CN113186266B

CN113186266B - Method for detecting human CYP2D6 gene copy number variation

Info

Publication number: CN113186266B
Application number: CN202110632262.XA
Authority: CN
Inventors: 魏宁; 何熲; 张辉; 韩燕�
Original assignee: Shanghai Kangli Diagnostic Technology Co ltd
Current assignee: Shanghai Kangli Diagnostic Technology Co ltd
Priority date: 2021-06-07
Filing date: 2021-06-07
Publication date: 2023-04-07
Anticipated expiration: 2041-06-07
Also published as: CN113186266A

Abstract

The invention provides a method for detecting human CYP2D6 gene copy number variation, which comprises the following steps: selecting known genome copy of sample to be testedTaking two DNA sequences with definite copy number and no copy number variation as internal reference genes, and calculating the difference Ct between the Ct values of the two internal reference genes ₀ Judging whether the degradation degree of the sample reaches the degree of inaccurate detection; if the Ct is ₀ If the threshold value which cannot ensure the accuracy of the detection result is reached, resampling is prompted for DNA extraction; if the Ct is ₀ Within the threshold range ensuring the detection result to be accurate, calculating the difference value of the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes to obtain the Ct ₁ And further judging the variation condition of the CYP2D6 copy number of the sample to be detected. According to the invention, the quality problem of the sample is eliminated, the accuracy of the CNV detection result is ensured, the operation is convenient and quick, the detection time is shortened, and the high cost brought by sequencing is saved.

Description

Method for detecting human CYP2D6 gene copy number variation

Technical Field

The invention relates to the field of molecular biology, in particular to a method for detecting human CYP2D6 gene copy number variation.

Background

CYP2D6 is responsible for the metabolic task of 20% -30% of drugs in humans. Many studies have shown that CYP2D6 enzyme activity has a very high correlation with the polymorphism of the gene, and the activity is rarely induced to change. And CYP2D6 Copy Number Variation (CNV) is closely related to its activity. For example, 5 is homozygously mutated to 0 copies, and human CYP2D6 enzyme activity of this genotype is extremely low, which easily causes accumulation of drugs metabolized by CYP2D6 and is liable to cause adverse reactions. And people carrying CYP2D6 copy (3 CNV) and above have very high enzyme activity and very high elimination rate of medicines metabolized by the people, and medicines with conventional doses often cannot reach effective blood concentration in the human body, so that the tolerance to the medicines is shown. Therefore, accurate detection of the copy number of CYP2D6 is very important for determining the metabolic activity pattern of CYP2D 6.

Common methods for detecting CYP2D6 CNV include fluorescence quantitative PCR, first-generation sequencing, second-generation sequencing, long-fragment PCR electrophoresis, and recently-developed digital PCR. The current fluorescent quantitative PCR method is limited by the definition of an interpretation threshold value and the like, and samples of the same person appear in some cases, and the CNV results of two times of measurement are inconsistent. The first-generation sequencing method and the second-generation sequencing method have higher requirements on splicing analysis of sequencing results, the final splicing result cannot be ensured to be completely accurate, and meanwhile, the sequencing method is complicated in procedure, and high in time consumption and consumption. Although the long-fragment PCR electrophoresis method has high accuracy, the electrophoresis detection needs to be carried out after the PCR, and the operation is complicated and time-consuming. The digital PCR method is similar to the fluorescent quantitative PCR, and although the method is an absolute quantitative method, the CNV results obtained by sampling and measuring samples of the same person twice are inconsistent under the condition of the same interpretation threshold, the results are not necessarily accurate, and the cost is high.

At present, no biological product for obtaining the medical device registration certificate aiming at CYP2D6 copy number variation detection exists in the market, and the kit for research and development comprises: agena Veridose CYP2D6 (MALD-TOF), thermolish CYP2D6 (fluorescent quantitative PCR) and the like. The Agena product also has the disadvantages of complicated experimental steps, high environmental requirements and the like, while the thermolish product is calibrated by only adopting one internal reference gene, and the problem of inaccuracy is caused by the fact that the sample quality (inaccurate judgment caused by degradation and the like) is not considered.

Disclosure of Invention

The invention aims to provide a method for detecting human CYP2D6 gene copy number variation, so as to solve the problems of low accuracy, complex procedure, time and labor waste of the method for detecting human CYP2D6 copy number variation in the prior art.

