CN113197901B

CN113197901B - Pharmaceutical composition containing fampicin as well as preparation method and application thereof

Info

Publication number: CN113197901B
Application number: CN202010131171.3A
Authority: CN
Inventors: 张银龙; 李炜; 金振诗; 李巧霞; 邓声菊; 徐艳君; 王田园
Original assignee: Beijing Tianxinyuan Pharmaceutical Science And Technology Development Co ltd; Beijing Sihuan Pharmaceutical Co Ltd; Beijing Ao He Research Institute Co Ltd
Current assignee: Beijing Tianxinyuan Pharmaceutical Science And Technology Development Co ltd; Beijing Sihuan Pharmaceutical Co Ltd; Beijing Ao He Research Institute Co Ltd
Priority date: 2020-02-01
Filing date: 2020-02-28
Publication date: 2023-09-08
Anticipated expiration: 2040-02-28
Also published as: CN113197901A; CN116898979A

Abstract

The present invention relates to a solid pharmaceutical composition containing fampicvir, comprising: the method comprises the steps of preparing a composition of fampicvir and/or a derivative thereof, and a pharmaceutically acceptable carrier, wherein the weight percentage of the fampicvir and/or the derivative thereof in the composition is 50% -95%, and the pharmaceutically acceptable carrier is optionally any one or combination of a binder, a disintegrating agent, a diluent, a lubricant and a glidant. The solid pharmaceutical composition containing the fampicin has the advantages of reduced preparation size, convenience for patients to swallow, improvement of treatment compliance of patients, reduction of the occurrence risk of crystal transformation of the fampicin, remarkable improvement of the hardness and friability of tablets, production efficiency, reduction of processing cost and improvement of product quality by crushing of the raw material medicine of the fampicin, and has very excellent clinical value.

Description

Pharmaceutical composition containing fampicin as well as preparation method and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to a pharmaceutical composition containing fampicin, a preparation method and application thereof.

Background

WTO will cause new coronavirus pneumo epidemic in the new genus of β -type coronavirus named "2019 new coronavirus (2019-nCoV)" on 1 month 12 2020. The clinical manifestations of the patient infected by the virus include fever, hypodynamia, dry cough and the like, and cause the patient to develop acute respiratory infectious diseases. Dyspnea occurs after about half of the patients for one week, and severe patients rapidly progress to symptoms such as acute respiratory distress syndrome, septic shock, uncorrectable metabolic acidosis, and clotting dysfunction. Most patients have good prognosis, few patients are critically ill and even die. At present, no effective antiviral therapeutic drug for treating the coronavirus infection exists.

Favipiravir (structure shown in formula I) is a broad-spectrum antiviral drug of the class of RNA-dependent RNA polymerase (RdRp) inhibitors, which is rapidly converted in vivo to the form of Fapipira Wei Hegan triphosphate (M6). M6 plays an antiviral role by mimicking Guanosine Triphosphate (GTP) to competitively inhibit viral RNA-dependent RNA polymerase, inhibiting viral genome replication and transcription, and M6 can also permeate viral genes to play an antiviral role by inducing fatal mutations. Japan has approved its use for the treatment of new or recurrent influenza virus infections (limited to cases where other anti-influenza virus drugs are ineffective or of insignificant effect), and for the treatment of emergency situations in infected individuals in the outbreak of ebola virus epidemic. However, there is still a need for improved uniformity, stability and safety of existing pharmaceutical formulations of fampicin to enhance patient compliance.

Firstly, the Fabry-Perot compound has the defects of poor compression formability, large specific volume, strong cohesive force, poor fluidity and the like, so that the hardness and friability of the tablet are not up to the standard, edge defects and pitting surfaces appear after slight collision and friction, and adverse effects are brought to the production, transportation and storage of the tablet. Although increasing the amount of excipients having excellent compression properties in the formulation can improve the above problems, the resulting size of the tablet is large, and patients may have difficulty in swallowing or frequent administration, and patient compliance is reduced.

Secondly, the fampicin has polymorphism, so that the dominant crystal form is needed to be used in preparation of the preparation, and the crystal transformation of the dominant crystal form is needed to be prevented or reduced in preparation, transportation and storage of the preparation, so that the uniformity, the effectiveness and the safety of the quality of the medicine are ensured, and the quality control of the medicine is realized.

CN102348458A discloses a tablet, which adopts low-substituted hydroxypropyl cellulose or croscarmellose sodium and a binder as auxiliary materials, and adopts a punch of 8.5mm for tabletting, so that the diameter of the tablet is reduced, and the dissolution is better. However, the dosage of the low-substituted hydroxypropyl cellulose in the tablet is large and the cost is high, thus increasing the production cost.

CN106667926a discloses a tablet of fampicin which siliconized microcrystalline cellulose, which is relatively inexpensive, is used instead of low substituted hydroxypropyl cellulose. However, the addition of silicified microcrystalline cellulose still increases the production cost, and increases the potential risk of the Fapila Wei Zhuai crystal, which is not beneficial to guaranteeing the uniformity, effectiveness, safety and quality control of the pharmaceutical preparation.

Therefore, how to develop a solid pharmaceutical composition of fampicin with more uniform, stable, safe, effective, better quality and cost to meet clinical demands is a technical problem that needs to be solved in the field.

Disclosure of Invention

The invention aims to provide a solid pharmaceutical composition containing fampicin, which comprises the following components: the method comprises the steps of preparing a composition of fampicvir and/or a derivative thereof, and a pharmaceutically acceptable carrier, wherein the weight percentage of the fampicvir and/or the derivative thereof in the composition is 50% -95%, and the pharmaceutically acceptable carrier is optionally any one or combination of a binder, a disintegrating agent, a diluent, a lubricant and a glidant.

In a preferred embodiment of the present invention, the fampicvir and/or the derivative thereof is selected from any of any crystal form and amorphous form of the fampicvir and/or the derivative thereof.

In a preferred embodiment of the present invention, the derivative of the fampicvir is selected from any one of pharmaceutically acceptable salts, esters, isomers, and solvates of the fampicvir.

In a preferred embodiment of the present invention, the particle size of the fampicin and/or its derivative is not more than 100. Mu.m, preferably not more than 80. Mu.m, more preferably not more than 50. Mu.m.

In a preferred embodiment of the present invention, the weight percentage of the fampicvir and/or the derivative thereof is 60% -85%, preferably 70% -80%.

In a preferred embodiment of the present invention, the weight percentage of the binder is 0.5% -15%, preferably 1% -10%, more preferably 2% -5%.

