CN113174423B - Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian - Google Patents

Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian Download PDF

Info

Publication number
CN113174423B
CN113174423B CN202110263303.2A CN202110263303A CN113174423B CN 113174423 B CN113174423 B CN 113174423B CN 202110263303 A CN202110263303 A CN 202110263303A CN 113174423 B CN113174423 B CN 113174423B
Authority
CN
China
Prior art keywords
luciferase
strain
disease
pathogenic bacteria
phytophthora
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110263303.2A
Other languages
Chinese (zh)
Other versions
CN113174423A (en
Inventor
董莎萌
陈汉
李鸷
黄杰
王源超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202110263303.2A priority Critical patent/CN113174423B/en
Publication of CN113174423A publication Critical patent/CN113174423A/en
Application granted granted Critical
Publication of CN113174423B publication Critical patent/CN113174423B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/66—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving luciferase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/37—Assays involving biological materials from specific organisms or of a specific nature from fungi

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention aims to provide a preparation method of phytophthora capsici luciferase labeling strain and application thereof in prevention and control of phytophthora capsici, wherein pathogenic bacteria expressing luciferase are prepared, zoospores, hyphae, oospores or bacterial cakes of the pathogenic bacteria are used for inoculating plants, luciferase substrates are added after infection for a certain time, and the length or area of a lesion is counted; the length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance or different types of potential disease-resistant resources on pathogenic bacteria. The method has the characteristics of rapid, simple, convenient, quantitative and high-throughput detection of epidemic disease bacteria disease course, is suitable for accurately evaluating the effects of various epidemic disease prevention and control methods, is suitable for plant pathogenic bacteria, and can be widely applied to the field of screening of disease-resistant resources.