In order to solve the technical problem, the invention adopts the following technical scheme:

there is provided a method of detecting human CYP2D6 copy number variation for non-disease diagnostic purposes, said method comprising the steps of: a: selecting two DNA sequences with determined copy number and no copy number variation in the known genome of a sample to be detected as reference genes, and respectively designing corresponding primers and probes aiming at the sequence characteristics of the human CYP2D6 gene and the two selected reference genes; b: obtaining extracted genome DNA of a sample to be detected; c: in a reaction system, mixing the primer and the probe, and adding the mixture into a reaction solution; d: carrying out real-time quantitative fluorescent PCR detection; e: by calculating thisCt value difference Ct of two reference genes ₀ Judging whether the degradation degree of the sample reaches the inaccurate detection degree; if the Ct is ₀ If the threshold value which cannot ensure the accuracy of the detection result is reached, resampling is prompted for DNA extraction; if the Ct is ₀ Within the threshold range ensuring the detection result to be accurate, calculating the difference value of the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes to obtain the Ct ₁ Through the Ct ₁ And judging the variation condition of the CYP2D6 copy number of the sample to be detected.

The invention mainly claims a method for judging the degradation degree of a sample by simultaneously setting two internal reference genes so as to accurately judge the CYP2D6 copy number variation condition of the sample to be detected, so that the phenomenon that the CYP2D6 gene copy number variation detection accuracy is not high due to overhigh degradation degree of the sample, namely the quality problem of the sample is avoided. The selection of the reference gene is only required to ensure that the reference gene is a DNA sequence with definite copy number and no copy number variation in the known genome of the sample to be tested, so the specific type of the reference gene is not limited in the invention.

It should be understood that, depending on the selection of the reference gene, the determination conditions are different from each other, and the determination conditions can be determined by those skilled in the art according to the verification of a large number of samples during the development of the kit, and the determination of the determination conditions can be realized by those skilled in the art according to the conventional technical means.

It should also be understood that the difference between the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes in step E is calculated to obtain the Ct ₁ In this case, one reference gene may be selected, and the determination threshold for different reference genes is different. However, the threshold value can be determined by those skilled in the art based on the validation of a large number of samples during the development of the kit.

According to a preferred embodiment of the present invention, when the reference gene is RPPH gene and TERT gene, step E comprises: calculating the CT difference value of RPPH gene minus TERT gene as CT ₀ If-1.5 is equal to or less than CT ₀ The quality of the sample is judged to be qualified if the sample quality is less than or equal to 0; if CT ₀ If the sample quality is more than 0 or less than-1.5, the sample quality is unqualified; after the sample is qualified, calculating the difference value of the Ct value of the CYP2D6 gene minus the Ct value of one of the internal reference genes (TERT) to obtain CT ₁ When CT ₁ <A 0 copy variation at-1, CT-1 ≦ ₁ <0.5, the number of copies is judged as 1 copy variation, CT is 0.5 or less ₁ <At 1.4, 2 copies of the mutant were judged, CT ₁ And judging the copy number is more than or equal to 1.4, and judging the copy number is 3.

According to this preferred embodiment, the primers and probes designed in step A are as follows: an upstream primer CYP2D6-F for the human CYP2D6 gene: 5 'CACCAGGAAAAGCAAAGACAC-3'; the downstream primer CYP2D6-R aiming at the human CYP2D6 gene: 5 'TGCAGCACTTCAGCTTCT-3'; an upstream primer TERT-F aiming at a reference gene TERT gene segment: 5' AGGGTCCTCGCCTGTGTA-; the downstream primer TERT-R aiming at the reference gene TERT gene segment: 5 'CCCAGATATTCGCCATTGTTCAzone 3'; an upstream primer RPPH-F aiming at an internal reference gene RPPH gene segment: 5'-CCGCCTCTGGCCCTAGT-3'; a downstream primer RPPH-R aiming at the reference gene RPPH gene segment: 5 'GCCACGAGCTGTAGTGCGT-3'; a Probe CYP2D6-Probe for identifying human CYP2D6 mutation: 5'-FAM-TGGGCCGGGGCTGTCCAGTG-BHQ1-3'; and (2) identifying the Probe TERT-Probe with reference gene TERT gene fragment conserved sequence specificity: 5'-CY5-CAGGGCACACCTTTGGTCACTCCA-BHQ3-3'; and (3) identifying the Probe TERT-Probe with the conserved sequence specificity of the reference gene RPPH gene fragment: 5 '-VIC-TGTCACTCCACTCCCATGTCCTTGG-BHQ 1-3'.

Preferably, the concentration of each primer used in step C is 800 to 1000nM, and the concentration of each probe is 200 to 300nM.

According to another preferred embodiment of the present invention, when the reference gene is a β -globin gene and an ALB gene, the CT difference obtained by subtracting the ALB gene from the β -globin gene is calculated as CT ₀ If 0 is less than or equal to CT ₀ Less than or equal to 0.9, and judging that the quality of the sample is qualified; if CT ₀ If the sample quality is more than 0.9 or less than 0, the sample quality is unqualified; after the sample is qualified, calculating the difference value of the Ct value of the CYP2D6 gene minus the Ct value of the beta-globin gene to obtain CT ₁ If CT ₁ <0.5 as 0 copy variation, 0.5. Ltoreq.CT ₁ <1.0, the number of copies is judged as 1 copy variation, 1. Ltoreq. CT ₁ <1.7, 2 copies of the mutant, CT ₁ At most 1.7, the number of copies of the mutant was judged to be 3.