In a preferred embodiment of the present invention, the binder is selected from one or a combination of povidone, hydroxypropyl cellulose, methylcellulose, hypromellose, sodium carboxymethylcellulose, polyvinyl alcohol, gum arabic, and dextrin.

In a preferred embodiment of the present invention, the povidone is selected from any one of povidone K30, povidone K25, povidone K17, povidone K90, or a combination thereof.

In a preferred embodiment of the present invention, the weight percentage of the disintegrant is 5% to 25%, preferably 8% to 20%, more preferably 12% to 18%.

In a preferred embodiment of the present invention, the disintegrant is selected from any one of carboxymethyl cellulose, calcium carboxymethyl cellulose, sodium carboxymethyl starch, crospovidone, partially pregelatinized starch, or a combination thereof.

In a preferred embodiment of the present invention, the crospovidone is selected from povidone XL, povidone XL-10, or a combination thereof.

In a preferred embodiment of the present invention, the weight percentage of the diluent is 3% -60%, preferably 10% -58%, more preferably 30% -50%.

In a preferred embodiment of the present invention, the diluent is selected from any one of mannitol, microcrystalline cellulose, calcium carbonate, sodium carbonate, lactose, dicalcium phosphate, sodium phosphate, kaolin, or a combination thereof.

In a preferred embodiment of the present invention, the weight percentage of the lubricant is 0.01% -5%, preferably 0.05% -1%, more preferably 0.1% -0.4%.

In a preferred embodiment of the present invention, the lubricant is selected from any one of sodium stearyl fumarate, stearic acid, magnesium stearate, calcium stearate, talc, sucrose fatty acid ester, or a combination thereof.

In a preferred embodiment of the present invention, the weight percentage of the glidant is 0.1% -10%, preferably 0.5% -6%, more preferably 1.5% -4.5%.

In a preferred embodiment of the present invention, the glidant is selected from any one of silicon dioxide and titanium dioxide or a combination thereof.

In a preferred embodiment of the present invention, the silica is selected from any one of hydrated silica, light silicic anhydride, colloidal silica, or a combination thereof.

In a preferred embodiment of the present invention, the content of any one of low-substituted hydroxypropyl cellulose, low-substituted hydroxypropyl cellulose sodium, crosslinked carboxymethyl cellulose, crosslinked sodium carboxymethyl cellulose, silicified microcrystalline cellulose or a combination thereof in the solid pharmaceutical composition is lower than the conventional amount as a disintegrant, excipient or binder, and preferably the content of any one of low-substituted hydroxypropyl cellulose, low-substituted hydroxypropyl cellulose sodium, crosslinked carboxymethyl cellulose, crosslinked sodium carboxymethyl cellulose, silicified microcrystalline cellulose or a combination thereof in the solid pharmaceutical composition is lower than 0.1%.

In a preferred embodiment of the present invention, the solid pharmaceutical composition is substantially free of a crystalline form stabilizer.

In a preferred embodiment of the present invention, the crystal form stabilizer refers to a component that prevents or reduces the crystal transformation of the fampicvir and/or the derivative thereof, and preferably the content of the crystal form stabilizer in the composition is not higher than 0.1%.

In a preferred embodiment of the present invention, the solid pharmaceutical composition comprises fampicvir and/or a derivative thereof in a formulation which is substantially free of seeding during preparation, storage and use.

In a preferred embodiment of the present invention, the fact that no seeding occurs substantially means that the seeding rate of the fampicin is not higher than 5% when stored for 6 months under the conditions of 40 ℃ ± 2 ℃ and relative humidity of 75% ± 5% rh.

In a preferred embodiment of the present invention, the solid pharmaceutical composition optionally contains a pharmaceutically acceptable carrier selected from any one of or a combination of flavoring agents, coloring agents, preservatives, buffers.

In a preferred embodiment of the present invention, the flavoring agent is selected from any one of xylitol, stevioside, mogroside, glycyrrhizin, rubusoside, sucrose, sodium saccharin, glycerol, sorbitol, mannitol, maltose, or a combination thereof.

In a preferred embodiment of the present invention, the colorant is selected from any one of red iron oxide and yellow iron oxide or a combination thereof.

In a preferred embodiment of the present invention, the preservative is selected from any one or a combination of benzoic acid or a salt thereof, sorbic acid or a salt thereof, parabens, sodium metabisulfite, chlorhexidine, sodium citrate, butylhydroxytoluene (BHT), butylhydroxyanisole (BHA), tocopherol, ethylenediamine tetraacetic acid, propyl gallate, and quaternary ammonium compounds.

In a preferred embodiment of the present invention, the buffer is selected from any one or a combination of citric acid, potassium citrate, sodium citrate, malic acid, sodium malate, potassium hydroxide, sodium bicarbonate, sodium hydroxide, calcium carbonate, sodium carbonate, phosphoric acid, disodium hydrogen phosphate, sodium dihydrogen phosphate, monoethanolamine, diethanolamine, triethanolamine, lactic acid, sodium lactate, potassium lactate, propionic acid, tartaric acid, sodium tartrate, sodium fumarate, potassium tartrate, potassium fumarate, and fumaric acid.

In a preferred embodiment of the present invention, the solid pharmaceutical composition is in the form of a preparation selected from any one of tablets, capsules, granules and powders.

In a preferred embodiment of the present invention, the formulation of the solid pharmaceutical composition is coated with a coating to provide a modified release form.

In a preferred embodiment of the present invention, the modified release form is selected from any one of delayed release, controlled release, slow release, extended release, sustained release, fast release, or a combination thereof.

In a preferred embodiment of the present invention, the tablet is prepared in various possible shapes, preferably selected from any one of an ellipsoid and a round shape with two convex sides, more preferably, the tablet shape is selected from any one of a round tablet, an oval tablet, a capsule-shaped tablet, a triangular tablet, a rectangular tablet, a square round tablet, and a special-shaped tablet.

In a preferred embodiment of the invention, the diameter of the tablet is 6-10mm, preferably 7-8mm.

The invention aims to provide a preparation method of a solid pharmaceutical composition containing fampicin, which comprises the following steps: (a) Weighing a required amount of the fampicvir and/or the derivative thereof and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is optionally any one or combination of a binder, a disintegrating agent, a diluent, a lubricant and a glidant, and uniformly mixing the fampicin and/or the derivative thereof; (b) And (c) preparing the mixture obtained in the step (a) into any one of tablets, capsules, granules and powder.