Description

Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian
Technical Field
The invention belongs to the technical field of biology, and relates to pathogenic bacteria for marking luciferase, a preparation method thereof and application of a marking strain in crop resistance screening and epidemic disease prevention and control effect evaluation of pesticides and microorganisms.
Background
Pathogenic bacteria can cause harm on animals and plants, and part of pathogenic bacteria seriously threatens human health, grain safety and ecological environment. Taking plant pathogenic bacteria as an example, diseases are factors restricting the quality and the high yield of crops. The prevalence of some serious plant diseases can directly lead to grain yield loss or even affect population numbers. The current statistics show that plant pathogenic bacteria and pests can reduce the yield of five main crops by 10% -30%, and about 10% of the world population still suffers from the threat of grain safety. Therefore, effective control of crop diseases is a highly desirable problem.
The main means for resisting pathogenic bacteria in the current agricultural production comprise the selection of crops containing disease-resistant genes and the application of chemical pesticides. The improvement of the resistance of crops to pathogenic bacteria through disease-resistant breeding is an important strategy for implementing green prevention and control of diseases. The natural plant population accumulates a large number of genetic mutations in the selection process of long-term natural evolution and manual intervention, and the genetic mutations are valuable resources in disease-resistant breeding. In addition, the pesticide has an irreplaceable effect on human agricultural production, and reasonable use of the pesticide is an important means for improving and ensuring grain yield per unit. More and more newly discovered natural active substances, massive new synthetic compounds and a large number of environmental microorganisms existing in nature are all potential pesticide resources.
Disease resistant varieties and chemical pesticides are easily overcome due to rapid variation of pathogenic bacteria in the field and some improper agronomic operations. Therefore, the evaluation and screening of new disease-resistant resources and effective pesticide resources are key to improving crop disease resistance and controlling diseases. In view of this current situation, the establishment of a sensitive and rapid in vitro and in vivo high-throughput screening method is still an important topic in scientific research and agricultural production.
The disease-resistant resource screening needs to take the infection state or classification of pathogenic bacteria as a measurement standard, and a scientific, visual, rapid and sensitive method plays an important role in the disease-resistant resource screening. The invention provides a disease-resistant resource screening thought taking pathogenic bacteria marked with luciferase as a reporting system, and the disease-resistant resource screening thought takes PsLuc (preserved in China general microbiological preservation center (Phytophthora sojae) in 11 months in 2020, with a classification name of Phytophthora sojae (CGMCC No. 21049) and PcLuc (preserved in China general microbiological preservation center (Phytophthora capsici) in 11 months in 2020, with a classification name of Phytophthora capsici (21048)) as examples for displaying a using method.
The invention provides scientific standard for disease resistance resource evaluation and screening, can screen resources including but not limited to plant disease resistance genes, chemical pesticides, biological pesticides and the like, and can effectively serve disease control.
Disclosure of Invention
The invention aims to provide application of a luciferase-marked pathogenic bacterium as a reporting system in screening disease-resistant resources or crop resistance, and provides a new idea of using the luciferase-marked pathogenic bacterium in screening disease-resistant resources.
Another object of the present invention is to provide a method for screening disease-resistant resources or crop resistance using luciferase-labeled pathogenic bacteria as a reporter system.
It is a further object of the present invention to provide a transformation vector for over-expressing luciferase and a luciferase-tagged pathogen.
The aim of the invention can be achieved by the following technical scheme:
the application of luciferase marked pathogenic bacteria as a reporting system in screening disease-resistant resources or crop resistance.
The application of the method comprises the steps of preparing pathogenic bacteria expressing luciferase, inoculating plants with zoospores, hyphae, oospores or bacterial cakes of the pathogenic bacteria marked by the luciferase, adding a luciferase substrate after infection for a certain time, and counting the length or area of a disease spot; the length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance or different types of potential disease-resistant resources on pathogenic bacteria.
The disease-resistant resource is a disease-resistant gene or microorganism strain with biological control potential, chemical pesticide or biological pesticide.
The pathogenic bacteria are plant pathogenic bacteria. The plant pathogenic bacteria are phytophthora, but are not limited to the phytophthora.
A method for screening disease-resistant resources or crop resistance by taking luciferase-marked pathogenic bacteria as a reporting system comprises the steps of preparing pathogenic bacteria for expressing luciferase, inoculating plants with zoospores, hyphae, oospores or bacterial cakes of the luciferase-marked pathogenic bacteria, adding a luciferase substrate after infection for a certain time, and counting the length or area of a disease spot; the length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance or different types of potential disease-resistant resources on pathogenic bacteria.
A transformation vector for over-expressing a luciferase, for transient or stable transformation of a pathogenic bacterium, comprising a gene sequence encoding a luciferase or a codon optimized gene sequence of a luciferase. The invention provides sequence information (SEQ ID NO. 1) for synthesizing luciferase gene.
The preparation method of the transformation vector comprises the following steps: amplifying a target fragment by using a luciferase gene shown as SEQ ID NO.1 as a template and using primers shown as SEQ ID NO.2 and SEQ ID NO. 3; the target fragment is connected to a phytophthora expression vector by a fragment recombination method, positive clones are screened by using SEQ ID NO.4 and SEQ ID NO.5, and positive cloning plasmids are extracted to be used as a transformation vector pTOR for over-expressing luciferase, wherein Luc-flag is transformed by phytophthora.
Transferring the transformation vector for over-expressing luciferase into pathogenic bacteria, and screening to obtain luciferase-labeled pathogenic bacteria strain. The pathogenic bacteria may be phytophthora sojae or phytophthora capsici, but is not limited thereto.
