with mass percent (0.05% -0.1%) of fructo-oligosaccharide, and placing the feces sample in an anaerobic culture box (N)₂:CO₂:H₂Enrichment in 80:10:10) for 12 h;

(2) the fecal sample is diluted by sterile physiological saline in a gradient way and then coated on a solid plate added with sterile 100 mu g/mL mupirocin and 50U/mL MRS + mass percent (0.05-0.1%) of nystatin L-cysteine hydrochloride for culturing for 24-48 h;

(3) selecting single colony conforming to basic morphology of bifidobacterium to carry out plate streaking purification, and screening and separating out the selected strain;

(4) and (3) culturing the single colony in a liquid MRS + cysteine culture solution with the mass percent (0.05-0.1%) for 24 hours, then performing gram staining, and selecting gram-positive bacteria for subsequent tests.

(II) preliminary identification of Bifidobacterium: fructose-6-phosphate phosphoketolase assay

(1) Culturing the lactobacillus obtained by screening in the step (one) in a liquid MRS + cysteine culture solution with the mass percentage of 0.05-0.1% for 24 hours, and then centrifuging 1mL of culture at 8000rpm for 2 min;

(2) using 0.05M KH of pH6.5 containing 0.05% (mass percent) cysteine₂PO₄Washing the solution twice;

(3) resuspending in 200. mu.L of the above phosphate buffer solution to which 0.25% (mass%) Triton X-100 was added;

(4) adding 50 mu L of mixed solution of 6mg/mL sodium fluoride and 10mg/mL sodium iodoacetate and 50 mu L of fructose-6-phosphate with the concentration of 80mg/mL, and incubating for 1h at 37 ℃;

(5) adding 300 μ L of light amine hydrochloride with concentration of 0.139g/mL and pH of 6.5, and standing at room temperature for 10 min;

(6) respectively adding 200 mu L of 15 percent (mass percent) trichloroacetic acid and 4M HCl;

(7) 200 μ L of 0.1M HCl containing 5% (mass percent) ferric chloride was added, and if the system rapidly turned red, it was positive for F6PPK, and it was preliminarily determined that it was a Bifidobacterium.

Molecular biological identification of Bifidobacterium

(1) And (5) taking 1mL of the thallus screened and activated for 3 generations in the step (II) (cultured for 12-48h) for strain identification, centrifuging at 6000r/min for 3min, and removing the supernatant to obtain the thallus.

(2) Adding 1mL of sterile water to blow and wash the thalli, centrifuging for 1min at 10000r/min, discarding the supernatant to obtain the thalli, and adding 500 mu L of sterile water to resuspend the thalli to be used as a bacterial liquid template.

(3)16S rDNA PCR System:

A. bacterial 16S rDNA, 20 μ LPCR reaction:

27F, 0.5 μ L; 1492R, 0.5 μ L; taq enzyme, 1 μ L; template, 1 μ L; ddH20, 8 μ L.

PCR conditions:

94℃5min；94℃30s；55℃30s；72℃2min；72℃10min；step2-4 30×；12℃2min。

(3) preparing 1% agarose gel, mixing the PCR product with 10000 × Loading buffer, Loading 2 μ L, running at 120V for 30min, and performing gel imaging;