In a preferred embodiment of the present invention, the tablet obtained in step (b) is coated with a film.

In a preferred embodiment of the present invention, any one of the tablet, capsule, granule, and powder prepared in step (b) is subjected to a light shielding treatment, and preferably any one of the tablet, capsule, granule, and powder prepared in step (b) is subjected to a light shielding treatment by a blister package.

In a preferred technical scheme of the invention, the preparation method comprises the following steps: (a) Weighing the fampicin or a derivative thereof and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is optionally selected from any one or combination of a binder, a disintegrating agent, a diluent, a lubricant and a glidant; (b) pre-treating the pharmaceutically acceptable carrier; (c) premixing; (d) granulating; (e) drying; (f) finishing; (g) total mixing; (h) And (3) preparing the mixture obtained in the step (g) into any one of tablets, capsules, granules and powder.

In a preferred technical scheme of the invention, the adhesive is povidone K30 water solution with the concentration of 15-30%.

In a preferred embodiment of the present invention, the pretreatment of the pharmaceutically acceptable carrier in step (b) comprises the steps of: disintegrating agent and glidant are crushed and sieved for standby.

In a preferred embodiment of the present invention, the premixing treatment in step (c) includes the following steps: mixing the fampicin and/or the fampicin derivative with the pretreated disintegrating agent and glidant prepared in the step (b), stirring and shearing, and then granulating by a wet method.

In a preferred embodiment of the present invention, the stirring speed in step (c) is 250-500r/min, preferably 400r/min; the shear rate in step (c) is 600-900r/min, preferably 800r/min; the mixing time in step (c) is 2-10min, preferably 5min.

In a preferred embodiment of the present invention, the granulating in step (d) comprises the steps of: slowly adding adhesive under shearing and stirring conditions, making soft material, discharging, and sieving.

In a preferred embodiment of the present invention, the shear rate in the granulation process in step (d) is 100-1500r/min, preferably 1200r/min, and the stirring rate in the granulation process in step (d) is 300-500r/min, preferably 400r/min.

In a preferred embodiment of the present invention, the drying treatment in step (e) is a drying treatment in which the granules in step (d) are granulated so that the moisture content in the granules is not more than 3%, preferably not more than 2%.

In a preferred embodiment of the present invention, the total mixing treatment in step (g) comprises the following steps: sieving disintegrating agent and glidant with 10-50 mesh sieve, mixing with the dry granule obtained in step (e), adding lubricant, and mixing for 1-10 min.

It is another object of the present invention to provide the use of fampicvir and/or derivatives thereof for the preparation of viral RNA polymerase inhibitors.

It is another object of the present invention to provide the use of fampicvir and/or derivatives thereof for the preparation of a virus-lethal mutation-inducing agent.

It is another object of the present invention to provide the use of fampicvir and/or derivatives thereof for the preparation of a medicament for the prevention and/or treatment of novel coronavirus (2019-nCoV) infections.

In a preferred embodiment of the invention, the treatment of 2019-nCoV infection is selected from any one of decreasing the ability of 2019-nCoV to replicate, decreasing 2019-nCoV load, increasing viral clearance, or a combination thereof.

In a preferred embodiment of the present invention, the preventing 2019-nCoV infection is selected from any one of reduced susceptibility to 2019-nCoV infection, reduced ability to sustain infection, or a combination thereof.

In a preferred embodiment of the present invention, the preventing and/or treating 2019-nCoV infection is selected from the group consisting of ameliorating any one of symptoms or a combination of symptoms of fever, weakness, dry cough, nasal obstruction, runny nose, simple infection, light pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, septic shock, metabolic acidosis, coagulation dysfunction caused by 2019-nCoV infection.

It is another object of the present invention to provide the use of fampicvir and/or derivatives thereof for the preparation of a medicament for the prevention and/or treatment of influenza virus infection.

In a preferred embodiment of the present invention, the influenza virus to be treated is selected from any one of a novel influenza virus and recurrent influenza virus, or a combination thereof.

In a preferred embodiment of the present invention, the treatment of influenza infection is selected from any one of or a combination of reducing the ability of influenza virus replication, reducing influenza virus load, and increasing virus clearance.

In a preferred embodiment of the present invention, the prevention of influenza virus infection is selected from any one of reduced influenza virus susceptibility, reduced ability to sustain infection, or a combination thereof.

In a preferred embodiment of the present invention, the influenza virus is selected from any one of influenza a virus, influenza B virus, influenza C virus, highly pathogenic avian influenza virus, and a strain resistant to existing anti-influenza drugs, or a combination thereof.

In a preferred embodiment of the present invention, the influenza a virus is selected from any one of or a combination of avian influenza and H1N1 influenza a infection.

In a preferred embodiment of the present invention, the virus resistant to the existing anti-influenza drug is selected from any one of amantadine hydrochloride, oseltamivir phosphate, zanamivir, and combinations thereof, and is resistant.

In a preferred embodiment of the invention, the medicament is useful for antiviral treatment of patients suffering from immunodeficiency.

In a preferred embodiment of the invention, the influenza virus infection is selected from acute respiratory tract infections caused by influenza virus.

It is another object of the present invention to provide the use of fampicvir and/or derivatives thereof for the preparation of a medicament for the prevention and/or treatment of ebola virus infection.

In a preferred technical scheme of the invention, the fampicin and/or the fampicin derivative and a pharmaceutically acceptable carrier are prepared into a solid pharmaceutical composition together.

It is another object of the present invention to provide a method for making essentially no seeding of fampicvir and/or derivatives, wherein the content of any one of low substituted hydroxypropyl cellulose, low substituted sodium hydroxypropyl cellulose, croscarmellose sodium, silicified microcrystalline cellulose or a combination thereof in the solid pharmaceutical composition is lower than the conventional amount used as a disintegrant; preferably, the solid pharmaceutical composition contains less than 0.1% of any one or combination of low-substituted hydroxypropyl cellulose, low-substituted sodium hydroxypropyl cellulose, croscarmellose sodium, silicified microcrystalline cellulose.

Another object of the present invention is to provide a combination of a solid pharmaceutical composition containing fampicvir, which combines the solid pharmaceutical composition with any one of other types of antiviral drugs, interferons, protein drugs, antibacterial drugs, macromolecular monoclonal drugs, antitussive expectorants, intestinal flora drugs, traditional Chinese medicines or a combination thereof.