The positive cloning plasmid is transferred into phytophthora sojae through a method of protoplast transformation to obtain a stable transformed phytophthora sojae strain PsLuc.
The positive cloning plasmid is transferred into phytophthora capsici by adopting a protoplast transformation method through luciferase labeling phytophthora capsici obtained by using a phytophthora capsici transformation vector, so as to obtain a stable transformed phytophthora capsici strain PcLuc.
The detailed method is that a conversion vector pTOR for over-expressing luciferase is converted into a phytophthora sojae strain Ps19-5 or phytophthora capsici Pc50 by using a PEG-mediated protoplast conversion method by taking the phytophthora sojae wild strain Ps19-5 or phytophthora capsici Pc50 as a transformant, and finally the luciferase-marked phytophthora sojae strain PsLuc and phytophthora capsici strain PcLuc are obtained. The phytophthora sojae strain PsLuc is named as phytophthora sojae (Phytophthora sojae) and is preserved in China general microbiological deposit management center (China) at 11/2020 with a preservation number of: CGMCC No.21049, the PcLuc strain is classified and named as phytophthora capsici (Phytophthora capsici), and is preserved in China general microbiological preservation center (China center for type culture Collection) at 11/2020 with the preservation number: CGMCC No.21048. Preservation address: no.1 and No.3 of the north cinquefoil of the morning sun area of beijing city.
The vector and the pathogenic bacteria transformed by the vector are applied to the fields of animal and plant pathogenic bacteria disease resistance resource screening and scientific research. The invention obtains a method for screening disease-resistant resources or crop resistance by taking luciferase-marked pathogenic bacteria as a reporting system, wherein the method is to utilize zoospores, hyphae, oospores or bacterial cakes of phytophthora sojae or phytophthora capsici marked by luciferase to infect plants; such hosts include, but are not limited to, those reported for soybean, capsicum, tomato, cucumber, eggplant, etc., and other hosts that allow PsLuc or PcLuc to form infectious hyphae; the disease-resistant resource and the function thereof comprise: 1) Quantitatively evaluating the control effect of biological pesticides or microorganism strains with biological control potential on plant epidemic diseases; 2) Quantitatively evaluating the prevention and treatment effect of the chemical agent and the compound product and the active precursor on the plant epidemic disease; 3) The crop cultivars, wild-type or transgenic plant material were quantitatively assessed for resistance to phytophthora.
Luciferin, a substrate of luciferase, is screened for phytophthora transformants obtained by phytophthora transformation to obtain a soybean phytophthora strain expressing the luciferase. The phytophthora zoospore, hypha, oospore or bacterial cake is used for inoculating plants, luciferase substrate is added after infection for a certain time, and the length or area of the lesion is counted by photographing. The length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance and different types of potential pesticide resources on phytophthora. The method provided by the invention can intuitively display the growth position of pathogenic bacteria and the biomass of hyphae by a luciferase tracing method, and can intuitively and scientifically measure the disease resistance effect of different disease resistance resources on soybean root rot.
The phytophthora capsici luciferase marked strain is applied to crop resistance screening and epidemic disease control effect evaluation of pesticides and microorganisms. The method comprises the steps of using a phytophthora expression vector (pTOR:: luc-flag) containing codon-optimized luciferase to pass through CaCl 2 PEG-mediated stable genetic transformation System A stable transformation strain of Phytophthora sojae (PsLuc) and a stable transformation strain of Phytophthora capsici (PcLuc) were obtained by introducing pTOR::: luc-flag. The method definitely sprays luciferin to PsLuc strains, pcLuc strains, soybean samples infected by PsLuc strains or samples infected by PcLuc strains of different hosts, and can rapidly and sensitively detect the released bioluminescence through a fluorometer. The method has the characteristics of rapid, simple, convenient, quantitative and high-throughput detection of the epidemic disease bacterial pathogenesis, is suitable for accurately evaluating the effects of various epidemic disease prevention and control methods, is suitable for plant pathogenic bacteria, and can be widely applied to the field of screening of disease-resistant resources.
The invention has the beneficial effects that:
the invention can intuitively, rapidly and sensitively compare the biomass, can measure the length and the area of the lesion, and has simple and convenient operation, time saving and labor saving. Meanwhile, the invention can effectively serve for disease control.
Drawings
FIG. 1 verification of recombinant plasmid pTOR::: luc-flag and vector map thereof
Wherein, the recombinant plasmid pTOR is amplified by the PCR of Luc-flag, wherein M is Takara DL5000 marker (3590Q), 1 is clear water contrast, 2-6 is recombinant plasmid, 8 is pTOR-Avh241 plasmid contrast; recombinant plasmid pTOR:: luc-flag vector map.
FIG. 2 selection of Phytophthora sojae transformants expressing the flag tag by WB
Wherein M is Beyotime color pre-dyeing protein molecular weight standard (P0068), 1-7 are different transformants, and 2 is PsLuc.
FIG. 3 screening of transformants expressing luciferase by the luciferase luminescence principle
Wherein, A, white light shoots the growth state of PsLuc in a V8 culture medium; b, shooting a PsLuc luminous state by using luminous imaging after spraying Luciferin, and combining with the A graph, wherein the color is later-period homogenization; c, shooting the growth state of PcLuc in a V8 culture medium by white light; and D, shooting a PcLuc luminous state by using luminous imaging after spraying Luciferin, and combining with the graph C, wherein the color is post-homogenization.
FIG. 4 infection status of PsLuc and PcLuc respectively infecting their hosts
Wherein, A, psLuc zoospores infect soybean seedling hypocotyl for 2 days; b, the PcLuc zoospores infest the tomato leaves for 1 day; C-D, the PcLuc bacterial cakes with the diameter of 6mm respectively infect the capsicum and the Nicotiana benthamiana (TRV 2: GUS) for 2 days; E-H, 6mm diameter PcLuc cakes respectively infest the states of cucumber, tomato, pepper and eggplant for 2 days. Each of panels a-H performs white light and fluorescence overlap in the manner of fig. 3.
Fig. 5 bacillus OKB105 can inhibit phytophthora sojae infection.
Fig. 6. Soybean cultivar PI103091 has strong disease resistance to phytophthora sojae compared to soybean cultivar he feng 47.
Fig. 7 shows a stronger disease resistance against phytophthora capsici compared to tomato variety Moneymaker, and tomato variety Heinz.