(4) sequencing analysis is carried out on the PCR product of the 16S rDNA, the sequencing result is ATCCTAGGGGAGCGGCGTTCTGCAGAGCGGACGGGTCACCTTGACCGGGTCAGTCACACCGGCGGCCAGCAGGTCCTCGTAGGTGTCGGTGGCGGCGTTGAAGCCTTCGCCATCGGGCAGAGAACGAACCTTGTTGATCACCACGTCGCCGGACACGCCAGCATTCTCGGCAATCTGCTTGATCGGGGCTTCGATGGCGCGGAACACGATGGCGGCACCGGTAGCCTCTTCGCCGGTCAGGGAGGTGACGGCCTCAGCCTTCTCGGCCTTGGCAGCAGCCTGAACGAGGGCCACGCCACCGCCGGGCAGCAGGCCTTCCTCAATGGCGGCCTTGGCGTTACGCACGGCATCTTCGATGCGGTGCTTGCGCTCCTTGGCCTCGACCTCGGTGGCAGCGCCGACCTTGATGACAGCCACGCCGCCGGCCAGCTTGGCCAGACGCTCCTGCAGCTTCTCACGATCGTTAATCGGAA (shown as SEQ ID NO. 1), the obtained sequence result is searched in GenBank and compared with similarity by using BLAST, and the strain with the sequencing result identified as Bifidobacterium breve (Bifidobacterium breve) is selected and preserved at-80 ℃ for standby.

(IV) preparation of Bifidobacterium breve bacterial suspension

Inoculating the activated 3-generation bacterial liquid into 1L of liquid MRS culture medium in an inoculation amount of 2%, shaking, mixing uniformly, and culturing in an anaerobic incubator at 37 ℃ for 24 h. Centrifuging at 8000g/min and 4 deg.C for 15min, removing supernatant, washing with sterile physiological saline containing 0.05% -0.1% L-cysteine hydrochloride for 2 times, centrifuging under the same conditions, removing supernatant, and preserving with 30% glycerol for one week at-80 deg.C. Before animal experiments, the bacterial liquid is centrifuged at 6000r/min for 5min, then is washed twice by sterile normal saline, is resuspended by 10 percent skim milk, and is shaken uniformly, and then the number of viable bacteria is measured by a plate pouring method at the beginning and after one week of frozen storage. The formula of the MRS culture medium is as follows: 10g of beef extract; 10g of tryptone; 5g of yeast powder; 20g of glucose; 5g of anhydrous sodium acetate; MgSO (MgSO)₄·7H₂O 0.1g；MnSO₄·H₂0.05g of O; 2g of diammonium hydrogen citrate; k₂HPO₄·3H₂O2.6 g; tween 801 mL; 0.8g of L-cysteine hydrochloride; adjusting the pH value to 6.8 +/-0.2; the volume is up to 1L. Autoclaving at 115 deg.C for 20 min.

The experimental results are as follows: the initial viable count is 9.5 × 10⁹CFU/mL, viable count after 1 week was 7.6X 10⁹CFU/mL, the order of magnitude does not change, show that the bacterial liquid does not influence the experiment after being frozen, and can be used for animal experiments.

Example 2 Bifidobacterium breve CCFM1179 improvement of behavioral indices in Alzheimer's mice

Taking 32 male C57BL/6J mice with the age of 7 weeks, adapting to the environment for one week, adopting a disposable brain hippocampus to carry out microinjection of Abeta 1-42 protein to establish an animal model of Alzheimer's disease, and dividing the animals into four groups on the 3 rd day after model building: control group (injected with equal volume of physiological saline), model group, drug intervention group, CCFM1179 intervention group, each group containing 8 mice. Animal groups and treatment methods are shown in table 1.

TABLE 1 animal experiment grouping and processing method

Mouse model of AD induced by microinjection of a β 1-42 protein into the brain: after one week of adaptation, each group of mice was anesthetized with isoflurane (induction concentration 3%, maintenance concentration 1%), the top of the mouse was dehaired, sterilized with 75% alcohol, and fixed on a brain stereotaxic apparatus. The scalpel cuts an incision along the median sagittal direction to expose the skull, the medical cotton swab wipes the skull with hydrogen peroxide to expose the staggered cross-shaped area of the chimney, the position of the chimney is found, and the marking is done. A mouse brain stereotaxic map is referred to, and holes are drilled at a position 2.0mm behind the forelimb and 1.8mm beside the midline. A5-mu-L microsyringe is vertically inserted 2.0mm downwards from the surface of the skull, the injection sample amount is 1 mu L, and the sample injection speed is 0.2 mu L/min. The model group, the drug dry-run group and the CCFM1179 dry-run group are injected with oligopeptide Abeta 1-42 with the concentration of 2 mug/muL, and the control group is injected with the same amount of sterile normal saline. After injection, the needle is retained for 5min, and then slowly withdrawn. After closing the wound, penicillin sodium was administered at 4 ten thousand units/stick for approximately 2-3 days. The whole process is operated aseptically.