In a preferred embodiment of the invention, the other type of antiviral drug is selected from Lei Midi vitamin or rendimivir (GS-5734), chloroquine (Chloroquine, sigma-C6628), indinavir, saquinavir, lopinavir, carfilzomib, ritonavir (Ritonavir), adefovir, atazanavir, darunavir, telanavir, fosamprenavir, enzatole Weipu, abacavir, bortezomib, etiquevir, ma Liba, raltegravir, montelukast, disulfiram, carmofur, ebselen, PX-12, TDZD-8, cyclosporin A, cinnamomide, deoxygeniposide, polydatin, kavalone, shikonin, tidegluvalib, acyclovir, ribavirin, rimantadine, oseltamivir, zanamivir, lamivudine, lanivir, DAS181, ganciclovir, baloflavir Sha Wei (Baloxavir), arbidol, feonavir, nifedide, or a combination thereof.

In a preferred embodiment of the present invention, the interferon is selected from any one of interferon alpha-1 b, interferon alpha-2 b, albumin, gamma globulin or a combination thereof.

In a preferred embodiment of the present invention, the protein drug is selected from any one of albumin and gamma globulin or a combination thereof.

In a preferred technical scheme of the invention, the macromolecular monoclonal antibody is CR3022.

In a preferred embodiment of the present invention, the antibacterial agent is selected from any one or a combination of β -lactams, aminoglycosides, polymyxins, macrolides, lincomycin, vancomycin, tetracyclines, chloramphenicol, sulfonamides, quinolones, furans, and antifungal agents.

In a preferred embodiment of the present invention, the β -lactams are selected from any one or a combination of penicillins, cephalosporins, atypical β -lactams.

In a preferred embodiment of the present invention, the penicillin is selected from any one of penicillin V, cloxacillin, amoxicillin, ampicillin, and carboxyl Xilin, or a combination thereof.

In a preferred embodiment of the present invention, the cephalosporin is selected from any one of ceftriaxone, ertapenem, linezolid, cefalexin, cefaclor, ceftazidime, cefepime, or a combination thereof.

In a preferred embodiment of the present invention, the aminoglycoside is selected from any one of streptomycin and gentamicin, or a combination thereof.

In a preferred embodiment of the present invention, the polymyxins are selected from any one of polymyxin B and polymyxin E, or a combination thereof.

In a preferred embodiment of the present invention, the macrolide is selected from any one of erythromycin, roxithromycin and azithromycin or a combination thereof.

In a preferred embodiment of the present invention, the lincomycin is selected from any one of lincomycin and clindamycin or a combination thereof.

In a preferred embodiment of the present invention, the vancomycin is selected from any one of vancomycin, norvancomycin, teicoplanin, and combinations thereof.

In a preferred embodiment of the present invention, the tetracyclines are selected from any one of tetracycline, oxytetracycline, tigecycline, or a combination thereof.

In a preferred embodiment of the present invention, the chloramphenicol is selected from the group consisting of chloramphenicol, thiamphenicol, and odorless chloramphenicol, or a combination thereof.

In a preferred technical scheme of the invention, the sulfanilamide is any one or combination of sulfadiazine and sulfamethoxazole.

In a preferred embodiment of the present invention, the quinolone is selected from any one of ciprofloxacin, ofloxacin, levofloxacin, enoxacin, gatifloxacin, moxifloxacin, or a combination thereof.

In a preferred embodiment of the present invention, the furans are selected from any one of nitrofurans, furazolidone, furacilin, or a combination thereof.

In a preferred embodiment of the present invention, the antifungal agent is selected from any one of griseofulvin, clindamycin, clotrimazole, miconazole, econazole, bifonazole, ketoconazole, flucytosine, amphotericin B, nystatin, clarithromycin, methylprednisomycin, fluconazole, itraconazole, or a combination thereof.

In the preferred technical scheme of the invention, the cough-dispelling phlegm-stopping medicine is selected from ambroxol.

Chinese medicine has been used for treating viral infectious diseases (pestilence) for over two thousand years. A large number of clinical practices and experimental researches show that the antiviral traditional Chinese medicine has remarkable curative effect on treating viral infectious diseases and shows unique advantages different from western medicines: firstly, the composition has the effects of relieving fever, resisting inflammation and the like while resisting viruses, and plays multiple roles in viral infection; secondly, the anti-virus agent has the functions of enhancing the immunity of organisms and effectively preventing viruses from entering cell tissues while resisting viruses; thirdly, the diversification of the effective components of the traditional Chinese medicine makes the virus difficult to generate drug resistance and the like; fourth, the traditional Chinese medicine has low treatment cost, is beneficial to reducing the medical cost and relieving the patient cost burden. The traditional Chinese medicine and the western medicine are combined with antivirus, so that the beneficial effects of reducing toxicity, improving efficiency, treating both principal and secondary aspect of disease, reducing cost and the like can be synergistically exerted.

In a preferred technical scheme of the invention, the traditional Chinese medicine is selected from any one or combination of honeysuckle, bupleurum, scutellaria baicalensis, houttuynia cordata, rhizoma polygonati, astragalus membranaceus, radix trichosanthis, liquorice, schisandra chinensis, epimedium herb, selfheal, radix sophorae flavescentis, white hyacinth bean, schizonepeta, moutan bark, white paeony root, cimicifuga foetida, sweet wormwood, perilla leaf, radix isatidis, american ginseng, goat horn, pokeberry root, yam, cantharides, brucea javanica, elsholtzia, bezoar, catechu, aloe, human placenta, garlic, ginseng leaf, burdock, perilla leaf, pyrrosia lingua, fructus forsythiae, ephedra, rhizoma anemarrhenae, peppermint, wrinkled gianthyssop, blackberry lily, cassia twig, dyer woad leaf, honeysuckle stem and herba Ajugae.

In the preferred technical scheme of the invention, the traditional Chinese medicine is selected from any one or combination of Huoxiang Zhengqi capsules, jin Huaqing sense granules, lianhua Qingshen capsules and/or granules, shuangfeng Jiedu capsules and/or granules, fangfengsheng pills and Shuanghuanglian oral liquid.

In order to clearly demonstrate the scope of the present invention, the present invention is defined by the following terms:

1. the "particle size" of the fampicvir in the invention refers to a particle size (D90) corresponding to 90% of the particle size distribution.

2. The crystal form determination method comprises the following steps: taking a proper amount of fine powder of a to-be-detected product, adding a proper amount of water, stirring, filtering, washing filter residues with a proper amount of water, vacuum drying the residues at 60 ℃ for 2 hours, and taking the dried residues for measurement according to an X-ray powder diffraction method (Chinese pharmacopoeia 2010 edition II appendix IX F).