FIG. 8. Azoxystrobin may inhibit phytophthora sojae infection of soybean seedling hypocotyls.
Fig. 9. Azoxystrobin may inhibit phytophthora capsici from infecting tomato leaves.
Detailed Description
The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods used in the following examples are conventional, unless otherwise specified. The test materials and the like used in the following examples are commercially available from conventional biochemical reagent companies unless otherwise specified. The gene synthesis, primer synthesis and sequencing involved in this experiment were performed by Shanghai.
Abbreviations used in the present invention:
v8 medium: 100mL of V8 vegetable juice plus 1g CaCO 3 Stirring to CaCO 3 Centrifuging at 1500rpm for 10min after dissolution; adding 9 times of volume of ultrapure water into the supernatant, and adding 1.5% CaCO into the solid culture medium 3 Sterilizing for standby;
LB medium: 5g of Tryptone (Tryptone) 10g,Yeast Extract (yeast extract), 10g of NaCl (sodium chloride) and fixing the volume to 1L;
Lysis buffer：1％(g/100ml)SDS,10mM Tris-Cl,1mM EDTA。
pTOR-Avh241 vector is stored by molecular laboratory of oomycete and fungus at Nanjing university, and is described in Chen Han, research on the regulatory mechanism and biological function of six-position methylation (6 mA) of phytophthora genomic DNA, in 2019, nanjing university, doctor's academy of science paper, the public is available from Nanjing university of agriculture.
The phytophthora sojae P19-5 strain is a conventional strain collected in a laboratory and stored by a molecular laboratory of oomycetes and fungi at the university of Nanjing, and is publicly available from the university of Nanjing.
The Pc50 strain of phytophthora capsici is a routine strain collected in a laboratory, and is preserved by an oomycete and fungus molecular laboratory of Nanjing university, and is available to the public from Nanjing university.
Soybean Hefeng 47 and PI103091, tomato Heinz and Moneymaker are all varieties known in the art.
Example 1: pTOR:: luc-flag vector construction
The luciferase (luciferase) gene (SEQ ID NO. 1) and primers (SEQ ID NO. 2-3) required for PCR amplification were synthesized. The synthesized luciferase gene is used as a template, and primers SEQ ID NO.2 and SEQ ID NO.3 are used for PCR amplification. The PCR reaction procedure was set as follows: the amplification product was recovered by pre-denaturing at 94℃for 4min, denaturing at 94℃for 30s, annealing at 58℃for 30s, extending at 72℃for 90s, cycling for 32 times, and extending at 72℃for 10 min.
pTOR-luc-FLAG-F:
CGGGCCCCCCCTCGAGGTCGACGGTATATGGAGGACGCCAAGAACATC(SEQ ID NO.2)
pTOR-luc-FLAG-R:
GTAGGCACCCCGCGGTCTAGTCACTTGTCATCGTCATCCTTGTAATCCACCGCGATC TTGCCGCCCT(SEQ ID NO.3)
The pTOR-Avh241 vector was digested simultaneously with ClaI and XbaI to recover a >5000bp fragment. The PCR amplified product was ligated to pTOR-Avh241 using Nanjinouzan Biotechnology Co.Ltd ClonExpress MultiS One Step Cloning Kit (C113-01) to give pTOR:: luc-flag plasmid. After the ligation product was transformed into competent cells of E.coli JM109 strain, a positive strain was identified by PCR using primers of SEQ ID NO.4 and SEQ ID NO. 5. Positive clones were extracted by pTOR of Luc-flag plasmid was sent to Nanjing Jinsri Biotechnology Co., ltd. For sequencing (FIG. 1A), the sequencing primers were SEQ ID NO.4 and SEQ ID NO.5, the sequencing result was SEQ ID NO.6, and the constructed vector map was shown in FIG. 1B, according to the procedure of Takara company plasmid extraction kit (code. No. 9760).
pTOR-00F:
AGGCTCATTCTCCTTTTCACTC(SEQ ID NO.4)
pTOR-00R:
GGCCTTCTTTTGAAAACAATCG(SEQ ID NO.5)
Example 2: preparation and screening of luciferase-expressing phytophthora sojae
The preparation of the soybean phytophthora strain expressing luciferase is carried out by taking soybean phytophthora P19-5 as a receptor strain and utilizing the constructed pTOR::: luc-flag vector according to the reported PEG-mediated genetic transformation of soybean phytophthora protoplast. Single colonies which still grow after covering are picked up, 8 pieces of 4mm x 4mm mycelium blocks are cut by a scalpel, and after three days of culture by using a liquid V8 culture medium, total proteins are extracted by using a lysis buffer. The positive transformants were screened by western blot detection using Abmark company Tag Tag-DYKDDDK-Tag (3B 9) Mouse anti-body by SDS-PAGE gel, and the predicted protein size was 61.6KD, and the results showed that the 7 transformants screened here were positive (FIG. 2).
After transferring the western blot screening positive transformants to a new G418-resistant V8 plate for 3 days, luciferin (catenulate No.7903; biovision, USA), a substrate for luciferase with a final concentration of 1mM, was sprayed, and screening was performed using Tanon 5200Multi and Tanon biological image capturing software (luminescence imaging program), with an exposure time of 60s. The imaging results were color-homogenized using the tannomage software (fig. 3). In combination with the result of the western blot and luciferase reaction, transformant No.2 was selected for subsequent experiments, designated herein as PsLuc.
And constructing the phytophthora capsici which is marked by luciferase by using Pc50 of the phytophthora capsici as a receptor strain and screening out a phytophthora capsici strain PcLuc marked by the luciferase by adopting the same method.
The phytophthora sojae strain PsLuc is preserved in China general microbiological deposit management center (China) at 11-2020, and the preservation number is: CGMCC No.21049, wherein the phytophthora capsici strain PcLuc is preserved in China general microbiological preservation center (China center for type culture Collection) at 11/2020, and the preservation number is: CGMCC No.21048.
Example 3: application example of quantitative evaluation of phytophthora infestans Using PsLuc and PcLuc
Shading and planting soybean cultivated species Hefeng 47 yellowing seedlings, and placing the seedlings in a 16L/8D greenhouse for 4-5 days at 25 ℃; inducing PsLuc zoospores, quantitatively counting, and inoculating 100 zoospores to hypocotyls of Hefeng 47 yellowing seedlings; placing the infected sample at 25 ℃ and under dark conditions, carrying out moisture preservation and culture for 48 hours, and then sampling; the samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIG. 4A).
Collecting in-vitro tomato leaves; inducing PcLuc zoospores, quantitatively counting, and inoculating 100 zoospores to the leaf backs of tomatoes; placing the infected sample at 25 ℃ and under dark conditions, carrying out moisture preservation and culture for 24 hours, and then sampling; the samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIG. 4B).
Collecting in vitro leaves of Capsici fructus and tobacco (TRV 2: GUS); beating fungus cakes on the edge of the culture medium by using a 6mm puncher, and inoculating the fungus cakes on the leaf backs; placing the infected sample at 25 ℃ and under dark conditions, carrying out moisture preservation and culture for 48 hours, and then sampling; the samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIGS. 4C-D).