Probiotic intragastric administration agent: collecting activated 2-generation Bacillus bifidus CCFM1179, culturing at 37 deg.C for 24 hr, centrifuging at 4 deg.C and 8000r/min for 3min to collect thallus, discarding supernatant, and re-suspending with 10% sterilized and defatted emulsion to reach lactobacillus concentration of 5 × 10⁹CFU/mL. The gavage volume was 0.2 mL/day.

Starting at week five, all mice were behaviorally tested. Comprises a Y maze experiment, a water maze experiment and a dark avoidance experiment. The specific implementation method and results are as follows:

(1) y maze experiment:

the Y maze experiment can simultaneously observe the escape conditioned reflex capacity and the space discrimination capacity of the animal, and is applied to evaluating the discriminative learning, the working memory and the reference memory of the animal. The Y maze experiment contains two phases, the first phase being a training phase: the mice were placed in the Y-maze and allowed to move freely in the initial arm and other arms for 10min, and after training was completed, the mice were returned to the cage for the next stage of testing 24 hours later. The second stage is a detection period: the mice were placed in the maze from the central point and were free to move in 3 arms for 8 min. The video analysis system records the total arm entering times and the times of continuously entering three different arms, and calculates the alternation percentage according to a formula: the percent alternation is the number of consecutive entries into three different arms/(total number of entries-2) × 100%.

The experimental result is shown in fig. 1A, the free alternation percentage of the model group mice in the Y maze experiment is reduced to 48.41%, and the behavioral characteristics of identifying dysmnesia are shown; the gavage CCFM1179 can obviously improve the behavioral disorders, and the effect is equivalent to that of a donepezil hydrochloride drug intervention group.

(2) Water maze experiment:

the water maze experiment forces the experimental mouse to swim, so that a platform hidden in water is learned and searched, the learning and memory ability of the experimental animal on the spatial position sense and the direction sense (spatial positioning) is further tested, and the experimental animal is a preferred classical experiment for developing the research of behaviourology, particularly the study and memory.

The water maze circular pool is divided into four quadrants, and the water temperature is kept at 23-25 ℃. The water maze adaptability training is carried out on day 0, and the positioning cruise experiment is carried out on days 1-5, 4 times per day. During the positioning cruise experiment, the mice are respectively placed into the water pool from four different water entry points at random facing the pool wall, and the time (escape latency) required for the mice to find an underwater concealed platform and stand on the platform and the total movement distance in the period are recorded. If the mice failed to find the hidden platform 60s after entering the water, they were gently guided to the platform with a long stick and allowed to stand on the platform for 30s, and the escape latency was recorded as 60 s. And then, removing the platform on the 6 th day, carrying out a space exploration experiment, and recording the times of the mouse passing through the original platform within 60s, the residence time of the quadrant of the original platform and the movement distance.

The experimental results are shown in fig. 1B and 1C, the escape latency of the model group mice in the water maze experiment is obviously increased to 51.06s, which indicates that the model group mice have impaired spatial memory and learning memory; the gavage CCFM1179 can obviously improve the behavioral disturbance, the latency is reduced to 37.6s, in addition, the percentage of the residence time of the mice in the quadrant of the original platform in the CCFM1179 group in the total time length is obviously increased to 68.21 percent (figure 1C), and the effect is obviously superior to 50.68 percent of that of the donepezil hydrochloride drug intervention group.