The primers and probes designed in step a are as follows: an upstream primer CYP2D6-F for the human CYP2D6 gene: 5 'CACCAGGAAAAGCAAGACACAC 3'; the downstream primer CYP2D6-R aiming at the human CYP2D6 gene: 5 'TGCAGCACTTCAGCTTCT-doped 3'; an upstream primer ALB-F aiming at an internal reference gene ALB gene segment: 5 'GGAGAAGGTCACTACTTGAAGAGATT-3'; a downstream primer ALB-R aiming at an internal reference gene ALB gene segment: 5' CATGAGAGATTAGTATTTGC-; an upstream primer beta-globin-F aiming at a reference gene beta-globin gene fragment: 5 'GTGGATGAAGTTGGTGGTGAG-3'; a downstream primer beta-globin-R aiming at a reference gene beta-globin gene segment: 5 'TAACAGCACTAGGAGGAGTGGACAG-3'; a Probe CYP2D6-Probe for identifying human CYP2D6 mutation: 5'-FAM-TGGGCCGGGGCTGTCCAGTG-BHQ1-3'; a Probe ALB-Probe for identifying the conserved sequence specificity of the internal reference gene ALB gene fragment: 5'-VIC-CTATATTCCTTCCCTTAATTAACTCTGTTT-MGB-3'; a Probe beta-globin-Probe for identifying the conserved sequence specificity of the reference gene human beta-globin gene fragment: 5'-CY5-AAGGTTACAAGACAGGTTTAAGGAGACCAATAG-BHQ1-3'.

As described in the background section of the present invention, CYP2D6 enzymes are involved in the liver metabolism of approximately 25% of the commonly used drugs including antidepressants, antipsychotics, antiarrhythmics, opioids and beta-blockers etc., and the copy number variation of the CYP2D6 gene (e.g., loss of 5, 36X2, 36+ 10 rearrangement, etc.) plays a key role in the metabolism of individual drugs.

Through reasoning and testing, the inventor finds that the results of two measurements before and after the ordinary fluorescent quantitative PCR are inconsistent because the degradation degrees of the DNA samples extracted twice are different. Because the common fluorescent quantitative PCR is used for judging the CNV value of a sample by the ratio of the amplification signal of the CYP2D6 gene to the amplification signal of a single internal reference gene. If the sample is degraded to a certain degree, the ratio of the number of the DNA fragments containing the CYP2D6 gene to the number of the DNA fragments of the internal reference gene may have a large deviation from the true value, and at this time, the ratio detected by the fluorescence quantitative PCR may fall within the interpretation threshold of other CNVs, resulting in inaccurate final interpretation results.

In contrast, the invention proposes to adopt two DNA sequences which are determined by the copy number in the known genome and have no copy number variation as the internal reference genes at the same time for the first time, then uses the difference of the Ct values of the two internal reference genes to judge whether the degradation degree of the sample reaches the inaccurate detection degree, and prompts resampling to carry out DNA extraction if the Ct difference reaches the threshold value which can not ensure the accuracy of the detection result; and if the Ct difference value is within the threshold range which ensures the accuracy of the detection result, calculating the difference value between the CYP2D6 gene amplification Ct value and the Ct value of one of the internal reference genes, and judging the CNV number of the sample according to the Ct difference value. The invention successfully eliminates the inaccuracy of the detection result caused by the degradation of the sample DNA by setting two reference genes.

The key point of the invention is that double internal references are added at the same time as qualified parameters of an evaluation sample, the risk of misjudgment caused by sample quality problems is avoided, the simultaneous detection of 3 target genes (including CYP2D6 gene and two internal reference genes) is realized in a single tube, on the premise of ensuring performance indexes such as detection accuracy, reproducibility, detection limit and the like, the reagent and consumable cost are reduced to the maximum extent, the operation of experimenters is simplified, meanwhile, the UDG enzyme in reaction liquid can effectively prevent false positive amplification possibly caused by aerosol, and the accuracy of detecting copy number variation of clinical samples is further ensured.

In conclusion, according to the method for detecting human CYP2D6 gene copy number variation provided by the invention, the quality problem of the sample is eliminated, so that an unreliable result is eliminated, the accuracy of the human CYP2D6 gene copy number variation detection result is ensured, the operation is convenient and rapid, the detection time is saved, and the high cost brought by sequencing is saved.