Collecting cucumber, tomato, capsicum and eggplant; beating fungus cakes on the edge of the culture medium by using a 6mm puncher, and inoculating the fungus cakes on the fruit epidermis; placing the infected sample at 25 ℃ and under dark conditions, carrying out moisture preservation and culture for 48 hours, and then sampling; the samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIGS. 4E-H).
Example 4: taking the reported bacillus OKB105 as an example, the effect of PsLuc on screening biocontrol strains is demonstrated
Shading and planting soybean cultivated species Hefeng 47 yellowing seedlings, and placing the seedlings in a 16L/8D greenhouse for 4-5 days at 25 ℃; activated OKB was inoculated in vitro with LB medium at 37℃and 220rpm overnight. Two groups of treatments are needed when soybean is planted, 1) OKB105 is applied, about 5ml of bacteria liquid is irrigated to the root when soybean is planted, and about 5ml of bacteria liquid is irrigated to the root at night before inoculation; 2) The same volume of root-drenching LB medium was used for the same time as in treatment 1).
Cutting PsLuc mycelium blocks with the size of 4mm x 4mm in a V8 culture medium, and culturing in dark at 25 ℃ for 3-5 days; beating the fungus cake at the edge of the culture medium by using a 6mm puncher, and inoculating the fungus cake to the hypocotyl of the yellowing seedling; the infected sample was subjected to moisture culture at 25℃in the dark for 48 hours and then sampled. The samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized with an exposure time of 120s (FIG. 5).
Example 5: taking soybean Hefeng 47 and PI103091, and tomato Heinz and Moneymaker as examples, respectively, it is proved that PsLuc and PsLuc have the function of quantitatively evaluating the disease resistance of different varieties to Phytophthora
Shading and planting soybean cultivated species Hefeng 47 and PI103091 yellowing seedlings, and placing the seedlings in a 16L/8D greenhouse at 25 ℃ for 4-5 days; cutting PsLuc mycelium blocks with the size of 4mm x 4mm in a V8 culture medium, and culturing in dark at 25 ℃ for 3-5 days; beating the fungus cake at the edge of the culture medium by using a 6mm puncher, and inoculating the fungus cake to the hypocotyl of the yellowing seedling; the infected sample was subjected to moisture culture at 25℃in the dark for 48 hours and then sampled. The samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized with an exposure time of 120s (FIG. 6).
Planting tomatoes Heinz and Moneymaker, and culturing in a 16L/8D greenhouse at 25 ℃ for about 30 days; cutting 4mm×4mm PcLuc mycelium blocks in V8 culture medium, and culturing at 25deg.C in dark for 3-5 days; beating the bacterial cake at the edge of the culture medium by using a 6mm puncher, and inoculating the bacterial cake to the back of the isolated blade; the infected sample was subjected to moisture culture at 25℃in the dark for 48 hours and then sampled. The samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIG. 7).
Example 6: taking azoxystrobin as an example, the PsLuc and PcLuc are proved to have the functions of evaluating and screening chemical agents, compound products and active precursors for preventing and treating plant epidemic diseases
Shading and planting soybean cultivated species Hefeng 47 yellowing seedlings, and placing the seedlings in a 16L/8D greenhouse for 4-5 days at 25 ℃; taking out the yellowing seedlings, spraying azoxystrobin with the final concentration of 40 mug/ml, and carrying out moisture preservation and culture for two days at 25 ℃ under the dark condition by using 0.1% DMSO as a control; cutting PsLuc mycelium blocks with the size of 4mm x 4mm in a V8 culture medium, and culturing in dark at 25 ℃ for 3-5 days; beating the fungus cake at the edge of the culture medium by using a 6mm puncher, and inoculating the fungus cake to the hypocotyl of the yellowing seedling; the infected sample was subjected to moisture culture at 25℃in the dark for 48 hours and then sampled. The samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIG. 8).
Planting tomatoes Heinz, and culturing in a 16L/8D greenhouse at 25 ℃ for about 30 days; taking out the isolated leaf blades, spraying azoxystrobin with the final concentration of 40 mug/ml, and carrying out moisturizing culture for two days at 25 ℃ and 16L/8D under the condition of 0.1% DMSO as a control; cutting PsLuc mycelium blocks with the size of 4mm x 4mm in a V8 culture medium, and culturing in dark at 25 ℃ for 3-5 days; beating the bacterial cake at the edge of the culture medium by using a 6mm puncher, and inoculating the bacterial cake to the leaf backs; the infected sample was subjected to a moisture-retaining culture at 25℃and 16L/8D for 4 days, and then sampled. The samples were sprayed with Luciferin at a final concentration of 1mM, photographed using Tanon 5200Multi and Tanon biological image photographing software and color homogenized (FIG. 9).
The foregoing has been a general description and several specific implementations of the invention, but is not intended to limit the invention. Accordingly, modifications or improvements may be made without departing from the scope of the invention as claimed.
Sequence listing
SEQ ID NO.1 (artificially synthesized luciferase gene sequence)
ATGGAGGACGCCAAGAACATCAAGAAGGGCCCGGCCCCGTTCTACCCGCTGGAGGACGGCACG GCCGGCGAGCAGCTGCACAAGGCCATGAAGCGCTACGCCCTCGTCCCCGGCACGATCGCGTTCA CGGACGCCCACATCGAGGTGGACATCACGTACGCCGAGTACTTCGAGATGTCGGTGCGTCTGGCGGAGGCGATGAAGCGCTACGGCCTGAACACGAACCACCGCATCGTGGTGTGTTCGGAGAACTC CCTCCAGTTCTTCATGCCGGTGCTGGGCGCCCTGTTCATCGGCGTCGCCGTCGCCCCCGCCAACGACATCTACAACGAGCGCGAGCTCCTGAACTCGATGGGCATCTCCCAGCCGACGGTGGTGTTTGT CTCGAAGAAGGGCCTGCAGAAGATCCTGAACGTGCAGAAGAAGCTCCCCATCATCCAGAAGATC ATCATCATGGACAGCAAGACCGACTACCAGGGCTTCCAGTCCATGTACACGTTCGTGACGAGCCACCTGCCGCCGGGCTTCAACGAGTACGACTTCGTCCCGGAGTCGTTCGACCGCGACAAGACGAT CGCCCTGATCATGAACTCCTCGGGCTCGACGGGCCTGCCGAAGGGCGTGGCGCTCCCCCACCGGACGGCCTGCGTGCGATTCTCGCACGCCCGTGACCCCATCTTCGGCAACCAGATCATCCCCGACAC GGCCATCCTCTCGGTGGTCCCGTTCCACCACGGCTTCGGCATGTTCACCACCCTGGGCTACCTGATCTGCGGCTTCCGCGTGGTCCTCATGTACCGCTTCGAAGAGGAGCTGTTCCTCCGCAGCCTGCAG GACTACAAGATCCAGTCGGCGCTCCTCGTGCCGACGCTCTTCTCGTTCTTCGCGAAGAGCACGCTGATCGACAAGTACGACCTGAGCAACCTCCACGAGATCGCCAGCGGCGGCGCGCCGCTGTCTAA GGAAGTGGGCGAGGCGGTGGCCAAGCGCTTCCACCTGCCGGGCATCCGCCAGGGCTACGGCCTCACGGAGACCACCTCGGCCATCCTGATCACGCCCGAGGGCGACGACAAGCCGGGCGCCGTGGG CAAGGTGGTCCCGTTCTTCGAGGCCAAGGTCGTGGACCTGGACACGGGTAAGACCCTGGGCGTGAACCAGCGCGGCGAGCTCTGCGTGCGTGGCCCCATGATCATGAGCGGCTACGTGAACAACCCG GAGGCCACCAACGCCCTGATCGACAAGGACGGCTGGCTGCACTCGGGCGACATCGCCTACTGGGACGAGGACGAGCATTTCTTTATCGTGGACCGTCTGAAGTCGCTGATCAAGTACAAGGGCTACC AGGTGGCGCCGGCCGAGCTGGAGTCGATCCTGCTCCAGCACCCGAACATCTTCGACGCTGGCGTCGCGGGCCTCCCCGACGACGACGCCGGCGAGCTGCCGGCCGCCGTGGTGGTGCTGGAGCACGG CAAGACGATGACCGAGAAGGAGATCGTCGACTACGTGGCCTCGCAGGTCACGACCGCGAAGAAGCTGCGCGGCGGCGTGGTGTTCGTGGACGAGGTCCCGAAGGGCCTGACGGGCAAGCTGGACGCCCGGAAGATCCGCGAGATCCTGATCAAGGCCAAGAAGGGCGGCAAGATCGCGGTG
SEQ ID NO.2 (artificially synthesized primer sequence)