(3) Dark avoidance experiments:

mice were allowed to rest for 1 day after the water maze experiment and then a dark avoidance test was performed for a total of 2 days. Day 1 is a single shock training session, mice were placed in a bright box, and after 10s, the door between the light and dark boxes was opened. Most strains of mice have strong exploratory behaviors, and are pleased with dim light and poor light. Therefore, the mouse quickly enters the dark box. Once the mouse has completely entered the dark box, the access door is closed and the shock is initiated (0.3mA, 2 s); the mice were left in the dark box for 10s (to allow the animals to establish a correlation between the box and the shock), and the mice were returned to their cages. Day 2 is a memory retention test period, mice were placed in a bright box with the central door open but without shock. The time for the mouse to dig into the dark box was recorded as latency.

The experimental result is shown in figure 1D, the latency period of the mice in the model group entering the dark box is obviously shortened to 10.6s, which indicates that the memory retention capacity of the mice is damaged, and the intervention of the CCFM1179 can obviously prolong the latency period of the mice entering the dark box to 33.04s, relieve the memory disorder of the mice, and the effect is better than that of the 14.67s of the drug group.

Example 3CCFM1179 reduction of Abeta protein deposition in the brain of mice with Alzheimer's disease

The grouping, modeling and treatment methods of the mice were the same as in example 2. After the behavioral experiments of the mice are finished, the mice are subjected to intraperitoneal injection by adopting a pentobarbital sodium solution with the concentration of 1% every other day so as to be anesthetized, the mice are sacrificed, the brain tissues of the mice are taken, and the hippocampus tissues are separated on ice. Taking a certain mass of fresh hippocampus tissue, adding 9 times of sterile PBS buffer solution (equivalent to 1g of tissue and 9ml of homogenate), homogenizing by using a tissue homogenizer, centrifuging the tissue solution for 3000g and 15min, taking supernatant, and detecting the content of Abeta 1-42 in the hippocampus by using an ELISA kit.

The experimental result is shown in figure 2, and the result shows that the intervention of bifidobacterium breve CCFM1179 can obviously reduce the deposition of Abeta 1-42 protein in the hippocampal tissue of a model mouse, and the relieving effect is equivalent to that of a donepezil hydrochloride drug intervention group.

Example 4 Bifidobacterium breve CCFM1179 increase neurotransmitter levels in the brain of mice with Alzheimer's disease

Taking a certain mass of the brain tissue obtained in the example 3, adding 9 times of sterile PBS buffer solution (equivalent to 1g of tissue and 9ml of homogenate), homogenizing by using a tissue homogenizer, centrifuging the tissue fluid for 3000g and 15min, taking supernatant, and detecting the content of the brain-derived neurotrophic factor BDNF in the brain tissue by using an ELISA kit.

The experimental result is shown in fig. 3A, and the result shows that the intervention of bifidobacterium breve CCFM1179 remarkably reverses the reduction of the BDNF level in the brain of the mouse model of alzheimer's disease, and the increase of BDNF can promote neurogenesis and reduce the inflammation of the diseased brain.

Example 5 Bifidobacterium breve CCFM1179 increase synaptic protein levels in the brains of mice with Alzheimer's disease

A certain amount of the brain tissue obtained in example 3 was taken, 9 times the volume of sterile PBS buffer (equivalent to 1g of tissue plus 9ml of homogenate) was added, homogenate was performed with a tissue homogenizer, the supernatant was centrifuged at 3000g for 15min, and the content of postsynaptic Density protein PSD-95 in the brain tissue was measured with an ELISA kit.

The experimental result is shown in fig. 3B, and the result shows that the intervention of bifidobacterium breve CCFM1179 remarkably reverses the reduction of PSD-95 level in the brain of the alzheimer model mouse, and is increased to 1.507pg/mL compared with 1.325pg/mL of the model group, and the improvement effect of CCFM1179 on PSD95 in the brain is remarkably superior to 1.402pg/mL of donepezil hydrochloride, and is equivalent to that of the normal control group.

Example 6 Bifidobacterium breve CCFM1179 can increase the 5-HT content in the serum of mice with Alzheimer's disease

The grouping, modeling and treatment methods of the mice were the same as in example 2. After the behavioral experiment is finished and the mice are sacrificed, the collected blood of the mice is kept stand for 2h, and is centrifuged at 3000 Xg for 15min to obtain serum, and the content of 5-hydroxytryptamine (5-HT) in the serum is detected by an ELISA kit. 5-HT in peripheral tissues is important for maintaining normal intestinal motility. 5-HT of peripheral tissues can stimulate gastrointestinal smooth muscle 5-HT2 receptors or act on 5-HT4 receptors of ganglion cells in intestinal walls to cause contraction of gastrointestinal smooth muscle, so that the tension of the gastrointestinal tract is increased, and the intestinal peristalsis is accelerated; the decrease in 5-HT in peripheral tissues is directly associated with constipation, gastrointestinal discomfort, and the like.

The experimental result is shown in figure 4, the level of 5-HT in the serum of the mouse model of Alzheimer's disease is remarkably reduced to 36.95pg/mL, which indicates that the intestinal peristalsis function is damaged; the bifidobacterium breve CCFM1179 dry prognosis remarkably improves the level of 5-HT in serum to 47.70pg/mL, not only shows better cognition and memory protection functions, but also can recover the normal intestinal peristalsis function of a mouse, and the intervention effect of the drug donepezil hydrochloride is not remarkable and is not recovered to the normal level.

Example 7 Bifidobacterium breve CCFM1179 can increase the content of acetic acid in the feces of mice with Alzheimer's disease

The grouping, modeling and treatment methods of the mice were the same as in example 2. After the mouse behavioural experiment is finished, collecting mouse excrement, freezing and storing at-80 ℃, and detecting the content of acetic acid in the mouse excrement by using a GC-MS method. The specific method comprises the following steps: taking a 50mg mouse excrement sample, adding the sample into 500 mu L of saturated NaCl solution, soaking and uniformly mixing; adding 20 μ L10% sulfuric acid solution, acidifying, adding 800 μ L diethyl ether, shaking, and centrifuging (13000rpm, 15min, 4 deg.C); taking the upper layer of ether phase, adding 0.25g of anhydrous sodium sulfate and drying; fully shaking, standing for 30min, and centrifuging again (13000rpm, 15min, 4 ℃); the supernatant was aspirated into a gas phase vial for gas analysis.

The GC-MS conditions were: an Rtx-Wax column (column length 30m, inner diameter 25 μm) was used; the carrier gas is He, and the flow rate is 2 mL/min; the sample introduction volume is 1 mu L, the temperature is increased to 140 ℃ according to the speed of 7.5 ℃/min, then the temperature is increased to 200 ℃ according to the speed of 60 ℃/min, the temperature is kept for 3min, and the ionization temperature is 20 ℃; the analysis adopts a full scanning mode, and a standard curve is measured by an external standard method, so that the concentration of the acetic acid is calculated.

The experimental result is shown in figure 5, the content of acetic acid in the feces of the mice in the model group is significantly lower than that of the feces of the control group and has statistical significance, the intervention of the bifidobacterium breve CCFM1179 ensures that the content of the acetic acid in the feces of the mice is significantly increased to 18.187 mu mol/g, which is 6.787 mu mol/g higher than that of the model group, and the content of the acetic acid in the feces of the mice is 2.031 mu mol/g higher than that of the feces of the control group.