Drawings

FIG. 1 shows the results of the detection of a single internal reference kit for DNA samples extracted immediately in case one;

FIG. 2 shows the result of the detection of the DNA single internal reference kit extracted after the simulation transportation in case one;

FIG. 3 shows the detection results of the double internal reference kit 1 for DNA samples extracted immediately in case one;

FIG. 4 shows the result of detection of the DNA double reference kit 1 extracted after simulated transportation in case one;

FIG. 5 shows the detection results of the double internal reference kit 1 for DNA samples extracted immediately in case two;

FIG. 6 shows the results of the detection of the double internal reference kit 1 for DNA samples extracted five days after the simulated transportation in case two;

FIG. 7 shows the result of detection by the double reference kit 2 for DNA samples extracted immediately in case two;

FIG. 8 shows the results of the detection of the DNA sample extracted five days after the simulated transportation in case two with the double internal reference kit 2.

Detailed Description

The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

Example 1 design of primer Probe combination 1

According to the preferred embodiment, the TaqMAN fluorescence quantitative method is adopted for specifically amplifying CYP2D6 exon 9 region, double internal references TERT and RPPH are added as qualified parameters of an evaluation sample, the risk of misjudgment caused by sample quality problems is avoided, and the simultaneous detection of 3 target genes (2D6 + TERT + RPPH) is realized in a single tube. The invention designs primers and probes respectively aiming at human CYP2D6 gene, TERT internal reference gene and RPPH internal reference gene, the nucleotide sequences of which are shown in the following table 1, and the preferable use concentrations of the primers and the probes are also shown.

TABLE 1 sequences of primer-probe combination 1 designed for human CYP2D6 copy number detection

Primer name	Sequence of	Concentration nM
			CYP2D6-F(SEQ ID No.1)	CACCAGGAAAGCAAAGACAC	900
CYP2D6-R(SEQ ID No.2)	TGCAGCACTTCAGCTTCT	900
			TERT-F(SEQ ID No.3)	AGGGTCCTCGCCTGTGTA	900
TERT-R(SEQ ID No.4)	CCCAGATTCGCCATTGTTCA	900
			RPPH-F(SEQ ID No.5)	CCGCCTCTGGCCCTAGT	900
RPPH-R(SEQ ID No.6)	GCCACGAGCTGAGTGCGT	900
			CYP2D6-Probe(SEQ ID No.7)	FAM-TGGGCCGGGGCTGTCCAGTG-BHQ1	250
TERT-Probe(SEQ ID No.8)	CY5-CAGGGCACACCTTTGGTCACTCCA-BHQ3	250
			RPPH-Probe(SEQ ID No.9)	VIC-TGTCACTCCACTCCCATGTCCCTTGG-BHQ1	250

Example 2A Dual internal reference assay kit 1 for detecting human CYP2D6 copy number variation

1. The main components

According to the preferred embodiment, a kit for detecting human CYP2D6 copy number variation is provided, and the main components of the kit are shown in table 2 below.

TABLE 2 major Components of the kit

/>

2. Components necessary for detection but not included in the kit

1.5mL centrifuge tubes (for preparing PCR reactions and DNA extraction), 0.2mL PCR tubes or 8-up tubes or 96-well plates, stoppered tips (1 mL, 200. Mu.L and 10. Mu.L), DNA extraction kits (recommended Qiamp DNA Blood Mini Kit, raney swab/Blood spot extraction Kit).

3. Adapted for instruments

Is suitable for a Real-time PCR amplification instrument with ABI7500 model.

4. Sample requirement

4.1 suitable samples are EDTA anticoagulated whole blood, buccal swab and blood card; the sample is preserved for no more than 7 days at 4-10 ℃ and no more than 1 year at-20 ℃, and repeated freezing and thawing are avoided.

4.2 extraction of human genomic DNA using commercial kits, preferably whole Blood samples using Qiamp DNA Blood Mini Kit (cat # 51104 or 51106) from Qiagen, saliva or swab samples using the swab genomic DNA extraction Kit from Ranui (NSSDE-P-6004) from Ranui, blood card samples using the plaque genomic DNA extraction Kit from Ranui (BSDE-P-5004), concentration and purity of the extracted DNA determined using Nanodrop, DNA OD260/280 between 1.4 and 2.0, concentration greater than 10ng/μ L, sample quality failure not to be detected, re-sampling below 10ng/μ L for nucleic acid extraction, appropriate dilution to a specified concentration range above 100ng/μ L, extracted DNA suggested immediate detection, or storage at-20 ℃ for a storage period not exceeding 6 months.

5. Inspection method

5.1 nucleic acid extraction

Extracting nucleic acid according to different sample types and strict according to the instruction of the corresponding kit. Necessary marking methods are adopted in the extraction process, so that reagent addition omission and sample confusion are avoided.

5.2 reagent preparation

Taking out the reagent from the refrigerator, melting at room temperature, mixing uniformly, and quickly centrifuging at 1000rpm for 20s for later use.

5.3 preparation of reaction System

5.3.1 calculating the required reaction solution according to the number of detection samples, if the number of the detection samples is N, performing N +6 reaction, wherein three positive controls, two blank controls and one calibrator.

5.3.2 calculate the volume of each required reaction solution according to the following table 4, configure the reaction system, mix the reaction system evenly, centrifuge rapidly at 3000rpm for 30 seconds, and dispense into PCR tubes with 19. Mu.L each.

TABLE 3 sample addition Table

Components	Copy number (μ L)
		Reaction solution A	4
Reaction solution I	1
		Water (W)	14
Total volume	19

5.4 sample application

Adding 1 mu L of DNA (10-100 ng is recommended) of a sample to be detected into a PCR reaction tube, covering a tube cover, and centrifuging at 1000rpm to remove bubbles at the bottom of the tube; and (4) carrying a positive control, a blank control and a calibrator by using the kit.

5.5 operating machine detection

5.5.1 opening the fluorescent quantitative PCR instrument, and putting the PCR tube containing the detected sample into the detection bin of the machine. The instrument control software was then turned on.

5.5.2 set up the reaction program according to the prompt.

When the detection machine is operated for the first time, the following operations are performed.

Click "advanced setting" and set the reaction program in the experimental attributes as per table 4 below.

TABLE 4 reaction procedure

Then in the reaction plate setup, click "define genes and samples" and then click "add new genes" button. Then "Gene 1" is renamed to "CYP2D6", reporter group is selected to be "FAM", and quencher group is "None"; the gene 2 is renamed to be RPPH, the reporter group is selected to be VIC, and the quencher group is selected to be None; the "Gene 3" was renamed "TERT", reporter group selected "CY5", quencher group "None".

Then, in the reaction procedure, the reaction system was changed to "20. Mu.L", and the amplification procedure was set up as in Table 5 below.

TABLE 5 amplification procedure

Then clicking the 'save' button, selecting 'save as template' and saving as 'CYP 2D 6-CNV'. The template is then closed.

5.5.3 if the machine used for the detection has completed the above operation, please proceed as follows.

1) Click the "open" button, open the file CYP2D6-cnv.

2) After the file is opened, the name of the sample to be tested is added to the "define gene sample" in the "reaction plate setup". Then click "assign genes and samples", in this panel, according to the actual sample placement position. In the column of "designated gene", a gene corresponding to a sample test item (copy number identification) and a sample are selected and checked, and "none" is selected among reference fluorescent dyes.

3) After all the settings are finished, the file is saved as eds file according to the name of the experiment, and simultaneously, the 'Start' button at the upper right corner is clicked to Start the experiment.

6 analysis of results

6.1 after the reaction program runs, enter the analysis interface, click "analysis settings" in the top right corner, set the threshold to 3000, baseline set "start cycle" to 5, "end cycle" to 18, and then click "apply analysis settings".

6.2 the selection of "pattern" in amplification map is "Delta Rn VS cycle number", "pattern type" is "linear map", the color is "gene" for direct observation, and the menu bar "export" key can be used to save the data as XLS/. TXT file for convenient calculation of copy number variation and SNP typing identification.

7 interpretation of test results

7.1 copy number variation: calculating the difference Ct between Ct values of two reference genes ₀ Judging whether the degradation degree of the sample reaches the inaccurate detection degree; if the Ct is ₀ It can not guaranteeIf the detection result is accurate, prompting to re-sample for DNA extraction; if the Ct is ₀ Within the threshold range ensuring the detection result to be accurate, calculating the difference value of the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes to obtain the Ct ₁ Through the Ct ₁ And judging the variation condition of the CYP2D6 copy number of the sample to be detected.

Example 3 design of primer Probe combination 2

In order to verify that the detection accuracy of CYP2D6 can be improved even if different double internal references are selected, the present example selects internal reference genes different from those in example 1, and designs a primer probe combination 2.

According to the preferred embodiment, a TaqMAN fluorescence quantitative method is adopted for specific amplification of CYP2D6 exon 9 region, double internal reference ALB and beta-globin genes are added as qualified parameters of an evaluation sample, the risk of misjudgment caused by sample quality problems is avoided, and simultaneous detection of 3 target genes (2D6 + ALB + beta-globin) is realized in a single tube. In this example, primers and probes were designed for the human CYP2D6 gene, the ALB reference gene, and the β -globin reference gene, respectively, and the nucleotide sequences thereof are shown in table 6 below, and the preferred use concentrations of the primers and probes are also shown.

TABLE 6 sequences of primer-probe combination 2 designed for human CYP2D6 copy number detection

Example 4A Dual internal reference assay kit 2 for detecting human CYP2D6 copy number variation

The difference between the kit 2 and the kit 1 is only the difference between the primer and the probe sequence, the kit 2 can be obtained by replacing the primer and the probe sequence shown in table 1 with the primer and the probe sequence shown in table 6, and other components and the detection method are basically the same as those in example 2, and thus are not repeated herein.

Case one

One oral swab sample is taken, DNA extraction is carried out immediately after one oral swab sample is taken, and then CYP2D6 CNV detection is carried out by using a CYP2D6 CNV detection reagent (human CYP2D6 gene detection kit) with a single internal reference, wherein the interpretation standard is as follows: when the Ct difference is less than 0CNV, 0. Ltoreq. Ct difference is less than 1.2, 1CNV, 1.2. Ltoreq. Ct difference is less than 3, 2CNV, 3. Ltoreq. Ct difference, and 3CNV. The difference between the Ct value of the internal reference gene CYP2D6 and the Ct value of the CYP2D6 internal reference gene is 3.03 (as shown in figure 1), so that the CYP2D6 is judged to be 3 copies. And the other sample simulates transportation conditions, DNA extraction is carried out after two days, then the same kit is used for CYP2D6 CNV detection, the result is that the difference between the CYP2D6 Ct value and the Ct value of the internal reference gene is 2.92 (shown in figure 2), and the CYP2D6 is judged to be 2 copies according to the judgment standard. The experiment proves that the same person sample appears, and the quantitative detection results of CYP2D6 CNV are inconsistent, so that the problem of wrong conclusion is caused.

The double-internal-reference CYP2D6 CNV detection kit 1 designed in the embodiment 2 of the invention is used for detecting the two DNA samples, and the interpretation standard is as follows: when the Ct difference is < -1, the judgment is that the Ct difference is 0CNV, when the Ct difference is more than or equal to-1 and less than or equal to-0.5, the judgment is that the Ct difference is 1CNV, when the Ct difference is more than or equal to 0.5 and less than or equal to 1.4, the judgment is that the Ct difference is 2CNV, and the judgment is that the Ct difference is more than or equal to 1.4 and less than or equal to 3CNV. The difference between the Ct values of two reference genes (RPPH and TERT) of the sample from which DNA is immediately extracted (the difference obtained by subtracting the CT value of the TERT gene from the CT value of the RPPH gene) is-0.92, the sample meets the interpretation condition and enters the interpretation, the difference between the Ct values of the CYP2D6 and one of the reference genes (namely the difference obtained by subtracting the Ct value of the TERT gene from the Ct value of the CYP2D6 gene) is 3.02, and the CYP2D6 is interpreted to be 3 copies (as shown in figure 3). The difference of Ct values of two reference genes of another DNA sample extracted under the simulated transportation condition is-1.59 (as shown in figure 4), the DNA sample does not meet the interpretation condition, and the sample is re-extracted or re-sampled to extract DNA according to the requirement. Therefore, the condition that the detection result is wrong due to the quality problem of the sample is avoided.

Comparison of kit 1 and kit 2 designed by double internal reference method in case two

Two oral swab samples of prunus salicina were taken and treated the same as in case one: one sample was immediately subjected to DNA extraction, the other sample was subjected to transportation conditions, and two days later, DNA extraction was performed. These two samples were tested using the dual internal control kit 1 designed in example 2 for these two DNAs. The detection result of the first sample shows that the difference between the two internal references (the difference obtained by subtracting the CT value of the TERT gene from the CT value of the RPPH gene) is-0.88, the sample meets the interpretation condition (the allowable interpretation interval is-1.5-0), and the sample enters the interpretation. The difference between the Ct values of the reference gene TERT and CYP2D6 (the difference obtained by subtracting the Ct value of the TERT gene from the Ct value of the CYP2D6 gene) was 1.27, which was judged to be 2CNV according to the standard (as shown in FIG. 5).

The other sample simulates transportation conditions, DNA extraction is carried out after five days, and then the double internal reference kit 1 designed by the inventor is still used for detection. The result shows that the difference between the two internal parameters is 0.58, and the two internal parameters are not in the interpretation-allowed region, so that interpretation cannot be performed, and resampling detection is required (as shown in FIG. 6). In fact, if the dual internal reference is not considered, the sample would be interpreted as 3CNV if it is directly judged by the difference between the Ct values of the reference genes TERT and CYP2D6 (difference between Ct values is 2.72). Therefore, when there is no pre-determination of the dual internal references, the result of the detection is wrong, and the subsequent determination is misled.

In order to further verify that different double internal references can improve the detection accuracy of CYP2D6, the double internal reference detection kit 2 provided in example 4 is further used in the present embodiment to detect the two DNA samples. The difference between the Ct values of two reference genes (the difference between the CT value of the beta-globin gene and the CT value of the ALB gene) of a sample for immediately extracting DNA is 0.58, the sample meets the interpretation condition (the allowable interpretation interval is 0-0.9), the sample enters the interpretation, the difference obtained by subtracting the Ct value of the beta-globin gene from the Ct value of the CYP2D6 gene is 1.19 (the judgment standard of the reagent is that the Ct difference is 0.5, namely the Ct value is judged to be CNV, the Ct difference is more than or equal to 0.5, when the Ct difference is less than 1.0, the reagent is judged to be 1CNV, when the Ct difference is more than or equal to 1.0, the reagent is judged to be 2CNV, the Ct difference is more than or equal to 1.7, the Ct value is judged to be 3 CNV), and the CYP2D6 is judged to be 2 copies (as shown in figure 7).

Another sample, simulating transport conditions, was tested using our designed dual internal reference kit 2. The result shows that the difference between the two internal references is 1.04, and the two internal references are not in the interpretation-allowed region, so that interpretation cannot be performed, and resampling detection is required (as shown in fig. 8). In fact, if the double internal reference is not considered, if the judgment degree is directly according to the difference between the Ct values of the internal reference gene beta-globin and CYP2D6, the sample is judged to be 0CNV (the difference between the Ct values is-0.13). The effect is similar to that of the double-reference kit 1.

The above embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and various changes may be made in the above embodiments of the present invention. All simple and equivalent changes and modifications made according to the claims and the content of the specification of the present application fall within the scope of the claims of the present patent application. The invention has not been described in detail in the conventional technical content.

SEQUENCE LISTING

<110> Shanghai Kangli diagnostic technology Co., ltd

<120> a method for detecting copy number variation of human CYP2D6 gene

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

caccaggaaa gcaaagacac 20

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<400> 2

tgcagcactt cagcttct 18

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

agggtcctcg cctgtgta 18

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

cccagattcg ccattgttca 20

<210> 5

<211> 17

<212> DNA

<213> Artificial sequence

<400> 5

ccgcctctgg ccctagt 17

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

gccacgagct gagtgcgt 18

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

tgggccgggg ctgtccagtg 20

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence

<400> 8

cagggcacac ctttggtcac tcca 24

<210> 9

<211> 26

<212> DNA

<213> Artificial sequence

<400> 9

tgtcactcca ctcccatgtc ccttgg 26

<210> 10

<211> 26

<212> DNA

<213> Artificial sequence

<400> 10

ggagaaggtc actacttgaa gagatt 26

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence

<400> 11

catgagagat taggattcta gtatttgc 28

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

gtggatgaag ttggtggtga g 21

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<400> 13

taacagcatc aggagtggac ag 22

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence

<400> 14

ctatattcct tcccttaatt aactctgttt 30

<210> 15

<211> 33

<212> DNA

<213> Artificial sequence

<400> 15

aaggttacaa gacaggttta aggagaccaa tag 33

Claims

1. A method for detecting human CYP2D6 gene copy number variation for non-disease diagnostic purposes, the method comprising the steps of:

a: selecting two DNA sequences with determined copy number and no copy number variation in the known genome of a sample to be detected as reference genes, and respectively designing corresponding primers and probes aiming at the sequence characteristics of the human CYP2D6 gene and the two selected reference genes;

b: obtaining extracted genome DNA of a sample to be detected;

c: in a reaction system, mixing the primer and the probe, and adding the mixture into a reaction solution;

d: carrying out real-time quantitative fluorescent PCR detection;

e: calculating the difference Ct between Ct values of the two reference genes ₀ Judging whether the degradation degree of the sample reaches the inaccurate detection degree; if the Ct is ₀ If the threshold value which cannot ensure the accuracy of the detection result is reached, resampling is prompted for DNA extraction; if the Ct is ₀ Within the threshold range ensuring the detection result to be accurate, calculating the difference value of the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes to obtain the Ct ₁ Passing the Ct ₁ Judging the variation condition of the CYP2D6 copy number of the sample to be detected;

when the reference gene is the RPPH gene and the TERT gene, step E comprises: calculating the difference value obtained by subtracting the CT value of TERT gene from the CT value of RPPH gene as CT ₀ If-1.5 is less than or equal to CT ₀ The quality of the sample is judged to be qualified when the sample is less than or equal to 0; if CT ₀ If the sample quality is more than 0 or less than-1.5, the sample quality is unqualified; after the sample is qualified, calculating the difference value obtained by subtracting the Ct value of the TERT gene from the Ct value of the CYP2D6 gene as CT ₁ When CT ₁ <A-1 ≦ CT of-1 ≦ CT ₁ <0.5, the number of copies is judged as 1 copy variation, CT is 0.5 or less ₁ <1.4, judging as 2 copies of variation;

the primers and probes designed in step a are as follows:

an upstream primer CYP2D6-F for the human CYP2D6 gene: 5 'CACCAGGAAAAGCAAGACACAC 3';

the downstream primer CYP2D6-R aiming at the human CYP2D6 gene: 5 'TGCAGCACTTCAGCTTCT-doped 3';

an upstream primer TERT-F aiming at a reference gene TERT gene segment: 5' AGGGTCCTCGCCTGTGTA-;

a downstream primer TERT-R aiming at the reference gene human TERT gene segment: 5 'CCCAGATATTCGCCATTGTTCAzone 3';

an upstream primer RPPH-F aiming at the reference gene RPPH gene segment: 5'-CCGCCTCTGGCCCTAGT-3';

a downstream primer RPPH-R aiming at the reference gene RPPH gene segment: 5 'GCCACGAGCTGAGTGCGT-3';

probe CYP2D6-Probe for identifying human CYP2D6 gene mutation: 5'-FAM-TGGGCCGGGGCTGTCCAGTG-BHQ1-3';

and (2) identifying a Probe TERT-Probe with reference gene human TERT gene fragment conserved sequence specificity: 5'-CY5-CAGGGCACACCTTTGGTCACTCCA-BHQ3-3';

a Probe RPPH-Probe for identifying the conserved sequence specificity of the reference gene RPPH gene segment: 5 '-VIC-TGTCACTCCACTCCCATGTCCCCTTGG-BHQ 1-3';

the concentration of each primer used in the step C is 800 to 1000nM, and the concentration of each probe is 200 to 300nM.

2. A method for detecting human CYP2D6 gene copy number variation for non-disease diagnostic purposes, the method comprising the steps of:

a: selecting two DNA sequences with determined copy number and no copy number variation in the known genome of a sample to be detected as internal reference genes, and respectively designing corresponding primers and probes aiming at the sequence characteristics of the human CYP2D6 gene and the two selected internal reference genes;

b: obtaining extracted genome DNA of a sample to be detected;

c: in a reaction system, the primer and the probe are mixed and added into a reaction solution;

d: carrying out real-time quantitative fluorescent PCR detection;

e: calculating the difference Ct between Ct values of the two reference genes ₀ Judging whether the degradation degree of the sample reaches the inaccurate detection degree; if the Ct is ₀ If the threshold value which cannot ensure the accuracy of the detection result is reached, resampling is prompted for DNA extraction; if the Ct is ₀ Within a threshold range for ensuring the accuracy of the detection result, calculating the difference value between the Ct value of the CYP2D6 gene and the Ct value of one of the reference genes to obtain the Ct ₁ Passing the Ct ₁ Judging the variation condition of the CYP2D6 copy number of the sample to be detected;

when the reference gene is beta-globin gene and ALB gene, calculating the difference value obtained by subtracting the CT value of ALB gene from the CT value of beta-globin gene as CT ₀ If 0 is less than or equal to CT ₀ The quality of the sample is judged to be qualified when the sample quality is less than or equal to 0.9; if CT ₀ Greater than 0.9, or less than 0, the sample quality is not goodGrid; after the sample is qualified, the difference value obtained by subtracting the Ct value of the beta-globin gene from the Ct value of the CYP2D6 gene is CT ₁ If CT ₁ <0.5 or less of-CT is judged as 0 copy variation ₁ <1.0, the number of copies is judged as 1 copy variation, 1. Ltoreq. CT ₁ <When 1.7, 2 copies of the mutant were judged;

the primers and probes designed in step a are as follows:

an upstream primer ALB-F aiming at an internal reference gene ALB gene segment: 5 'GGAGAAGGTCACTACTTGAAGAGATT-3';

a downstream primer ALB-R aiming at an internal reference gene ALB gene segment: 5' CATGAGAGATTAGTATTTGC-;

an upstream primer beta-globin-F aiming at a reference gene beta-globin gene fragment: 5 'GTGGATGAAGTTGGTGGTGAG-3';

a downstream primer beta-globin-R aiming at a reference gene beta-globin gene segment: 5 'TAACAGCACTAGGAGGAGTGGACAG-3';

a Probe CYP2D6-Probe for identifying human CYP2D6 mutation: 5'-FAM-TGGGCCGGGGCTGTCCAGTG-BHQ1-3';

a Probe ALB-Probe for identifying the conserved sequence specificity of the internal reference gene ALB gene fragment: 5'-VIC-CTATATTCCTTCCCTTAATTAACTCTGTTT-MGB-3';

a Probe beta-globin-Probe for identifying the conserved sequence specificity of the reference gene human beta-globin gene fragment: 5'-CY 5-aaggttacaagagaggtttaaggagagagagaccaatag-BHQ 1-3';