CGGGCCCCCCCTCGAGGTCGACGGTATATGGAGGACGCCAAGAACATC
SEQ ID NO.3 (artificially synthesized primer sequence)
GTAGGCACCCCGCGGTCTAGTCACTTGTCATCGTCATCCTTGTAATCCACCGCGATCTTGCCGCCC T
SEQ ID NO.4 (artificially synthesized primer sequence)
AGGCTCATTCTCCTTTTCACTC
SEQ ID NO.5 (artificially synthesized primer sequence)
GGCCTTCTTTTGAAAACAATCG
SEQ ID NO.6 (pTOR:: luc-flag vector sequencing results)
TGCCCAAGTCCCAACCGACTCTTTTTCGACCTTCACTCTCACCGACAACGGGCCCCCCCTCGAG GTCGACGGTATCGATATGGAGGACGCCAAGAACATCAAGAAGGGCCCGGCCCCGTTCTACCCGC TGGAGGACGGCACGGCCGGCGAGCAGCTGCACAAGGCCATGAAGCGCTACGCCCTCGTCCCCGGCACGATCGCGTTCACGGACGCCCACATCGAGGTGGACATCACGTACGCCGAGTACTTCGAGAT GTCGGTGCGTCTGGCGGAGGCGATGAAGCGCTACGGCCTGAACACGAACCACCGCATCGTGGT GTGTTCGGAGAACTCCCTCCAGTTCTTCATGCCGGTGCTGGGCGCCCTGTTCATCGGCGTCGCCGTCGCCCCCGCCAACGACATCTACAACGAGCGCGAGCTCCTGAACTCGATGGGCATCTCCCAGCC GACGGTGGTGTTTGTCTCGAAGAAGGGCCTGCAGAAGATCCTGAACGTGCAGAAGAAGCTCCCCATCATCCAGAAGATCATCATCATGGACAGCAAGACCGACTACCAGGGCTTCCAGTCCATGTACA CGTTCGTGACGAGCCACCTGCCGCCGGGCTTCAACGAGTACGACTTCGTCCCGGAGTCGTTCGACCGCGACAAGACGATCGCCCTGATCATGAACTCCTCGGGCTCGACGGGCCTGCCGAAGGGCGTG GCGCTCCCCCACCGGACGGCCTGCGTGCGATTCTCGCACGCCCGTGACCCCATCTTCGGCAACCAGATCATCCCCGACACGGCCATCCTCTCGGTGGTCCCGTTCCACCACGGCTTCGGCATGTTCACC ACCCTGGGCTACCTGATCTGCGGCTTCCGCGTGGTCCTCATGTACCGCTTCGAAGAGGAGCTGTTCCTCCGCAGCCTGCAGGACTACAAGATCCAGTCGGCGCTCCTCGTGCCGACGCTCTTCTCGTTCT TCGCGAAGAGCACGCTGATCGACAAGTACGACCTGAGCAACCTCCACGAGATCGCCAGCGGCGGCGCGCCGCTGTCTAAGGAAGTGGGCGAGGCGGTGGCCAAGCGCTTCCACCTGCCGGGCATCC GCCAGGGCTACGGCCTCACGGAGACCACCTCGGCCATCCTGATCACGCCCGAGGGCGACGACAAGCCGGGCGCCGTGGGCAAGGTGGTCCCGTTCTTCGAGGCCAAGGTCGTGGACCTGGACACGG GTAAGACCCTGGGCGTGAACCAGCGCGGCGAGCTCTGCGTGCGTGGCCCCATGATCATGAGCGGCTACGTGAACAACCCGGAGGCCACCAACGCCCTGATCGACAAGGACGGCTGGCTGCACTCGGG CGACATCGCCTACTGGGACGAGGACGAGCATTTCTTTATCGTGGACCGTCTGAAGTCGCTGATCAAGTACAAGGGCTACCAGGTGGCGCCGGCCGAGCTGGAGTCGATCCTGCTCCAGCACCCGAACAT CTTCGACGCTGGCGTCGCGGGCCTCCCCGACGACGACGCCGGCGAGCTGCCGGCCGCCGTGGTGGTGCTGGAGCACGGCAAGACGATGACCGAGAAGGAGATCGTCGACTACGTGGCCTCGCAGGT CACGACCGCGAAGAAGCTGCGCGGCGGCGTGGTGTTCGTGGACGAGGTCCCGAAGGGCCTGACGGGCAAGCTGGACGCCCGGAAGATCCGCGAGATCCTGATCAAGGCCAAGAAGGGCGGCAAGAT CGCGGTGGATTACAAGGATGACGATGACAAGTGACTAGACCGCGGGGTGCCTACTTCTTGTAAGCCGAAGGTCGAGCTGTGTGCACTGAGTGCGAAGTTGCAGATTTTGTGTCT
Sequence listing
<110> Nanjing agricultural university
<120> preparation method of phytophthora capsici fluorescent enzyme marked strain and application thereof in prevention and control of phytophthora capsici
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1650
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atggaggacg ccaagaacat caagaagggc ccggccccgt tctacccgct ggaggacggc 60
acggccggcg agcagctgca caaggccatg aagcgctacg ccctcgtccc cggcacgatc 120
gcgttcacgg acgcccacat cgaggtggac atcacgtacg ccgagtactt cgagatgtcg 180
gtgcgtctgg cggaggcgat gaagcgctac ggcctgaaca cgaaccaccg catcgtggtg 240
tgttcggaga actccctcca gttcttcatg ccggtgctgg gcgccctgtt catcggcgtc 300
gccgtcgccc ccgccaacga catctacaac gagcgcgagc tcctgaactc gatgggcatc 360
tcccagccga cggtggtgtt tgtctcgaag aagggcctgc agaagatcct gaacgtgcag 420
aagaagctcc ccatcatcca gaagatcatc atcatggaca gcaagaccga ctaccagggc 480
ttccagtcca tgtacacgtt cgtgacgagc cacctgccgc cgggcttcaa cgagtacgac 540
ttcgtcccgg agtcgttcga ccgcgacaag acgatcgccc tgatcatgaa ctcctcgggc 600
tcgacgggcc tgccgaaggg cgtggcgctc ccccaccgga cggcctgcgt gcgattctcg 660
cacgcccgtg accccatctt cggcaaccag atcatccccg acacggccat cctctcggtg 720
gtcccgttcc accacggctt cggcatgttc accaccctgg gctacctgat ctgcggcttc 780
cgcgtggtcc tcatgtaccg cttcgaagag gagctgttcc tccgcagcct gcaggactac 840
aagatccagt cggcgctcct cgtgccgacg ctcttctcgt tcttcgcgaa gagcacgctg 900
atcgacaagt acgacctgag caacctccac gagatcgcca gcggcggcgc gccgctgtct 960
aaggaagtgg gcgaggcggt ggccaagcgc ttccacctgc cgggcatccg ccagggctac 1020
ggcctcacgg agaccacctc ggccatcctg atcacgcccg agggcgacga caagccgggc 1080
gccgtgggca aggtggtccc gttcttcgag gccaaggtcg tggacctgga cacgggtaag 1140
accctgggcg tgaaccagcg cggcgagctc tgcgtgcgtg gccccatgat catgagcggc 1200
tacgtgaaca acccggaggc caccaacgcc ctgatcgaca aggacggctg gctgcactcg 1260
ggcgacatcg cctactggga cgaggacgag catttcttta tcgtggaccg tctgaagtcg 1320
ctgatcaagt acaagggcta ccaggtggcg ccggccgagc tggagtcgat cctgctccag 1380
cacccgaaca tcttcgacgc tggcgtcgcg ggcctccccg acgacgacgc cggcgagctg 1440
ccggccgccg tggtggtgct ggagcacggc aagacgatga ccgagaagga gatcgtcgac 1500
tacgtggcct cgcaggtcac gaccgcgaag aagctgcgcg gcggcgtggt gttcgtggac 1560
gaggtcccga agggcctgac gggcaagctg gacgcccgga agatccgcga gatcctgatc 1620
aaggccaaga agggcggcaa gatcgcggtg 1650
<210> 2
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cgggcccccc ctcgaggtcg acggtatatg gaggacgcca agaacatc 48
<210> 3
<211> 67
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gtaggcaccc cgcggtctag tcacttgtca tcgtcatcct tgtaatccac cgcgatcttg 60
ccgccct 67
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aggctcattc tccttttcac tc 22
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ggccttcttt tgaaaacaat cg 22
<210> 6
<211> 1836
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tgcccaagtc ccaaccgact ctttttcgac cttcactctc accgacaacg ggccccccct 60
cgaggtcgac ggtatcgata tggaggacgc caagaacatc aagaagggcc cggccccgtt 120
ctacccgctg gaggacggca cggccggcga gcagctgcac aaggccatga agcgctacgc 180
cctcgtcccc ggcacgatcg cgttcacgga cgcccacatc gaggtggaca tcacgtacgc 240
cgagtacttc gagatgtcgg tgcgtctggc ggaggcgatg aagcgctacg gcctgaacac 300
gaaccaccgc atcgtggtgt gttcggagaa ctccctccag ttcttcatgc cggtgctggg 360
cgccctgttc atcggcgtcg ccgtcgcccc cgccaacgac atctacaacg agcgcgagct 420
cctgaactcg atgggcatct cccagccgac ggtggtgttt gtctcgaaga agggcctgca 480
gaagatcctg aacgtgcaga agaagctccc catcatccag aagatcatca tcatggacag 540
caagaccgac taccagggct tccagtccat gtacacgttc gtgacgagcc acctgccgcc 600
gggcttcaac gagtacgact tcgtcccgga gtcgttcgac cgcgacaaga cgatcgccct 660
gatcatgaac tcctcgggct cgacgggcct gccgaagggc gtggcgctcc cccaccggac 720
ggcctgcgtg cgattctcgc acgcccgtga ccccatcttc ggcaaccaga tcatccccga 780
cacggccatc ctctcggtgg tcccgttcca ccacggcttc ggcatgttca ccaccctggg 840
ctacctgatc tgcggcttcc gcgtggtcct catgtaccgc ttcgaagagg agctgttcct 900
ccgcagcctg caggactaca agatccagtc ggcgctcctc gtgccgacgc tcttctcgtt 960
cttcgcgaag agcacgctga tcgacaagta cgacctgagc aacctccacg agatcgccag 1020
cggcggcgcg ccgctgtcta aggaagtggg cgaggcggtg gccaagcgct tccacctgcc 1080
gggcatccgc cagggctacg gcctcacgga gaccacctcg gccatcctga tcacgcccga 1140
gggcgacgac aagccgggcg ccgtgggcaa ggtggtcccg ttcttcgagg ccaaggtcgt 1200
ggacctggac acgggtaaga ccctgggcgt gaaccagcgc ggcgagctct gcgtgcgtgg 1260
ccccatgatc atgagcggct acgtgaacaa cccggaggcc accaacgccc tgatcgacaa 1320
ggacggctgg ctgcactcgg gcgacatcgc ctactgggac gaggacgagc atttctttat 1380
cgtggaccgt ctgaagtcgc tgatcaagta caagggctac caggtggcgc cggccgagct 1440
ggagtcgatc ctgctccagc acccgaacat cttcgacgct ggcgtcgcgg gcctccccga 1500
cgacgacgcc ggcgagctgc cggccgccgt ggtggtgctg gagcacggca agacgatgac 1560
cgagaaggag atcgtcgact acgtggcctc gcaggtcacg accgcgaaga agctgcgcgg 1620
cggcgtggtg ttcgtggacg aggtcccgaa gggcctgacg ggcaagctgg acgcccggaa 1680
gatccgcgag atcctgatca aggccaagaa gggcggcaag atcgcggtgg attacaagga 1740
tgacgatgac aagtgactag accgcggggt gcctacttct tgtaagccga aggtcgagct 1800
gtgtgcactg agtgcgaagt tgcagatttt gtgtct 1836