Example 8 modulating effects of Bifidobacterium breve CCFM1179 on intestinal flora in mice with Alzheimer's disease

The grouping, modeling and treatment methods of the mice were the same as in example 2. And collecting the mouse feces after the mouse behavioral experiment is finished. Extracting bacterial genome from the mouse excrement according to the operation steps of the MP kit; amplifying a V3-V4 region fragment of 16S rDNA by using a mouse fecal genome as a template and an upstream primer 520F (5 '-AYTGGGYDTAAAGNG-3') and a downstream primer 802R (5 '-TACNVGGGTATCTAATCC-3') as primers; purifying the PCR product by agarose Gel electrophoresis, and recovering a target band Gel according to the instruction of a QIAquick Gel Extraction Kit Gel recovery Kit; detecting the DNA concentration of the Sample according to a Qubit DNA3.0 Kit, and then constructing a library according to the TurSeq DNA LT Sample Preparation Kit and the instruction thereof; and finally, carrying out on-machine sequencing on the Illumina Miseq sequencer according to the instructions of the Miseq Regent Kit. After sequencing was completed, species classification annotation was performed on QIIME platform, data was subjected to epi-fainting on microbiome analysis platform, and α diversity and β diversity of the samples were calculated.

The intra-flora alpha-diversity was characterized by the chao1 index and the species abundance (occupied richness) and the results are shown in fig. 6. The bifidobacterium breve CCFM1179 can obviously up-regulate the alpha-diversity of the intestinal flora and improve the species abundance degree of the intestinal flora. The beta-diversity of the flora is evaluated by principal coordinate analysis (PCoA) (figure 7), and the result shows that the intestinal flora of the mice with Alzheimer's disease is obviously different from that of the normal mice, the intestinal flora of the mice with model group is separated from that of the mice with model group to a certain extent after the bifidobacterium breve CCFM1179 is dried, and the trend of transforming the normal mice flora is achieved.

In addition, the intestinal microbial abundance of Akkermansia muciniphila (Akkermansia muciniphila) in the feces of mice in the alzheimer model group is remarkably reduced, the relative abundance of the bifidobacterium breve CCFM1179 can be remarkably increased by about 3 times by taking the bifidobacterium breve, and the abundance of the drug donepezil hydrochloride is not remarkably changed. The main metabolite of Akkermansia muciniphila (Akkermansia muciniphila) is propionic acid, the colonization of the intestinal tract is closely related to the health of a host, the intestinal tract can improve the inflammatory reaction of obesity and diabetes patients and adverse symptoms such as insulin resistance and glucose tolerance, and can also regulate the immune response of the organism and maintain the metabolic balance in vivo.

Example 9 production of fermented food containing Bifidobacterium breve CCFM1179 of the present invention

Selecting fresh vegetables or fruits, cleaning, and squeezing to obtain juice, wherein the juice comprises one or more of Chinese cabbage, white radish, cucumber, beet, yellow peach and waxberry products as raw materials. The juiced raw materials are sterilized instantly at high temperature, the temperature is reduced to 37 ℃ immediately after the juiced raw materials are sterilized at 140 ℃ for 2 seconds, and then the bifidobacterium breve CCFM1179 or the microbial inoculum leaven containing the strain is inoculated to ensure that the concentration of the bifidobacterium breve CCFM1179 reaches 10⁶More than CFU/mL, and refrigerating and storing at the temperature of 4 ℃ to obtain the fruit and vegetable beverage containing the viable bacteria of the bifidobacterium breve CCFM 1179.

The bifidobacterium breve CCFM1179 is used as a fermentation microorganism to produce fermented food, and the fermented food comprises solid food, liquid food and semi-solid food. The fermented food comprises dairy products, bean products and fruit and vegetable products, wherein the dairy products comprise fermented dairy products (fermented milk, flavored fermented milk, fermented milk beverage and the like), cream, cheese, milk-containing beverage and milk powder; the bean product comprises soybean milk and soybean milk powder; the fruit and vegetable products comprise Chinese cabbage, white radish, cucumber, beet, yellow peach and waxberry products.

The effect of the fermented food on improving the symptoms of the Alzheimer's disease is verified according to the method described in the example 2-8, and the result shows that the fermented food has an auxiliary effect on improving cognitive and memory disorders of the Alzheimer's disease mice, reducing the content of the Abeta 1-42 protein in the brains of the Alzheimer's disease mice, increasing the levels of the brain-derived neurotrophic factors and the postsynaptic density proteins in the brains of the Alzheimer's disease mice and increasing the content of the 5-hydroxytryptamine in the sera of the Alzheimer's disease mice; the fermented food can improve the level of flora metabolite acetic acid in the feces of mice with Alzheimer's disease, improve the gastrointestinal peristalsis function, regulate the structure of intestinal flora of mice with Alzheimer's disease, improve the species diversity degree of the intestinal flora, and improve the relative abundance of the beneficial intestinal bacterium, namely Akkermansia muciniphila (Akkermansia muciniphila).

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> Bifidobacterium breve capable of relieving Alzheimer's disease and increasing fecal acetic acid content and application thereof

<130> BAA210490A

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 473

<212> DNA

<213> Bifidobacterium breve

<400> 1

atcctagggg agcggcgttc tgcagagcgg acgggtcacc ttgaccgggt cagtcacacc 60

ggcggccagc aggtcctcgt aggtgtcggt ggcggcgttg aagccttcgc catcgggcag 120

agaacgaacc ttgttgatca ccacgtcgcc ggacacgcca gcattctcgg caatctgctt 180

gatcggggct tcgatggcgc ggaacacgat ggcggcaccg gtagcctctt cgccggtcag 240

ggaggtgacg gcctcagcct tctcggcctt ggcagcagcc tgaacgaggg ccacgccacc 300

gccgggcagc aggccttcct caatggcggc cttggcgtta cgcacggcat cttcgatgcg 360

gtgcttgcgc tccttggcct cgacctcggt ggcagcgccg accttgatga cagccacgcc 420

gccggccagc ttggccagac gctcctgcag cttctcacga tcgttaatcg gaa 473

Claims

1. Bifidobacterium breve (Bifidobacterium breve) CCFM1179, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on March 31, 2021, and the deposit number is GDMCC NO: 61589.

2. The composition containing Bifidobacterium breve CCFM1179 according to claim 1, wherein the number of cells of Bifidobacterium breve CCFM1179 in the composition is ≥ 1×10 ⁸ CFU/g or 1×10 ⁸ CFU/mL .

3. The composition according to claim 2, wherein the composition is functional food or medicine.

4. The composition according to claim 3, wherein the composition is a fermented food, including solid food, liquid food or semi-solid food.

5. The composition according to claim 4, wherein the types of the fermented food include dairy products, soy products or fruit and vegetable products.

6 . The bacterial agent containing the Bifidobacterium breve CCFM1179 according to claim 1 , wherein the bacterial agent is a powder obtained by drying the bacterial liquid containing Bifidobacterium breve CCFM1179. 7 .

7. Bifidobacterium breve CCFM1179 according to claim 1, or the composition according to any one of claims 2 to 5, or the bacterial agent according to claim 6 in the preparation of relieving cognitive impairment and delaying Alzheimer's disease The application in the medicine, characterized in that the medicine contains the Bifidobacterium breve CCFM1179 according to claim 1 and a pharmaceutically acceptable carrier.

8. The medicine according to claim 7, wherein the carrier comprises one of fillers, binders, wetting agents, disintegrating agents, lubricants, and flavoring agents commonly used in medicine or variety.

9. The use according to claim 7 or 8, wherein the delaying the progression of Alzheimer's disease comprises at least one of (a) to (d):

(a) reducing the deposition of beta-amyloid-42 (Aβ1-42) in the mammalian brain;

(b) increasing neurotransmitter levels in the mammalian brain;

(c) increasing the level of postsynaptic density protein in mammalian brain;

(d) increasing the content of serotonin (5-HT) in mammalian serum.

10 . The Bifidobacterium breve CCFM1179 of claim 1 , the composition of any one of claims 2 to 5 , or the application of the bacterial agent of claim 6 in preparing a product for regulating intestinal flora. 11 .