Unless otherwise indicated, when the invention relates to a percentage between liquids, the percentages are volume/volume percentages; the invention relates to the percentage between liquid and solid, said percentage being volume/weight percentage; the invention relates to the percentage between solids and liquids, the percentage being weight/volume percentage; the balance being weight/weight percent.

Compared with the prior art, the invention has the following beneficial technical effects:

1. the solid pharmaceutical composition is scientifically screened and optimized, firstly, the preparation size of the fampicregion is reduced, the fampicregion is convenient for patients to swallow, the clinical medication scheme is simplified, the compliance of the patients in taking the medicine is obviously improved, and the cost of the medicine is reduced; secondly, the granularity and the granule powder property of the fampicregion are optimized, the compressibility is good, the hardness and friability of the tablet are obviously improved, the coating operation is facilitated, the uniformity of the quality of the preparation is ensured, the production efficiency is improved, the processing cost is reduced, and the product quality is improved; thirdly, the solid pharmaceutical composition is prepared by adopting a conventional preparation method in the field (such as a direct tabletting method, a dry granulating method, a wet granulating method and the like), and has good dissolution rate and stability; fourthly, the risk of crystal transformation of the fampicin preparation is obviously reduced, the uniformity, the effectiveness and the safety of the medicine are improved, and the quality control of the medicine is realized; fifthly, the solid pharmaceutical composition can be combined with other components for use, has flexible application mode and is suitable for a wide range of people.

2. The composition of the invention has simple and convenient preparation and obvious cost benefit, and is suitable for industrialized mass production.

Drawings

FIG. 1 dissolution profiles of examples 1-3 in acetate buffer at pH4.5 (left: example 1; middle: example 2; right: example 3).

Figure 2 example 3 powder diffraction pattern of fampicvir (figure 2a: 0 months of standing; figure 2b: 6 months of acceleration; figure 2c: 6 months of long term).

FIG. 3 dissolution profiles of example 3 and comparative example in acetate buffer at pH4.5 (left: example 3; right: comparative example).

FIG. 4 MTS assay results of fampicvir cytotoxicity to Vero cells.

FIG. 5 quantitative RT-PCR assay of the inhibition of viral infection by fampicvir on Vero cells.

Detailed Description

The following description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes or modifications according to the present invention without departing from the spirit of the present invention, and shall fall within the scope of the claims of the present invention.

Examples 1 to 3Preparation of Fabry-Perot tablets

The compositions of the fampicin tablets of examples 1-3 are shown in Table 1, and the preparation method comprises the following steps:

(1) Pretreatment of raw materials and auxiliary materials: treating Fapila Wei Fensui for later use; crushing crospovidone XL and sieving the crushed crospovidone XL with a 80-mesh sieve for later use; the colloidal silica was sieved through a 60 mesh sieve for use.

(2) And (3) preparing an adhesive: weighing the povidone K30 with the prescription dosage, adding a proper amount of purified water, stirring and dissolving the povidone K30, and preparing the povidone K30 into a 20% povidone K30 aqueous solution.

(3) Premixing: the recipe amounts of the fampicvir, the colloidal silicon dioxide and the crospovidone XL are weighed, placed in a dry grinding cup, and subjected to stirring (speed 400 r/min) and shearing (speed 800 r/min) for 5min to obtain premixed powder.

(4) Granulating: adding the adhesive solution with the prescription amount into the premixed powder, shearing (speed 1200 r/min), stirring (speed 400 r/min) for 1min, making soft material, sieving with 18 mesh sieve, and making wet granule.

(5) And (3) drying: the wet granules were dried in an oven to a moisture content of less than 3%.

(6) And (3) dry finishing: the dried granules were sieved through an 18 mesh sieve.

(7) Total mixing: adding the crosslinked povidone XL, the colloidal silicon dioxide and the sodium stearyl fumarate into the dry particles, and uniformly mixing.

(8) Tabletting: round shallow concave stamping sheets with the diameter of 8mm are adopted.

(9) Coating: weighing coating powder with prescription amount, slowly adding into purified water under stirring, magnetically stirring for 45min, and sieving with 100 mesh sieve.

Table 1 examples 1-3 fampicin tablet compositions

Examples 4 to 6Examination of tablet Properties and dissolution

1. Examination of tablet Properties

The properties of the tablets of examples 1-3 were examined and the results are shown in Table 2.

Table 2 examples 1-3 tablet properties

As is clear from the results in Table 2, the granules prepared in examples 1 to 3 were uniform, good in fluidity and compressibility, free from sticking and punching during tabletting, smooth and clean in surface, stable in weight, and satisfactory in hardness and friability.

2. Dissolution measurement

The dissolution properties of the tablets of examples 1-3 were examined using a second paddle method, 50rpm/min, with 900mL of acetate buffer at pH4.5 as dissolution medium, and the results are shown in Table 3 and FIG. 1.

Table 3 dissolution rates (n=6) for the tablets of examples 1 to 3

As is clear from the results shown in Table 3 and FIG. 1, the tablets of examples 1 to 3 all showed good dissolution properties, and the tablets in which the amount of silica was 3.9% or more showed better dissolution properties.

3. Prescription stability investigation

The stability of the tablets of example 3 was examined and the results are shown in Table 4.

Table 4 example 3 tablet stability

As is clear from the results in Table 4, the tablet of example 3 was left under high temperature (60 ℃ C.), high humidity (RH 92.5%) and light irradiation for 10 days, and the weight of the sample was slightly increased for 10 days under high humidity (RH 92.5%), and the individual impurities and the total impurities (%) were not significantly changed from those for 0 days, which were in accordance with the standard limit requirements.

Example 7Study of Crystal form stability

As can be seen from fig. 2, the powder diffraction pattern of the sample in example 3 shows that the X-ray powder diffraction pattern of the sample with 0 month and 6 months of acceleration and long-term 6 months stability is basically consistent, and the crystal form is unchanged, which indicates that the crystal form is stable during the preparation and storage processes.

Example 8Tablet hardness comparative study

1. Preparation of comparative examples

The crude drug of the fampicin of the comparative example is directly 60 meshes without being crushed, and other formulation compositions and preparation methods are the same as those of the example 3.

2. Comparative study of tablet Properties and dissolution of example 3 and comparative example

(1) The tablet properties of example 3 and comparative example were examined and the results are shown in Table 5.

Table 5 comparative and example 3 tablet properties

As can be seen from Table 5, the pellets produced in the comparative example were inferior in compactibility, and the compressed tablet cores had a friability of 1.03% and did not meet the quality requirements for tablet cores having friability of not more than 1.0%. Example 3 chip friability was 0.49% meeting the quality requirements for chip friability not higher than 1.0%. It is explained that the granule compressibility and tablet friability can be significantly improved by pulverizing the crude drug.

2. The dissolution performance of example 3 and comparative example was examined, and the results are shown in Table 6 and FIG. 3.

Table 6 dissolution performance of comparative example and example 3 (n=6)

As can be seen from Table 6 and FIG. 3, the dissolution rates of example 3 and comparative example in acetate buffer at pH4.5 for 15min were 89.33% and 84.74%, respectively. It is explained that dissolution of the tablet can be significantly improved by pulverizing the crude drug.

Example 9Inhibition study of novel coronaviruses (2019-nCoVs) by Fapirrevir

1. Experimental materials

Fapiravir (production lot number: CP075-141002, content or purity: 99.9%); vero cells were purchased from american standard collection for organisms (ATCC), maintained by the virology laboratory of the institute of microbiology, the military medical institute; novel coronavirus Beijing isolates (2019-nCoVBetaCoV/Beijing/AMMS 01/2020) were isolated and stored by the institute of microbiology, the institute of epidemics, of the military medical institute; the culture medium for culturing Vero cells is DMEM liquid medium containing 10% Fetal Bovine Serum (FBS), 1% double antibody (Pen-strep) and 10mM Hepes; fluorescent quantitative RT-PCR primers and probes are designed in the conserved regions of the virus by utilizing Oligo7 and SeqBuilder software according to the full-length genome sequence of the virus, and the primers and the probes are synthesized by Shanghai biological engineering Co., ltd, and have a PAGE grade and purity of >98 percent, and are shown in Table 7.

TABLE 7 quantitative RT-PCR detection primers and probes for novel coronaviruses

Primer name	Position of	Primer sequence 5'-3'
			Cov-real time F3	22312-22333	TCCTGGTGATTCTTCTTCAGGT
CoV-real time-R3	22436-22455	TCTGAGAGAGGGTCAAGTGC
			Cov-real time P3	22334-22354	FAM-AGCTGCAGCACCAGCTGTCCA-BHQ1

2. Experimental method

(1) Vero cell culture

At 75cm ² The culture flask was charged with 12mL of DMEM complete medium at 5% CO ₂ Culturing in a cell culture box with saturated humidity at 37 ℃ for 3 days for one passage. The old medium was removed at passage, the cells were washed 1 time with PBS, 2mL of 0.25% pancreatin-EDTA was added, and digested in the incubator for 3min. Cell rounding was observed under an optical microscope, pancreatin was discarded, then digestion was stopped by adding 9mL of medium, and the cells were pipetted into single cells according to 1:3, adding the cell sap into a new culture bottle, adding new culture medium to 12mL, mixing, and adding 5% CO at 37deg.C ₂ The cells were continuously cultured in a saturated humidity cell incubator.

(2) Virus expansion culture

The day before the experiment, vero cells were grown at 1:3 are inoculated into a culture flask of T75, and are used for experiments when the cell density is over 90 percent. Adding novel coronavirus solution with MOI=0.1 into T75 culture flask, and adding 5% CO at 37deg.C ₂ Is incubated in the incubator for 1hr. 15mL of 2% FBS DMEM medium was added to the flask at 37℃with 5% CO ₂ Is cultured in an incubator for 3 days. The virus solution was collected into a 50mL centrifuge tube, centrifuged at 6000rpm for 10min at 4℃and the supernatant was collected, sub-packaged and stored at-80 ℃.

(3) Virus TICD ₅₀ Measurement

Vero cells were seeded into 96-well plates at 10000/Kong Nongdu a day in advance. The virus solution was diluted 10-fold in a gradient with DMEM medium containing 2% fbs (10 ^-2 ～10 ^-9 ). The primordial cell culture medium in the 96-well plate was aspirated, 200. Mu.L/well of virus solution was added to the 96-well plate, and 4 wells were prepared. At 37℃with 5% CO ₂ Incubation in a cell incubator. Cytopathy (CPE) was observed daily for 4 days. Viral half-maximal infection dose (TCID) was calculated by Reed-Muench method ₅₀ )。

(4) Drug cytotoxicity assay

Vero cells were seeded into 96-well plates at 10000/Kong Nongdu a day in advance. After the cells were grown to a monolayer, the culture solution was discarded from the 96-well plate, and 100. Mu.L/well of 2% FBS DMEM-containing drugs of different concentrations (initial concentration: 400. Mu.M, 3-fold dilution gradient was used to dilute the drug to be tested, total of 8 concentrations) was added, and 3 wells were measured for each concentration. And medium control and normal cell control groups were established. The culture was continued and the cell state was observed daily. 72 hours after dosing, 20. Mu.L MTS solution, 37℃and 5% CO were added ₂ The conditions were incubated for 1 hour and OD490 was determined. The cytotoxicity of the drug was calculated using the formula:

finally, the data is subjected to S fitting analysis by using Graphpad Prism7 software, and the CC of the medicine is calculated ₅₀ 。

(5) Inhibition of novel coronaviruses by fampicvir

Vero cells were seeded into 96-well plates at 10000/Kong Nongdu a day in advance. After the cells had grown to a monolayer, the 96-well plate was discarded, and the culture broth was diluted to 100TCID with DMEM maintenance solution containing 2% FBS ₅₀ 100. Mu.L/well of novel coronavirus solution, and placing at 37℃in 5% CO ₂ Incubator culture for 2hr. Discarding virus solution, adding DMEM maintenance solution containing 2% FBS to obtain 400,200. 100, 50, 25 and 12.5. Mu.M solution of fampicin, 200. Mu.L/well. Each drug 3 was multiplexed. And virus control and normal cell control groups were established. Placing at 37 ℃ 5% CO ₂ Incubator cultures were observed daily for Cytopathy (CPE). At 2 days post infection, 100 μl of cell culture supernatant was taken per concentration drug treatment group well, nucleic acids were extracted, and viral RNA copy number was detected using quantitative RT-PCR. Drug 50% Effective Concentration (EC) was calculated by fitting a dose-response curve ₅₀ )。

A. Viral nucleic acid extraction

Viral nucleic acid was extracted from the cell supernatant using QIAampViral RNA Mini Kit from QIAGEN. 1) Sucking 560 mu L of AVL buffer (nucleic acid extraction lysate) containing carrier RNA into a centrifuge tube of 1.5ml in a biosafety cabinet; 2) Sucking 100 mu L of cell culture supernatant (gun head is discarded in a collector containing 75% ethanol disinfectant) treated by different concentrations of medicines, adding the cell culture supernatant into the AVL buffer solution, and uniformly mixing by pulse vortex for 15 seconds; 3) Incubating for 10 minutes at room temperature, and simply centrifuging to enable the liquid at the top end of the centrifuge tube to fall to the bottom; 4) Adding 560 mu L of absolute ethyl alcohol into the sample, uniformly mixing for 15 seconds, and simply centrifuging; 5) Carefully add 630. Mu.L of liquid to the non-wetted QIAamp column, cover the lid, centrifuge 8000rpm/min for 1min, discard the collection tube, place the column on a new 2ml collection tube; opening the cover of the QIAamp column, and repeating the step 5 until the sample is centrifuged completely; 6) Opening the lid, adding 500. Mu.L of AW1 buffer to the column, covering the lid, centrifuging 8000rpm/min for 1min, discarding the collection tube, and placing the column on a new 2ml collection tube; 7) Opening the cover, adding 500 mu L of AW2 buffer solution, covering the cover, centrifuging at 14000rpm/min for 3min; 8) Placing the column on a new 2ml collecting tube, and carrying out air-separation for 1min; the column was placed on a new 1.5ml centrifuge tube, 60. Mu.LAVE elution buffer was added, and the column was allowed to stand at room temperature for 1min, and centrifuged at 8000rpm/min for 1min. The centrifugate is viral RNA, and is immediately detected or stored below-80 ℃.

B. Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection of viral nucleic acid load

Quantitative RT-PCR detection was performed using One Step RT-PCR kit (RR 064A) from Takara. 20. Mu.L of the reaction system is shown in Table 8.

Table 8 fluorescent quantitative RT-PCR detection system

20. Mu.L of the reaction solution was put into a Roche adapter 96-well Plate (LightCycler 480 Multiwell Plate 96, 04729692001), centrifuged at 3000rpm/min at low speed for 30s, and amplified in a Roche LightCycler480 II quantitative PCR apparatus under the reaction conditions: reverse transcription is carried out for 5min at 42 ℃ and pre-denaturation is carried out for 10s at 95 ℃; denaturation at 95℃for 5s, annealing at 60℃for 20s, amplification for 40 cycles, and fluorescence signal collection at the end of each cycle. According to the conversion formula of the viral RNA copy number and CT value: RNA Copies/mL = CT (-0.3) +13.17, viral RNA load was calculated. Using Graphpad Prism 7 software, 50% Effective Concentration (EC) was calculated by fitting a dose-response curve ₅₀ )。

(6) Selection index si=cc ₅₀ /EC ₅₀

3. Experimental results

(1) Virus TCID ₅₀ Titration

The Cytopathic (CPE) effect of the novel coronaviruses on Vero cells was observed with an inverted microscope and the virus half-dose (TCID 50) was calculated using the Reed-Muench method. See table 9. As can be seen from the results in Table 9, the TCID of the virus on Vero cells ₅₀ Titer is Log ₁₀ 5.4/mL。

TABLE 9 TCID50 titres of novel coronaviruses on Vero cells

(2) Drug cytotoxicity assay (MTS method)

The cytotoxicity of various concentrations of fampicvir on Vero cells was measured by the MTS method and the median toxic concentration (CC ₅₀ ). The results are shown in FIG. 4. As can be seen from the results of FIG. 4, the methodCC of Piravir on Vero cells ₅₀ >400μM。

(3) Inhibition of novel coronaviruses by fampicvir (EC ₅₀ )。

Method for inhibiting novel coronavirus effect at cellular level by using nucleic acid quantitative method to determine pilavir, and calculating EC of drug ₅₀ . The results are shown in FIG. 5. From the results of FIG. 5, it can be seen that the fapirrevir has an inhibitory effect on 2019-nCoV novel coronavirus at the cellular level, and that EC thereof ₅₀ 67. Mu.M.

(4) Viral inhibition of fampicvir on Vero cells

According to CC ₅₀ And EC (EC) ₅₀ Calculating the selection index SI of the fampicregion>5.97. The results are shown in Table 10.

Table 10 cytotoxicity of Fabry-Perot on Vero cells and Virus inhibition results

As shown in Table 10, the inhibition of 2019-nCoV novel coronavirus by fampicvir in Vero cells was shown to be EC ₅₀ A value of 67. Mu.M, a selection index SI>5.97。

4. Conclusion of the experiment

Fapiravir is effective in inhibiting novel coronaviruses (EC) ₅₀ =67), and has no toxic effect on normal cells.

The above description of the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes or modifications according to the present invention without departing from the spirit of the present invention, and shall fall within the scope of the claims of the present invention.

Claims

1. The solid pharmaceutical composition comprises 70-80% of fampicvir and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier comprises 2-5% of povidone K30, 12-20% of crospovidone XL, 0.1-0.4% of sodium stearyl fumarate and 1.5-6% of colloidal silicon dioxide, and the fampicvir is required to be crushed.

2. The solid pharmaceutical composition of claim 1, wherein the crystalline form of famprivir is shown in figure 2 a.

3. The solid pharmaceutical composition of claim 1, wherein the particle size of the fampicregion is no greater than 100 μιη.

4. A solid pharmaceutical composition according to claim 3, wherein the particle size of the fampicin is no more than 80 μm.

5. The solid pharmaceutical composition of claim 4, wherein the particle size of the fampicin is no more than 50 μm.

6. The solid pharmaceutical composition of any one of claims 1-5, wherein the fampicvir is substantially free of seeding during preparation, storage, and use of the formulation.

7. The solid pharmaceutical composition of claim 6, wherein substantially no seeding occurs means that the rate of seeding of fampicvir is no higher than 5% when stored at 40 ℃ ± 2 ℃ and a relative humidity of 75% ± 5% rh humidity for 6 months.

8. The solid pharmaceutical composition according to any one of claims 1-5, in a form selected from any one of tablets, capsules, granules, powders.

9. The solid pharmaceutical composition of claim 8, wherein a formulation of the solid pharmaceutical composition is coated with a coating to provide a modified release form.

10. The solid pharmaceutical composition of claim 9, wherein the modified release form is selected from controlled release.

11. The solid pharmaceutical composition of claim 8, wherein the tablet is prepared in a variety of possible shapes.

12. The solid pharmaceutical composition of claim 11, wherein the tablet is selected from any one of an ellipsoid, a two-sided convex circular shape.

13. The solid pharmaceutical composition of claim 12, wherein the tablet shape is selected from any one of a round tablet, an oval tablet, a capsule-shaped tablet, a triangular tablet, a rectangular tablet, a square round tablet, and a shaped tablet.

14. The solid pharmaceutical composition of claim 8, wherein the tablet has a diameter of 6-10mm.

15. The solid pharmaceutical composition of claim 14, wherein the tablet has a diameter of 7-8mm.

16. A method for preparing a solid pharmaceutical composition containing fampicvir, comprising the steps of: (a) Weighing a required amount of fampicin and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is selected from a combination of povidone K30, crospovidone XL, sodium stearyl fumarate and silicon dioxide, and uniformly mixing the combination; (b) Preparing the mixture prepared in the step (a) into any one of tablets, capsules, granules and powder, wherein the content of the fampicin is 70-80% by weight, the content of povidone K30 is 2-5% by weight, the content of crospovidone XL is 12-20% by weight, the content of sodium stearyl fumarate is 0.1-0.4% by weight, the content of colloidal silicon dioxide is 1.5-6% by weight, and the fampicin is required to be crushed.

17. The process according to claim 16, wherein the tablet obtained in step (b) is coated with a film.

18. The preparation method according to claim 16, wherein the tablet, capsule, granule or powder obtained in the step (b) is subjected to a light-shielding treatment.

19. The preparation method according to claim 18, wherein any one of the tablet, capsule, granule, and powder prepared in the step (b) is subjected to light-shielding treatment by a blister pack.

20. The preparation method according to claim 16, comprising the steps of: a) Weighing the fapirrevir and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is selected from the combination of povidone K30, crospovidone XL, sodium stearyl fumarate and silicon dioxide; b) Pretreating a pharmaceutically acceptable carrier; c) Premixing; d) Granulating; e) Drying; f) Finishing; g) Mixing; h) Making the mixture obtained in the step g) into any one of tablets, capsules, granules and powder.

21. The preparation method according to claim 20, wherein the povidone K30 is 15-30% povidone K30 aqueous solution.

22. The method of claim 20, wherein the pre-treating the pharmaceutically acceptable carrier of step b) comprises the steps of: crushing and sieving the crosslinked povidone XL and colloidal silicon dioxide for later use.

23. The method of claim 20, wherein the pre-mixing process of step c) comprises the steps of: mixing the fampicin with the pretreated crospovidone XL and colloidal silicon dioxide prepared in the step b), stirring and shearing, and granulating by a wet method.

24. The process according to claim 23, wherein the stirring speed in step c) is 250-500r/min; the shear rate in step c) is 600-900r/min; the mixing time in step c) is 2-10min.

25. The process according to claim 24, wherein the stirring speed in step c) is 400r/min; the shear rate in step c) was 800r/min; the mixing time in step c) is 2-10min.

26. The process of claim 25, wherein the mixing time in step c) is 5 minutes.

27. The method of claim 20, wherein said granulating of step d) comprises the steps of: slowly adding povidone K30 under shearing and stirring conditions, making soft material, discharging, and sieving.

28. The process according to claim 27, wherein the shear rate in the granulation process of step d) is 100-1500r/min and the stirring rate in the granulation process of step d) is 300-500r/min.

29. The method according to claim 28, wherein the shear rate in the granulating process of step d) is 1200r/min and the stirring rate in the granulating process of step d) is 400r/min.

30. The method of claim 20, wherein the drying step e) is performed by granulating the step d) and drying the granules so that the moisture content of the granules is not more than 3%.

31. The method of claim 30, wherein the drying step e) is performed by granulating the step d) and drying the granules so that the moisture content of the granules is not more than 2%.

32. The preparation method according to claim 20, wherein the total mixing treatment of step g) comprises the steps of: sieving the crosslinked povidone XL and colloidal silicon dioxide with a 10-50 mesh sieve, uniformly mixing the powder with the dry particles prepared in the step e), adding sodium stearyl fumarate, and mixing for 1-10min until uniform mixing.

33. The process of claim 16, wherein the crystalline form of fampicin is shown in figure 2 a.

34. The process of claim 16, wherein the particle size of the fampicin is no more than 100 μm.

35. The process of claim 34 wherein the particle size of the fampicin is no more than 80 μm.

36. The process of claim 35 wherein the particle size of the fampicin is no more than 50 μm.

37. The method of manufacture of any one of claims 16-36, wherein the solid pharmaceutical composition comprises fampicin that is substantially free of seeding during preparation, storage, and use.

38. The method of claim 37, wherein substantially no seeding is at 40 ℃ ± 2 ℃ and 75% ± 5% rh humidity relative humidity for 6 months, and wherein the rate of seeding is no higher than 5%.

39. Use of a fampicin composition according to any one of claims 1-15 for the preparation of a viral RNA polymerase inhibitor.

40. Use of a fampicin composition according to any one of claims 1-15 for the preparation of a mutation-inducing agent that is fatal to a virus.

41. Use of a fampicin composition according to any one of claims 1-15 for the preparation of a medicament for the prevention and/or treatment of a novel coronavirus infection.

42. The use of claim 41, wherein said treating a novel coronavirus infection is selected from any one of decreasing 2019-nCoV replication capacity, decreasing 2019-nCoV load, increasing viral clearance, or a combination thereof.

43. The use according to claim 41, wherein said preventing a novel coronavirus infection is selected from any one of reduced susceptibility to 2019-nCoV, reduced ability to sustain infection, or a combination thereof.

44. Use of a fampicin composition according to any one of claims 1-15 for the preparation of a medicament for the prevention and/or treatment of influenza virus infection.

45. The use according to claim 44, wherein said treating influenza infection is selected from any one of reducing influenza replication, reducing influenza load, increasing viral clearance, or a combination thereof.

46. The use according to claim 44, wherein said preventing influenza virus infection is selected from any one of reduced influenza virus susceptibility, reduced ability to sustain infection, or a combination thereof.

47. The use according to claim 44, wherein the influenza virus infection is selected from acute respiratory tract infections caused by influenza virus.

48. Use of a fampicin composition according to any one of claims 1-15 for the preparation of a medicament for the prevention and/or treatment of ebola virus infection.