Claims (3)

1. The application of the luciferase-marked pathogenic bacteria as a report system in screening disease-resistant resources or resistant crops is characterized in that zoospores, hyphae, oospores or bacterial cakes of the luciferase-marked pathogenic bacteria are used for inoculating plants, luciferase substrates are added after infection, and the length or area of lesions is counted; the length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance or different types of potential disease-resistant resources on pathogenic bacteria; the gene sequence of the luciferase is shown as SEQ ID NO. 1;
the disease-resistant resource is a disease-resistant gene or microorganism strain with biological control potential, chemical pesticide or biological pesticide;
the bacterial strain of the luciferase-marked pathogenic bacteria is a bacterial strain PsLuc or a bacterial strain PcLuc, the bacterial strain PsLuc is classified and named as phytophthora sojae (Phytophthora sojae), and the bacterial strain PsLuc is preserved in China general microbiological culture Collection center (China) with a preservation number of 11 th month 2020: CGMCC No.21049, the strain PcLuc is classified and named as phytophthora capsici (Phytophthora capsici), and is preserved in China general microbiological preservation center (China center for type culture Collection), with the preservation number of: CGMCC No.21048.
2. A method for screening disease-resistant resources or resistant crops by taking luciferase-marked pathogenic bacteria as a reporting system is characterized in that zoospores, hyphae, oospores or bacterial cakes of the luciferase-marked pathogenic bacteria are used for inoculating plants, luciferase substrates are added after infection, and the length or area of lesions is counted; the length or area of the disease spots is used for measuring the inhibition or promotion effect of crop resistance or different types of potential disease-resistant resources on pathogenic bacteria; the gene sequence of the luciferase is shown as SEQ ID NO. 1;
the disease-resistant resource is a disease-resistant gene or microorganism strain with biological control potential, chemical pesticide or biological pesticide;
the bacterial strain of the luciferase-marked pathogenic bacteria is a bacterial strain PsLuc or a bacterial strain PcLuc, the bacterial strain PsLuc is classified and named as phytophthora sojae (Phytophthora sojae), and the bacterial strain PsLuc is preserved in China general microbiological culture Collection center (China) with a preservation number of 11 th month 2020: CGMCC No.21049, the strain PcLuc is classified and named as phytophthora capsici (Phytophthora capsici), and is preserved in China general microbiological preservation center (China center for type culture Collection), with the preservation number of: CGMCC No.21048.
3. A luciferase-tagged pathogenic bacterium, characterized in that the luciferase-tagged pathogenic bacterium is a strain PsLuc or a strain PcLuc, the strain PsLuc being classified as phytophthora sojae (Phytophthora sojae), deposited in the China general microbiological deposit management center (China) 11-month 11 under the accession number: CGMCC No.21049, the strain PcLuc is classified and named as phytophthora capsici (Phytophthora capsici), and is preserved in China general microbiological preservation center (China center for type culture Collection), with the preservation number of: CGMCC No.21048.
CN202110263303.2A 2021-03-11 2021-03-11 Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian Active CN113174423B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110263303.2A CN113174423B (en) 2021-03-11 2021-03-11 Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110263303.2A CN113174423B (en) 2021-03-11 2021-03-11 Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian

Publications (2)

Publication Number Publication Date
CN113174423A CN113174423A (en) 2021-07-27
CN113174423B true CN113174423B (en) 2024-03-01

Family

ID=76922101

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110263303.2A Active CN113174423B (en) 2021-03-11 2021-03-11 Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian

Country Status (1)

Country Link
CN (1) CN113174423B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994401A (en) * 2013-01-05 2013-03-27 青岛农业大学 Method for preparing apple tree valsa ceratosperma transformant and GFP (Green Fluorescent Protein) labelled strain
CN104531750A (en) * 2014-12-24 2015-04-22 江苏省农业科学院 Method for labelling ascochyta citrullina by adopting green fluorescent protein (GFP)
CN106636173A (en) * 2017-02-07 2017-05-10 吉林省农业科学院 Method for labeling corn head smut fungus through enhanced green fluorescent protein, as well as corn head smut fungus and application of corn head smut fungus

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000012735A2 (en) * 1998-08-31 2000-03-09 Monsanto Co. Transgene assay using stable agrobacterium rhizogenes transformation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994401A (en) * 2013-01-05 2013-03-27 青岛农业大学 Method for preparing apple tree valsa ceratosperma transformant and GFP (Green Fluorescent Protein) labelled strain
CN104531750A (en) * 2014-12-24 2015-04-22 江苏省农业科学院 Method for labelling ascochyta citrullina by adopting green fluorescent protein (GFP)
CN106636173A (en) * 2017-02-07 2017-05-10 吉林省农业科学院 Method for labeling corn head smut fungus through enhanced green fluorescent protein, as well as corn head smut fungus and application of corn head smut fungus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
利用绿色荧光蛋白研究大豆疫霉与大豆的互作;陈孝仁等;科学通报;54(13);1894-1901 *

Also Published As

Publication number Publication date
CN113174423A (en) 2021-07-27

Similar Documents

Publication Publication Date Title
Serfling et al. Performance of the biocontrol fungus Piriformospora indica on wheat under greenhouse and field conditions
CN102246823B (en) Method of controlling cutworm pests
CN101282651A (en) Fungal isolates and biological control compositions for the control of weeds
CN111171123B (en) Plant immune activation protein PsPII1 and application thereof
Taghdi et al. Effectiveness of composts and Trichoderma strains for control of Fusarium wilt of tomato
CN114214220B (en) Bacillus thuringiensis and application thereof in promoting plant growth
CN105219781A (en) The method of cultivation of pest-resistant transgenic rice T1c-19
CN110241131A (en) The application of arabidopsis protective plant protecting agent transport protein PDR8 gene
CN109776659B (en) Application of cry2Ah-vp gene in anti-myxobolus
Matušinsky et al. Compatible interaction of Brachypodium distachyon and endophytic fungus Microdochium bolleyi
US20130340124A1 (en) Chimeric gene for heterologous expression that encodes peptides with antimicrobial activity
US20230054349A1 (en) Application of EMBP1 Gene or Protein Thereof
CN116731143B (en) Application of tomato ERF17 gene in regulation and control of plant insect resistance
CN113174423B (en) Preparation method of phytophthora capsici luciferase labeling strain and application of phytophthora capsici luciferase labeling strain in prevention and control of phytophthora capsici leonian
Sun et al. No adverse effects of transgenic maize on population dynamics of endophytic Bacillus subtilis strain B916‐gfp
CN110358778A (en) SlDALR2 gene is improving the application in tomato bacterial leaf spot resistance
CN114276945B (en) Bacillus thuringiensis and application thereof
CN102372781B (en) Insect antibacterial peptide thanatin (s) fusion protein and application thereof to plant disease resistance
Farhaoui et al. Fungal Root Rots of Sugar Beets: A Review of Common Causal Agents and Management Strategies
US10952441B2 (en) Symbiont for enhancement of plant performance
Wang et al. Phytoplasma: A plant pathogen that cannot be ignored in agricultural production—Research progress and outlook
CN115215931B (en) Use of protein IbC H18 related to vine cutting disease and soft rot disease or substance for regulating and controlling expression of protein IbC H18
CN110922463B (en) Rice disease-resistant gene RGA5-HMA5 and application thereof in rice breeding
Vinson Effects of abiotic stress on the oomycete Phytophthora pluvialis
CN115927351B (en) Application of brown planthopper salivary protein gene NlDNAJB9 in inducing plant to generate resistance

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant