CN113171469A - Tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof - Google Patents
Tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof Download PDFInfo
- Publication number
- CN113171469A CN113171469A CN202011112535.XA CN202011112535A CN113171469A CN 113171469 A CN113171469 A CN 113171469A CN 202011112535 A CN202011112535 A CN 202011112535A CN 113171469 A CN113171469 A CN 113171469A
- Authority
- CN
- China
- Prior art keywords
- sirna
- drug
- nano
- breast cancer
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
- A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
- A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
- A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
- A61K47/6935—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Nanotechnology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
A nanometer medicine targeting the surface Trop2 protein of tumor cell for treating tumor and its preparation method, the nanometer medicine is targeting Trop2, respond to the novel nanometer medicine of GSH, through loading Trop2 antibody, can target the tumor cell of over-expression Trop2, make the nanometer medicine enrich in the tumor tissue, reduce the oxic side effect to normal tissue, cell to the maximum extent, and respond to GSH of high concentration in cytoplasm, make the nanometer medicine release the cardinal remedy fast in the cytoplasm of the specific site, reduce the interference to other biological processes. The nano-drug has long circulation time in blood, can improve the utilization rate of the main drug, prolong the action time of the main drug and improve the treatment effect. The invention also discloses lnc RNA for promoting TNBC invasion and metastasis, provides application of the lnc RNA in diagnosis and treatment of triple negative breast cancer, and can use siRNA of the lnc RNA as a main drug of the nano-drug to treat triple negative breast cancer.
Description
Technical Field
The invention relates to the field of tumor molecular biology, in particular to a tumor treatment nano-drug targeting a Trop2 protein on the surface of a tumor cell and a preparation method thereof.
Background
In normal tissues, the endothelial gaps of the microvasculature are compact and complete in structure, and macromolecular substances cannot easily permeate through the vascular wall; the contrast is true for solid tumor tissues, which have selective permeability and retention effect (EPR effect) for macromolecular substances. The characteristics of the solid tumor tissue just promote the selective distribution of the nanoparticle substances wrapping the main drug in the tumor tissue, so that the side effects of the system are reduced while the drug effect is increased. However, although tumor tissues have an EPR effect on nanoparticulate substances, studies have shown that the efficiency of this process is not high, and the amount of nanoparticles accumulated in solid tumors by the EPR effect is only 0.7% of the injected dose on average. In order to improve the problem, the prior art further studies Antibody conjugates to improve targeting property and efficacy, taking Antibody-siRNA conjugates (SRCs) as an example, which are a novel antitumor drug formed by coupling an Antibody with targeting property and siRNA, and can link the Antibody with siRNA itself or a carrier thereof, thereby reducing off-target effect and improving bioavailability. Such antibody conjugates, while capable of improved targeting, have drawbacks, such as, when some antibodies are loaded with nanoparticles, the excessive molecular weight of the antibody can limit the number of monoclonal antibodies that can be placed on a single nanoparticle, resulting in decreased efficiency. In addition, some antibodies may have immunogenic and cytotoxic Fc domains, which may lead to side effects.
Meanwhile, even if targeting can be realized by selecting a targeting antibody, the action effect is still limited, the nano particles cannot enable the main drug to act on a specific site to be targeted, and cannot realize responsive main drug release based on the specificity of a tumor microenvironment, namely, the application and the treatment effect of the nano particles are still limited; taking the packaging of the siRNA as an example, if the siRNA is released to act on the target gene without entering into the cytoplasm of a specific site, the utilization rate of the siRNA is obviously lower, and the silencing effect is obviously limited.
Therefore, a response type nano-medicament which is not only connected with a targeting substance, but also can responsively release the main medicament at a specific site and has small toxic and side effects is needed, so that the action effect of the main medicament is improved. Furthermore, a marker and an action target point which can be applied to the prediction, diagnosis and/or prevention of tumors can be found in time, the excavation on the level of the main drug can be realized, the combination of the nano-drug and the main drug corresponding to the marker and the action target point is convenient, and the corresponding tumor treatment function is realized.
Disclosure of Invention
The invention constructs the Trop2 antibody-loaded intracellular response nanoparticle type nano-medicament of the main medicament for the first time, the PDSA wrapped outside the main medicament responds to the GSH in cytoplasm, the nano-medicament can realize the rapid release of the wrapped main medicament in cytoplasm, and the Trop2 antibody is also loaded and connected with the nano-medicament, so the nano-medicament is not only beneficial to the release of the main medicament, but also can improve the targeting property by means of the Trop2 antibody, thereby reducing the toxic and side effects. Because the Trop2 antigen presents specificity and high expression in various tumor tissues, the nano-drug is suitable for various tumor tissues, is beneficial to combining different main drugs to realize targeted therapy on various tumors over-expressing Trop2 and realize enrichment in the tumor tissues, and the nano-drug responds to intracellular concentration GSH to quickly release the main drugs, so that the action site of the main drugs can further have specificity in a biological environment on the premise that the Trop2 antibody enables the nano-drug to have targeting property. The inventor adopts the siRNA wrappage to carry out the performance detection of the nano-medicament, and the result shows that the nano-medicament in the application is obviously improved in the capability of being taken up by cells compared with naked main medicament siRNA, so that the nano-medicament can also promote the main medicament to be taken up so as to improve the efficacy of injecting the medicament with the same dosage. The formed nano-drug can effectively reduce off-target effect and improve bioavailability. Meanwhile, the inventor also finds that the nano-medicament constructed by the method has a longer blood circulation half-life period, and the main medicament can be retained in an organism for a longer time based on the nano-medicament, so that the utilization rate of the main medicament is improved, and the action time of the main medicament is prolonged. Based on the characteristics of the Trop2 antibody and intracellular response, the nano-drug formed by combining the main drugs has strong enough targeting property, and compared with the antibody with large molecular weight in the prior art, the Trop2 antibody can avoid the limitation on the nano-drug load, is beneficial to the improvement of the nano-drug load quantity, and improves the efficiency. And the Trop2 antibody is safer than antibodies with immunogenicity and cytotoxicity of other Fc domains, and the safety of the nano-drugs based on the Trop2 antibody can be seen from the in vivo toxicity test results of the inventor on the nano-drugs. Therefore, the nano-drug can improve the targeting property and the curative effect of the main drug, reduce or avoid toxic and side effects and reduce the damage to normal tissues and cells to the maximum extent.
The invention provides an intracellular response nano-drug, namely the nano-drug, which comprises a main drug for treating tumor, a high molecular polymer PDSA which is wrapped outside the main drug and decomposed under the concentration of glutathione in cytoplasm, and a Trop2 antibody which is connected with the PDSA and/or the main drug. The PDSA is a high molecular polymer synthesized by adding cystine dimethyl ester hydrochloride into a mixed solution of fatty diacid and triethylamine, and the high molecular polymer material keeps stable under the condition of low-concentration glutathione and responds to the high-concentration glutathione. GSH is rich in cytoplasm as a common reducing substance, and has low concentration in extracellular matrix, and based on the characteristic, the GSH concentration can be used for realizing responsive nano-drugs, thereby promoting the release and the function of the wrapped main drug in the cytoplasm. By cytoplasmic glutathione concentration (2)-10×10-3M) is extracellular glutathione concentration (2)-10×10-6M) is 1000 times of the total amount of the active ingredients, and the PDSA can quickly respond to and release the main ingredients wrapped by the PDSA under the condition of the concentration of the cytoplasmic glutathione. And Trop2 antagonist linked with PDSA or main drugThe body can target the Trop2 antigen overexpressed in the tumor tissue, so that the nano-drug is targeted and enriched in the tumor tissue, the targeting property of the nano-drug is improved, and the efficiency of the main drug acting on the tumor tissue is improved.
Further, the particle size distribution range is 20-150 nm; furthermore, the particle size distribution range is 40-80 nm; the nano-drug particle size distribution range is controlled to be 20-150 nm, and the nano-drug particle size distribution range is beneficial to being applied to organisms so as to smoothly pass through various biological barriers and improve the transportation performance.
Further, the main drug is siRNA molecule, and the siRNA molecule comprises target gene siRNA for inhibiting the occurrence and development of tumor. Through the Trop2 antibody, the nano-drug can at least realize targeting before the release of the main drug, and when the main drug is a target gene siRNA molecule which has a targeting effect and inhibits the occurrence and development of tumors, the targeting can be further realized on the level of the main drug, so that the cytotoxicity is reduced on the level of the main drug, the interference on other genes is avoided, and the side effect caused by the interference of normal genes is reduced. And when the main drug is siRNA molecules, the preparation and the loading of the nano-drug are facilitated, compared with the main drug with large molecular weight, the siRNA has small molecular weight, and the nano-drug is facilitated to be loaded with more siRNA, so that the effect of targeting effect is improved.
Further, the siRNA silences the expression of a long non-coding RNA gene, and the nucleotide sequence of the long non-coding RNA is shown as SEQ ID NO. 1. The invention firstly discovers that long-chain non-coding RNA (hereinafter, referred to as Uc003xsl.1) with a nucleotide sequence shown as SEQ ID NO.1 is obviously up-regulated in triple-negative breast cancer tissues compared with Luminal tissues, is combined with NKRF protein and occupies a site on NKRF combined with a negative reaction element on an IL8 promoter, so that the combination of NKRF and NRE on IL8 promoter is inhibited, the transcription of IL8 is promoted, and the triple-negative breast cancer cell transfer induced by downstream inflammatory protein is finally promoted. Indicating that Uc003xsl.1 can be used as a marker for predicting or diagnosing triple negative breast cancer metastasis, and is beneficial to timely acquiring the state of illness of a patient so as to conveniently carry out targeted treatment and improve the subsequent treatment effect. After the expression of Uc003xsl.1 in a triple-negative breast cancer cell is silenced by siRNA loaded with Uc003xsl.1 through a nano-drug, the invasion and metastasis of the tumor cell are obviously inhibited, which indicates that the inhibitor of long-chain non-coding RNA Uc003xsl.1 is beneficial to realizing the treatment of triple-negative breast cancer and is beneficial to realizing comprehensive triple-negative breast cancer treatment by combining other drugs; furthermore, the siRNA has targeting property, which is beneficial to improving the treatment effect and reducing toxic and side effects by utilizing the targeting property. Meanwhile, the siRNA of Uc003xsl.1 and the PDSA intracellular response nano-carrier loaded with the Trop2 antibody are combined to form the nano-drug, so that the siRNA targeting property of a target gene can be obviously improved, the siRNA of the target gene can be better targeted to tumor cells over-expressing Trop2, including triple negative breast cancer cells, and the nano-particles are enriched in corresponding tumor tissues. And the PDSA responds to high-concentration GSH in cytoplasm, so that the rapid release of the main drug in cells can be realized, and the target gene can be efficiently silenced. When the nano-drug simultaneously loads Trop2 antibody and siRNA of gene with inhibitory nucleotide sequence shown in SEQ ID NO.1, the inhibition on invasion and transfer functions of triple negative breast cancer can be realized, when intracellular response nano-drug wraps the siRNA, the inhibition on triple negative breast cancer can be at least realized, and the nano-drug can be applied to the treatment process of triple negative breast cancer. The gene sequence of the long non-coding RNA (hereinafter, referred to as Uc003xsl.1) is derived from the gene AC008691.1, and the nucleotide sequence of the long non-coding RNA is shown as follows:
GAGACGGTACCCGCGCCCCACAGTCCACCCGCTCCTCGGAGTCCCCCCGCGCCCC GGAGTCCACCCGCGCCCCGGAGTCCACCCGCGCAGGTCCACTTCTCCATCCCTGCTCTC GACCTCCGCCCCTGCGGTGGGGGAAGTTCCTGGGGCGGTGGCTGGGACCAGGCCGGGT TTTAGGCGGGCGCAGATTTCCGGGCTAACTTTCCTCGCCGTCTCAGCGCGGGAAGGGG GAAATGGGAAACCCGGGCCAGAGCAGCGGAGCTTCCCAGCCGCACACTTCCTCCCTCC AGCCGTTTGTCTCGGCAGGGGAGGGCCCAGGCAGCCAAGCCGGCAGGCCCACTGGTTA TCCGACCTTGTGCTCTGGCCGTGGGTGGAGACCTTACATCCAGCTCAGAGCGCCTCCTC CCATCCCCTGTGTCCTCTAGGCCTCCCCAGACTTTGCCTTTTAGCCTTCCAGTGAAACAA GTTCTGTATCCAAGATATACAATTAAGTGGACAAAGCAGATTGCAGAAAGTCTTTTCGTA GCTCACAAGGGGACATCAAAGATGACAAAGAGGAGTGGAAGAAGACAGAGAGAATCA ATGTGAGGAGCCTGGAACAGGGCTCTGAATTGTCTTCCCGCAGTGAAATCACTTGTCTA TTGCTGAGCCAAGAATTTGACTCTGAGCATCTAGGATGAGAAAGAAGAACTGGCACCT ACGCCATCTCTGCCCCTCGGGACTGACTATTTTGGCCCAGTTTCCTCAACAATGAAATGG GACTAATTATCCCAGGTCACACTTCTCTCTGGGCTTACCCTGGGAATCAGATGATTGAGC TTTGGATCTCACTCTGTTGCCCAGGCTGGAATGCAGTGATACGATCATGATTCACTGCAG CCTCAAACTCCTGGGTTCAAGTAACCCTCCCACCTCAGCTTTCTGAGTAACTGGGACTA CAGAATGCCCCACCCCACTTAGTCCATAGTGATGCCCACCTGTGGTTAATGGAGCTGAG GCTGCTGGACCAAAGGGAGGAAGTCTGTTAGGCATATGTGGAACCCAAAAGAGGAACT TCATCAACTGTCATGGACAGCTCTGCCACTTTGTGACCCTGTGGACTTTTTGGGAAGTG TTTTTGTGGTTCACCAGTCTCTCATTAGGCAAGGCCATTTGTCCTGGGTTGGTCTTCTTC ATTGGTGGAAAGTACAGCTGGGAGATTTGGAATGGTTGCAGATTGACTTGACTCTCATA AGGAACTGCCACCATGAGCTTTTGGGGAAAGACCTCAAGCTGTGGTGTGTTGCTGAGG ATTGTGGGATTCCTCCAAATCTTGGGGAACATTTTGAGTCATCACTGGCAGCAGATTTCT GTTGACAACTTGAGCAACTTCAGAATGAAGAAGCCATCTTCATCTCTCACATGAATATG ACTTTGGGTAAATCATCTCGAAATCTGAACCCATGGTTGTGATCCACACTCCTCCTGAGT TCTGATTTTTAGTGTAACCTTTTTCTTCTCATTTTTTCTTCTTTGTGCATCTCTTAAGGAGG TTTTTAAAATCTCATAATTAAAAAATTTATTTCTTCAAAACTTTTTATTTTGAAATCACTGT AAATTCACATACATTTGTATAAAATGCCACAGAAAAATCCTGTGTGCCTTTTACTCAGTTT ATTCTAATGATAACATCCTTAAAGAGATTTAAAAATTACTGAGATATAATTGAAATATGAG AAAATTCACTCTTTTATGCATTTAAATATCCTTTATGTTTTTTCATAGCTTATTAGCTCATTT CTTTTCAGTGCTGAATAATTCTTAATTGTCTGGATATACCATAGCTTATTTATCCATTCACG TATTGAAGGATGTTCTAGTGCTTTTAAGTTTTGGCAATTATGAATAAAGCTGCTGTATACA TTCAAAAAAAAAAAA。
further, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.2 and is 5'-GAAAGUACAGCUGGGAGAUTT-3', and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO.3 and is 5'-AUCUCCCAGCUGUACUUUCTT-3'; or, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.4 and is 5'-CCAUCUUCAUCUCUCACAUTT-3', and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO.5 and is 5'-AUGUGAGAGAUGAAGAUGGTT-3'. In a plurality of embodiments of the invention, the siRNA can effectively silence Uc003xsl.1, so as to inhibit the expression of the siRNA, and achieve the treatment effect of inhibiting the invasion and metastasis of triple negative breast cancer.
Further, the main drug is a modified siRNA molecule, such as a modified Uc003xsl.1siRNA molecule, wherein the modification comprises ribose modification, base modification or phosphate backbone modification. Modification of siRNA for its delivery and targeting effects also helps to improve practical clinical application of siRNA, and helps to further improve therapeutic effects of siRNA in combination with other substances. The targeted modification can generate the effects, and can further research the related biological process of the nano-drug loaded with the modified siRNA by utilizing the modifications of ribose, basic group and phosphate backbone, thereby facilitating the further improvement to obtain more effective nano-drug and further improving the treatment effect and the survival rate of patients.
Further, the nucleotide of the siRNA molecule is partially replaced and/or increased and decreased, and the siRNA molecule after the partial replacement and/or the increase and decrease silences the expression of the target gene before the nucleotide change of the siRNA. In the case of the Uc003xsl.1siRNA molecule, which is present as an expression inhibitor of Uc003xsl.1, the siRNA produced by adding or subtracting and/or replacing part of the nucleotides from the siRNA of SEQ ID NO.2 to SEQ ID NO.5, in addition to the above-mentioned sequence of SEQ ID NO.2 to SEQ ID NO.5, based on the nucleotide sequence corresponding to the same Uc003xsl.1, can also inhibit the expression of Uc003xsl.1. Therefore, siRNA targeting a gene is not limited to a few nucleotide sequences.
The invention also provides application of the intracellular response nano-drug in preparation of a drug for treating tumors over-expressing Trop 2. Because the nano-drug is connected with the Trop2 antibody, the nano-drug has targeting property on over-expressed Trop2 tissues, and the Trop2 is over-expressed in various tumors, the nano-drug is indicated to be applicable to treating various tumors over-expressed Trop2, so the nano-drug can be applied to preparing the drug for treating the tumors over-expressed Trop 2.
The invention also provides application of the intracellular response nano-medicament in preparing a medicament for treating breast cancer. In one embodiment of the invention, the Trop2 is expressed in breast cancer tissues more specifically than normal breast tissue programs, so that the nano-drug can be also applied to the treatment of breast cancer.
Further, the breast cancer is triple negative breast cancer. In one embodiment of the invention, compared with other types of breast cancer, the expression degree of Trop2 in the triple negative breast cancer tissue is the highest, so when the nano-drug is applied to triple negative breast cancer, the targeting property and the enrichment degree of the nano-drug are higher, and correspondingly, the effect of the released main drug is more obvious.
Furthermore, the medicine for treating the breast cancer is a medicine for inhibiting invasion and metastasis of triple negative breast cancer. In one embodiment of the invention, the nano-drug simultaneously loaded with the Trop2 antibody and the Uc003xsl.1siRNA can obviously inhibit invasion and metastasis of triple negative breast cancer, which indicates that the nano-drug can also realize corresponding inhibition effect by combining with a drug for targeted inhibition of invasion and metastasis of triple negative breast cancer.
The invention also provides a pharmaceutical composition which comprises the intracellular response nano-drug.
The invention also provides a preparation method of the intracellular response nano-drug, which comprises the following steps:
s1, adding cystine dimethyl ester hydrochloride into a mixed solution of fatty diacid and triethylamine to synthesize a PDSA high molecular polymer;
s2, preparing polyethylene glycol modified phospholipid (PEG-lipid) and polyethylene glycol-succinimide ester solution (PEG-NHS) capable of being specifically connected with the Trop2 antibody;
s3, preparing the Trop2 antibody-loaded and primary drug-loaded PDSA intracellular response nano-drugs by using the PDSA solution, the PEG-lipid solution, the PEG-NHS solution, the primary drug solution and the Trop2 antibody based on a nano-precipitation method.
On the basis of the discovery of the long non-coding RNA, the invention also provides application of the long non-coding RNA in preparing a medicament for diagnosing and treating triple negative breast cancer, wherein the nucleotide sequence of the long non-coding RNA is shown as SEQ ID NO. 1. More specifically, the application of the long-chain non-coding RNA in preparing the medicines for preventing, predicting, diagnosing and treating the invasion and metastasis of triple negative breast cancer is provided. In one embodiment of the invention, Uc003xsl.1 is obviously up-regulated in triple-negative breast cancer tissues and high-metastatic cells compared with other breast cancer tissues, and when the expression of Uc003xsl.1 is down-regulated, the invasion and metastasis of triple-negative breast cancer are obviously inhibited; the long-chain non-coding RNA Uc003xsl.1 can be used as a marker for predicting and diagnosing the invasion and metastasis of the triple negative breast cancer, and is favorable for the production of medicines for predicting or diagnosing the invasion and metastasis of the triple negative breast cancer.
Triple Negative Breast Cancer (TNBC) is a specific molecular subtype of breast cancer, accounting for approximately 15% of breast cancer patients. The prognosis of the triple negative breast cancer patient is poor, and the pathological characteristics of the triple negative breast cancer patient are high malignancy, early onset age and easy occurrence of organ metastasis such as internal organs, bones and the like at an early stage. And patients with triple negative breast cancer have a short survival time, which is usually only 12 to 15 months once the tumor has metastasized. At present, invasion and metastasis of triple negative breast cancer often cannot be prevented or diagnosed in time, and a patient easily loses the opportunity of inhibiting the metastasis of triple negative breast cancer. Meanwhile, the means for inhibiting the triple negative breast cancer metastasis in the prior art is very limited, and the requirements of patients and clinical treatment are difficult to meet. Therefore, the discovery of the long-chain non-coding RNA Uc003xsl.1 can provide an effective triple negative breast cancer treatment means, can be used as a marker for predicting, diagnosing and preventing triple negative breast cancer metastasis, is convenient to obtain a treatment substance for effectively inhibiting triple negative breast cancer metastasis, and can be applied to prolong the life span of a triple negative breast cancer patient.
The invention also provides application of the inhibitor in preparing a medicament for treating triple negative breast cancer, wherein the inhibitor inhibits the expression of a long-chain non-coding RNA gene, and the nucleotide sequence of the long-chain non-coding RNA is shown as SEQ ID NO. 1. In one embodiment of the invention, after the expression of Uc003xsl.1 is inhibited by inhibitor siRNA, the invasion and metastasis functions of triple negative breast cancer are obviously inhibited, and the invasion and metastasis belong to the process of the development of triple negative breast cancer; namely, the inhibitor which can down-regulate the expression of Uc003xsl.1 can be applied to the treatment of triple negative breast cancer to inhibit the development of triple negative breast cancer.
Furthermore, the medicine for treating the triple negative breast cancer is a medicine for inhibiting invasion and metastasis of the triple negative breast cancer. In one embodiment of the invention, after the inhibitor siRNA of Uc003xsl.1 silences the expression of Uc003xsl.1, the invasion and metastasis of triple negative breast cancer are obviously inhibited.
Further, the inhibitor is an siRNA molecule. The siRNA can be targeted on Uc003xsl.1, on one hand, the efficiency of acting target genes can be improved based on the targeting property of the siRNA, gene fragments corresponding to the Uc003xsl.1 can be targeted and silenced, and meanwhile, side effects caused by interference on the expression of other genes can be avoided, thereby being beneficial to realizing targeted killing and treatment on breast cancer tissues and cells. And when the inhibitor is an siRNA molecule, the siRNA molecule is beneficial to realizing further high-efficiency transportation and targeted transportation by virtue of other carriers, is beneficial to realizing a remarkable treatment effect based on less dosage, and can effectively avoid side effects possibly caused by excessive dosage. Compared with non-targeting therapeutic drugs or inhibitors, the siRNA can not only avoid the influence on the expression of other genes, but also avoid the negative influence on the therapeutic effect of other drugs when combined with other drugs for treatment; it is useful to achieve a therapeutically beneficial effect in combination with other drugs or carriers.
Further, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.2 and is 5'-GAAAGUACAGCUGGGAGAUTT-3', and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO.3 and is 5'-AUCUCCCAGCUGUACUUUCTT-3'; or, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.4 and is 5'-CCAUCUUCAUCUCUCACAUTT-3', and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO.5 and is 5'-AUGUGAGAGAUGAAGAUGGTT-3'. In a plurality of embodiments of the invention, the siRNA can effectively silence Uc003xsl.1, so as to inhibit the expression of the siRNA, and achieve the treatment effect of inhibiting the invasion and metastasis of triple negative breast cancer.
Further, the siRNA molecule is a modified siRNA molecule that silences expression of the long non-coding RNA gene. The modifications include ribose modifications, base modifications, or phosphate backbone modifications. Since the siRNA is designed based on the nucleotide sequence of SEQ ID NO.1, the silencing effect can be achieved by only siRNA which is completely the same as the siRNA sequence, and when the siRNA is modified and the modified siRNA can still inhibit the expression of Uc003xsl.1, the modified siRNA can also achieve the effect of inhibiting the invasion and metastasis of triple negative breast cancer. And for the transportation and targeting effects of the siRNA, the modification of the siRNA is also helpful for improving the practical application of the siRNA in clinic and is helpful for further improving the treatment effect of the siRNA alone or the combination of the siRNA and other substances. The targeted modification can not only produce the effect, but also utilize the modification of ribose, basic group and phosphate backbone to further research the subsequent siRNA silencing mechanism and the biological process caused by silencing, for example, the modification is carried out by using a marker, which is helpful for researching the transportation efficiency of siRNA in clinical use, the biological mechanism possibly caused and other cancer inhibition mechanisms, thereby realizing more effective treatment drugs or schemes based on the research basis to improve the treatment effect and the survival rate of patients.
Further, the nucleotides of the siRNA molecule are partially replaced and/or increased and decreased, and the siRNA molecule after the partial replacement and/or the increase and decrease of the nucleotides silences the expression of the long-chain non-coding RNA gene. The siRNA exists as an expression inhibitor of Uc003xsl.1, and based on the corresponding nucleotide sequence of the same Uc003xsl.1, besides the sequences of SEQ ID NO. 2-SEQ ID NO.5, the siRNA generated by adding or reducing and/or replacing part of nucleotides on the basis of the siRNA of the sequences of SEQ ID NO. 2-SEQ ID NO.5 can also inhibit the expression of Uc003xsl.1, so that the siRNA is not limited to only the nucleotide sequence, and the addition and/or replacement of part of nucleotides on the basis of the sequences of SEQ ID NO. 2-SEQ ID NO.5 is helpful to obtain the siRNA which can further effectively inhibit the expression of Uc003xsl.1 or is convenient to combine with other therapeutic substances to realize treatment along with the intensive research on the Uc003xsl.1.
The invention also provides a pharmaceutical composition, which comprises an inhibitor for inhibiting the gene expression of the long-chain non-coding RNA, wherein the nucleotide sequence of the long-chain non-coding RNA is shown as SEQ ID No. 1.
Further, the medicine composition also comprises other medicines compatible with the inhibitor and a pharmaceutically acceptable carrier and/or auxiliary material. The carrier and/or auxiliary materials compatible with the inhibitor are beneficial to the rapid action of the inhibitor; further, the vector is selected from one or more of a virus, a nanoparticle, cholesterol, or a liposome, the nanoparticle not only facilitates encapsulation of the inhibitor, but also facilitates modification based on the nanoparticle for more diverse targeted therapies. The virus, cholesterol and liposome vector can also provide a vector environment suitable for various scenes for the inhibitor.
Further, the siRNA molecule inhibitor comprises an inhibitor and a nanoparticle carrier, wherein the inhibitor is an siRNA molecule, the nanoparticle carrier comprises PDSA and Trop2 antibody components, the PDSA is wrapped outside the inhibitor, and a Trop2 antibody is connected with the PDSA and/or the inhibitor. In fact, the nano particle carrier is the component of the intracellular response nano medicine except the main medicine. The PDSA can rapidly respond to intracellular glutathione, and the rapid release of the inclusion is realized. The Trop2 antibody helps to further improve the targeting of the nanoparticles, since in one embodiment of the invention the Trop2 antigen is overexpressed in TNBC cells, and thus the Trop2 antibody helps to target TNBC tissue. The nano-drug formed by wrapping the siRNA can enter into a membrane cell and spread along synapses of nerve cells, blood vessels and lymphatic vessels, so that the technical problem that the siRNA transmission in the prior art is lack of effective carriers is solved, and the targeting effect efficiency of the siRNA is improved. After the siRNA is wrapped by the nanoparticle carrier, on one hand, targeted transportation can be realized based on Trop2, on the other hand, intracellular release of nano-drugs can be realized by utilizing PDSA, intracellular response is realized to release target gene siRNA, and target genes can be silenced efficiently, so that the effect of obviously inhibiting invasion and transfer of triple negative breast cancer is achieved, the toxic action is avoided to the greatest extent, and the damage to normal tissue cells is reduced.
Compared with the prior art, the invention has the beneficial effects that: the nano-drug is loaded with a Trop2 antibody, can better target tumor cells over expressing Trop2, including breast cancer cells, so that nanoparticles are enriched in tumor tissues, toxic and side effects on normal tissue cells are reduced to the maximum extent, and the nano-drug responds to high-concentration GSH in cytoplasm, so that the nano-drug can accelerate release of main drugs at the cytoplasm of a specific site, and interference on other biological processes is further reduced. And the synthesis steps are simple, the preparation process is easy to operate, mass production can be realized, and clinical transformation is easy to realize. Meanwhile, the nano-drug has longer circulation time in blood, can improve the utilization rate of the main drug, prolong the action time of the main drug and improve the treatment effect of the main drug. When the main drug is siRNA, the targeting property and the treatment effect can be further improved by utilizing the siRNA, and the corresponding nano-drug can quickly respond to high-concentration GSH in cytoplasm to promote the release of the siRNA and efficiently silence the target gene. The invention also finds that the target gene lncRNA Uc003xsl.1 for promoting TNBC metastasis can realize the prediction or diagnosis of triple negative breast cancer metastasis based on the long non-coding RNA Uc003xsl.1, and timely acquires the state of illness of a patient so as to conveniently carry out targeted treatment, thereby improving the subsequent treatment effect and prolonging the life cycle of the patient. And the inhibitor of the long non-coding RNA Uc003xsl.1 can realize the inhibition of the invasion or the metastasis of the triple negative breast cancer, and can realize clinical application in the treatment of the triple negative breast cancer, thereby preventing or treating the metastasis of the triple negative breast cancer and at least playing a role in inhibiting the development trend of tumors. The combination with other therapeutic drugs is convenient for realizing the treatment of tumors in all dimensions, and the treatment effect is improved. The inhibitor adopted by the invention is siRNA, and the siRNA can target genes, thereby avoiding interference on other genes or other medicines, being beneficial to realizing high-efficiency inhibition, avoiding generating other toxic and side effects, improving the treatment experience of patients, improving the compliance and facilitating subsequent continuous treatment. The siRNA of the long-chain non-coding RNA is further used as the main drug of the intracellular response nano-drug, and the formed nano-drug can inhibit invasion and metastasis of triple negative breast cancer and can be applied to treatment of triple negative breast cancer. The targeting property of the PDSA nano-drug loaded with the Trop2 antibody is improved, the tumor cells over-expressing the Trop2 are better targeted, the nano-drug is enriched in the tumor tissues, and intracellular response release is realized, so that the damage to other normal cells is further avoided. And the intracellular response release is quick, the circulation time in blood is long, the target gene can be silenced efficiently, the quick and lasting effect can be realized, the transfer of the triple negative breast cancer can be inhibited obviously, and the treatment effect is improved.
Drawings
FIG. 1 is a sequence heatmap and gene intersection of Luminal and TNBC tissues, highly metastatic and common MDA-MB-231 cells;
FIG. 2 is a qPCR validation of MIF-AS1, PRNCR1, and Uc003xsl.1 in Luminal and TNBC tissues and highly metastatic and normal MDA-MB-231 cells;
FIG. 3 is a graph of the effect on MDA-MB-231 cell migration and invasion following knockdown of Uc003xsl.1;
FIG. 4 shows the interaction of Uc003xsl.1 with NKRF;
FIG. 5 shows that Uc003xsl.1 is involved in regulating the transcriptional activity of IL 8;
FIG. 6 is a synthesis scheme of PDSA;
FIG. 7 is a nuclear magnetic resonance hydrogen spectrum of a PDSA;
FIG. 8 is a molecular weight statistics table for various PDSAs;
FIG. 9 shows the expression of Trop2 in breast cancer cell lines and normal breast epithelial cell lines;
FIG. 10 shows the subcellular localization of Trop2 in the MDA-MB-231 cell line;
fig. 11 is IHC staining of Trop2 in normal breast and breast cancer tissues;
FIG. 12 is a graph of the size distribution of a nanoparticle loaded with Trop2 antibody and Uc003xsl.1siRNA;
FIG. 13 is a micrograph of a nanoparticle loaded with Trop2 antibody and Uc003xsl.1siRNA;
FIG. 14 shows the molecular weight change of the polymer PDSA after being incubated with GSH for 4 hours;
FIG. 15 is a graph of the change in particle size of nanoparticles loaded with Trop2 antibody and Uc003xsl.1siRNA in aqueous solutions of different GSH concentrations;
FIG. 16 is a release curve of nanoparticles loaded with Trop2 antibody and fluorescently labeled Uc003xsl.1siRNA in GSH aqueous solutions of different concentrations;
FIG. 17 shows the intracellular fluorescence intensity of the nanoparticles carrying Trop2 antibody and fluorochrome-labeled siRNA after 4 hours of cell culture;
FIG. 18 is a graph of the efficiency of nanoparticles in knockdown of target genes at different concentrations of Uc003xsl.1siRNA;
FIG. 19 is a graph of the effect of nanoparticles loaded with Trop2 antibody and Uc003xsl.1siRNA on cell migration;
figure 20 is the effect of nanoparticles loaded with Trop2 antibody and uc003xsl.1sirna on cell invasion;
FIG. 21 is an in vivo metabolic performance assay of nanoparticles;
FIG. 22 shows tumor enrichment of nanoparticles;
FIG. 23 is an in vivo distribution of nanoparticles;
FIG. 24 shows lung metastasis following treatment with each set of nanoparticles;
FIG. 25 shows the liver and kidney function of nude mice treated with each set of nanoparticles;
FIG. 26 is a graph showing the staining of the pathological tissues of the heart, liver, spleen, lung and kidney of nude mice treated with each set of nanoparticles.
Detailed Description
The drawings are only for purposes of illustration and are not to be construed as limiting the invention. For a better understanding of the following embodiments, certain features of the drawings may be omitted, enlarged or reduced, and do not represent the size of an actual product; it will be understood by those skilled in the art that certain well-known structures in the drawings and descriptions thereof may be omitted.
Example 1
Acquisition and analysis of Uc003xsl.1
One, acquisition of Uc003xsl.1
The inventor collects 6 breast cancer fresh tissues from the grandma university Sun-Yi Xian commemorative hospital, wherein the 6 breast cancer fresh tissues comprise 3 TNBC and 3 Luminal breast cancer tissues. lncRNA sequencing was then performed by Illumina PE150 to analyze lncRNA expression in 6 breast cancer fresh tissues, the sequencing heatmap is shown in fig. 1A (left), and 30 lncrnas with upregulated TNBC tissue expression levels compared to luminel tissue were selected.
Meanwhile, in order to find out biomarkers related to TNBC metastasis, the inventors constructed a lung metastasis model of breast cancer, collected highly metastatic MDA-MB-231 cells from mouse lung metastasis, and screened 267 lncRNA that were up-regulated in expression of the highly metastatic MDA-MB-231 cells compared to normal MDA-MB-231-cells by lncRNA sequencing, which is shown in FIG. 1A (right), wherein MDA-MB-231-M represents the highly metastatic MDA-MB-231 cells.
Based on the intersection of the candidate lncrnas from the above two lncRNA sequencing data, the inventors finally screened 3 lncrnas whose expression levels were up-regulated in TNBC tissues and highly metastatic MDA-MB-231 cells, namely MIF-AS1, PRNCR1 and uc003xsl.1, AS shown in fig. 1B.
Subsequently, the present inventors verified the above 3 lncrnas by qPCR analysis, respectively, and as shown in fig. 2, among the 3 candidate lncrnas, only uc003xs1.1 was significantly up-regulated in TNBC tissue and highly metastatic MDA-MB-231 cells, indicating that uc003xs1.1 is closely related to the metastasis of TNBC.
On the basis, the inventor of the application takes Uc003xsl.1 as a target gene for further research.
II, Uc003xsl.1 gene function analysis and signal path verification
The result in (1) shows that uc003xsl.1 has a high expression level in the triple-negative breast cancer cell line MDA-MB-231, and on this basis, the present application utilizes siRNA designed according to the nucleotide sequence of uc003xsl.1 to silence the expression of uc003xsl.1 in the triple-negative breast cancer cell line MDA-MB-231 to further study the functions thereof, and finds that after siRNA silences the expression of uc003xsl.1 in the MDA-MB-231 cell, the migration and invasion functions of the tumor cell are significantly inhibited, and the result is shown in fig. 3, which indicates that inhibition of the expression of the uc003xsl.1 gene can realize inhibition of migration and invasion of the tumor cell, and suggests that uc003xsl.1 can promote metastasis of triple-negative breast cancer. In this example si-lnc1 represents siRNA formed by the sequences of SEQ ID NO.2 and SEQ ID NO. 3. si-lnc2 represents siRNA formed by SEQ ID NO.4 and SEQ ID NO.5 sequences; si-NC as control group.
Then, the present inventors further studied the molecular mechanism thereof, and found that: uc003xsl.1 has an interaction relationship with NF-kB repressing factors (NKRF) in nucleus, and further participates in regulating the transcriptional activity of NF-kB downstream target gene IL8, and the detection results are shown in FIGS. 4 and 5. It is understood that the prefix si in this example represents an siRNA corresponding to a suffix target gene.
After binding with NKRF protein, Uc003xsl.1 occupies a binding site on NKRF and a Negative Regulatory Element (NRE) on IL8 promoter, thereby inhibiting the binding of NKRF and the NRE on IL8 promoter, promoting the transcription of IL8 and finally promoting the downstream inflammatory protein-induced triple negative breast cancer cell transfer.
Example 2
Synthesis and structural analysis of PDSA
Synthesis of Primary, PDSA
The PDSA in this example is a high molecular polymer that decomposes at a higher glutathione concentration, and the mass production is performed by a "one-pot method" in this example, and the production process includes: (1) mixing and dissolving aliphatic diacid and triethylamine, wherein the aliphatic diacid comprises all aliphatic diacids such as succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, undecanedioic acid, dodecanedioic acid or tridecanedioic acid, and the solvent used for mixing and dissolving is a strong polar solvent such as dimethyl sulfoxide or dimethylformamide;
(2) cystine dimethyl ester hydrochloride (Cystine dimethyl ester dihydrate) was added dropwise to a mixed solution of fatty diacid and triethylamine under ice salt bath conditions. Then, after the reaction was stirred at room temperature for 15 minutes to 4 hours, the precipitate was removed from the reaction system, the filtrate was concentrated, and the crude product was precipitated using ethyl acetate.
(3) Dissolving the crude product with strong polar solvent such as dimethyl sulfoxide or dimethylformamide, adding ethyl acetate to precipitate out product, repeatedly precipitating for three times, and vacuum drying to obtain purified PDSA. As shown in fig. 6, a synthetic route map of PDSA is shown.
Second, structure detection analysis of PDSA
In this example, the structure of PDSA was analyzed and examined using a Varian (300MHz) type nuclear magnetic resonance spectrometer, and the molecular weight of PDSA was examined using size exclusion chromatography and multi-angle laser light scattering coupled analysis (SEC-MALLS). A dual detector system is used, including a MALLS device (DAWN EOS, Wyatt Technology) and an interferometric refractometer (Optilab DSP, Wyatt Technology). The concentration of the polymer was 10mg/mL, DMF was used as the mobile phase, and the flow rate was 0.3 mL/min. The results are shown in fig. 7 and 8, and fig. 7 and 8 are the nuclear magnetic resonance hydrogen spectrum of one PDSA and the molecular weight statistical table of several PDSAs, respectively.
Example 3
Detection of Trop2 expression in breast cancer
Gene expression detection of Trop2 in first and second mammary gland cell lines
The present inventors are based on normal mammary epithelial cell lines: MCF10A, HMEC; TNBC cell line: MDA-MB-231, MDA-MB-436, MDA-MB-468, BT 549; HER2+ breast cancer cell lines BT474, SKBR 3; the Luminal type breast cancer cell lines T47D, MCF-7 and ZR751 are subjected to detection of the expression level of the Trop2 gene in different cells, the detection method is Western blot, the detection result is shown in FIG. 9, and the Trop2 is found to be highly expressed in the breast cancer cell lines compared with the normal breast epithelial cell lines MCF10A and HMEC, wherein the expression level is highest in TNBC cell lines MDA-MB-231, MDA-MB-436, MDA-MB-468 and BT549, the expression level is second in HER2+ breast cancer cell lines BT474 and SKBR3, and the expression level is lowest in the Luminal type breast cancer cell lines T47D, MCF-7 and ZR 751. The above results also indicate that Trop2 antigen is present as a marker of breast cancer, and that even if high expression is present in various breast cancer tissues, the degree of high expression in various breast cancer tissues is still different, so that on the basis of the results, Trop2 antigen as breast cancer and particularly as triple negative breast cancer can be present as a target.
Two, subcellular localization
The subcellular localization of Trop2 was examined in the MDA-MB-231 cell line, and as a result, as shown in FIG. 10, Trop2 was found to be localized mainly to the cytoplasm and cell membrane. In combination with the intracellular response nanoparticles mentioned in other embodiments of the application, it is further shown that the Trop2 antibody not only helps to improve targeting property, but also helps to target cytoplasm and promote the intracellular response of the nanoparticles to release target gene siRNA, and reduces toxic and side effects on other normal cells and tissues.
IHC staining of three, different mammary tissues
The present inventors collected a total of 79 formalin-fixed, paraffin-embedded breast tissue samples including 20 normal breast tissues, 22 Luminal-type breast cancer tissues, 14 Her2+ breast cancer tissues, and 23 TNBC tissues from the grand university Sun-Yixian commemorative Hospital.
Then, these samples were subjected to Immunohistochemical (IHC) staining, and as a result, as shown in fig. 11, Trop2 was found to be highly expressed in breast cancer tissues compared to normal breast tissues, and to be most expressed in TNBC tissues. The results further demonstrate that the above-mentioned results can be used as significant markers and targets in breast cancer as well as triple negative breast cancer.
Example 4
Preparation and performance detection of Trop2 antibody and siRNA loaded PDSA nano material
Preparation of PDSA nano material loaded with Trop2 antibody and siRNA
In this example, PDSA nanoparticles loaded with Trop2 antibody and siRNA were prepared using a nanoprecipitation method.
(1) Selecting dimethylformamide as a solvent, and respectively preparing PDSA, polyethylene glycol modified phospholipid (PEG-lipid) and polyethylene glycol-succinimide ester (PEG-NHS) solution capable of being specifically connected with the Trop2 antibody.
(2) Mixing the PDSA solution, the PEG-lipid solution, the PEG-NHS solution, the siRNA aqueous solution, the Trop2 antibody and the cationic liposome, and dropwise adding the mixture into deionized water under the stirring condition to obtain the nano solution. The sirnas in this example were: siRNA with sense strand nucleotide sequence shown in SEQ ID NO.2 and antisense strand nucleotide sequence shown in SEQ ID NO. 3.
(3) The nano solution was transferred to an ultrafiltration membrane (EMD Millipore, MWCO 100K), the nanoparticles were separated by centrifugation, washed twice with deionized water, and the nanoparticles were collected and dispersed into 1mL of PBS buffer solution for use.
After the obtained nanoparticles are obtained, the size of the nanoparticles is measured by using a Nano-ZS ZEN3600 type particle size analyzer, and the result is shown in FIG. 12, which shows that the particle size range of the formed nanoparticles is 20-150 nm, and the size is further intensively distributed between 40-80 nm; the morphology of the nanoparticles was observed using a TEM of the Tecnai G20S-TWIN type, and as a result, as shown in fig. 13, the nanoparticles exist in a nearly spherical state, which structure facilitates crossing of various biological barriers.
Secondly, detecting and analyzing the polymer material PDSA and the reducibility of the nano material thereof
(1) Dissolving a certain amount of polymer materials PDSA and GSH in DMF and H2Mixed solution of O (volume ratio 9:1, final GSH concentration 10 mM). At different time points, 100 μ L of the solution was removed and the reduction responsiveness of PDSA was assessed using size exclusion chromatography detection; the results are shown in fig. 14, which indicate that PDSA has better reduction responsiveness.
(2) For the nanoparticles loaded with Trop2 antibody and siRNA, they were dispersed in aqueous GSH solution and the dimensions of the nanoparticles were examined at different time points using dynamic light scattering, the results are shown in fig. 15.
Third, nanoparticle controlled release detection
The PDSA nanoparticles carrying Trop2 antibody and fluorescent dye labeled siRNA were prepared according to the above preparation method. After multiple washes, it was dispersed in 1mL PBS. The nanoparticle solution was transferred to a dialysis tube, which was then placed in PBS aqueous solutions (GSH 0, 1mM, 10mM) containing different concentrations of glutathione at 37 ℃. At the indicated time point, 5. mu.L of the nanoparticle solution was removed and added to 100. mu.L of dimethyl sulfoxide solution. The fluorescence intensity of the fluorescent dye was measured using a fluorescence spectrophotometer. The cumulative release rate of siRNA is calculated according to the following formula: cumulative amount of released (%) ═ Mt/M∞) X 100; wherein M istIs siRNA, M, released from the nanoparticle at a given time point∞Is the total amount of siRNA loaded in the nanoparticles. Thus, a controlled release curve of the siRNA of the nanoparticle shown in fig. 16 was obtained, and as can be seen from fig. 16, the siRNA-encapsulated nanoparticle had a significant release amount at a higher glutathione concentration compared to that at a low glutathione concentration, verifying the release capacity of the nanoparticle and the potential for application in cells.
Fourthly, detecting the capability of the PDSA nano-particles loaded with Trop2 antibody and siRNA to be taken up by cells
Cells were seeded in 6-well plates and incubated for 24 hours with 2mL of medium containing 10% fetal bovine serum to allow for adequate adherence. Then, fluorescent dye labeled siRNA (Naked siRNA), nanoparticles (Nano) carrying the fluorescent dye labeled siRNA and nanoparticles (Nano-Trop2) carrying the Trop2 antibody and the fluorescent dye labeled siRNA are added respectively. After 4 hours of incubation, the medium was removed and the cells were washed three times with PBS. The cell uptake condition of the nanoparticles is analyzed by using a flow cytometer, and the result is shown in fig. 17, the two groups using the nanoparticles have better corresponding cell uptake capacity, and the Nano-Trop2 group shows the best corresponding cell uptake capacity, which indicates that the nanoparticles in the application are more beneficial to being taken by cells compared with naked siRNA, thereby being beneficial to directly acting on the cells and improving the action effect of the inclusion.
Example 5
Performance detection and tumor inhibition effect detection of Trop2 antibody and target gene siRNA loaded PDSA nano material
In this embodiment, based on the above examples 1 to 4, siRNA is designed based on uc003xsl.1 target gene, PDSA nanoparticles containing both Trop 2-loaded antibody and target gene siRNA are prepared by the preparation method of example 4, and the performance of the vector and the target gene siRNA effect based on the vector are tested. The siRNA referred in the embodiment is target gene Uc003xsl.1siRNA, and the siRNA in the embodiment is: siRNA with sense strand nucleotide sequence shown in SEQ ID NO.2 and antisense strand nucleotide sequence shown in SEQ ID NO. 3.
First, target gene silencing efficiency of nano particles and cell function change after silencing
Breast cancer MDA-MB-231 cells are inoculated into a 6-well plate, and 2mL of a culture medium containing 10% fetal bovine serum is added for incubation for 24 hours, so that the cells are fully attached to the wall. Nanoparticles (Nano-Trop2) loaded with siRNA (Nano) at different concentrations alone or with Trop2 antibody and siRNA at different concentrations are added. After 24 hours of incubation, the cells were incubated for another 48 hours. After RNA extraction, qPCR is carried out to detect the expression of lncRNA Uc003xsl.1, and the targeted Trop2 is found to obviously improve the silencing efficiency of target genes.
After the high-efficiency silencing effect of the nanoparticles on target genes is determined, the influence of the nanoparticles on cell functions is researched. It is found that the migration and invasion of MDA-MB-231 cells can be remarkably inhibited after the Uc003xsl.1 is knocked down by the nano-particles loaded with the Trop2 antibody and siRNA. Fig. 18 shows the efficiency of the nanoparticles in knocking down the target gene at different siRNA concentrations, and it can be seen from the figure that the nanoparticles targeted to Trop2 and loaded with siRNA have a more significant silencing effect than the nanoparticles loaded with siRNA alone, indicating that Trop2 antibody can significantly improve the silencing efficiency of the target gene; FIG. 19 is a graph showing the effect of nanoparticles loaded with Trop2 antibody and siRNA on cell migration, where Nano-siCTL is a negative control siCTL-encapsulated nanoparticle, Nano-siuc003 is Uc003xsl.1siRNA-encapsulated nanoparticle (hereinafter siuc003 is Uc003xsl.1siRNA), Nano-Trop2-siuc003 is a nanoparticle loaded with both Trop antibody and Uc003xsl.1siRNA, and both nanoparticles are encapsulated by PDSA; fig. 20 is a graph of the effect of nanoparticles loaded with Trop2 antibody and siRNA on cell invasion. Fig. 19 and 20 show that the siuc003 nanoparticle and the Trop2 and siuc 003-loaded nanoparticle both inhibit invasion and migration of tumor cells, and the inhibition effect of the Trop2 and siuc 003-loaded nanoparticle is most obvious.
Secondly, detecting the in vivo metabolism performance of the nano particles
Thirdly, evaluation of the enrichment capacity and in vivo distribution condition of nano-particle tumor
9 nude mice were divided into 3 groups, and 1X 10 mice were subcutaneously implanted on the back7MDA-MB-231 cells of (a), wait for the tumor size to grow to about 150mm in volume3When we give fluorescent dye labeled siRNA (Naked siRNA), nanoparticles (Nano) carrying fluorescent dye labeled siRNA and simultaneously carrying fluorescent dye labeled siRNAThe enrichment condition of the nanoparticles at a tumor part is detected by live imaging of a Trop2 antibody and nanoparticles of fluorescent dye siRNA (Nano-Trop2) after 24 hours, then important organs such as tumor, kidney, lung, spleen, liver, heart, muscle and the like are taken and the fluorescence intensity of the organs is detected, and the finding that the nanoparticles targeting Trop2 have stronger enrichment capacity at the tumor part and are mainly metabolized by the kidney is realized. FIG. 22 shows tumor enrichment of nanoparticles; FIG. 23 is the distribution of nanoparticles in vivo, in which siuc003 NPs represent the group of nanoparticles (Nano) loaded with fluorochrome-labeled siRNA, and siuc003/Trop2 NPs represent the group of nanoparticles loaded with both Trop2 antibody and fluorochrome siRNA.
Fourth, the effect of inhibiting tumor metastasis in vivo by nano particles
9 nude mice were divided into 3 groups and injected into 2X 10 mice via tail vein6MDA-MB-231 cells expressing luciferase. When lung metastases were detected by bioluminescence imaging technique (about 7 weeks), nanoparticles carrying negative control siCTL (siCTL NPs), nanoparticles carrying siRNA and nanoparticles carrying both Trop2 antibody and siRNA were injected via tail vein once every other day (siuc003 is 1nmoL), injected 3 times consecutively, and after 3 weeks lung tissues were taken and fixed with 4% paraformaldehyde, and lung metastases were analyzed to find that the siuc003/Trop2 NPs group had the strongest ability to inhibit lung metastases. Fig. 24 shows lung metastasis after treatment with each set of nanoparticles. In the figure, siuc003 NPs represent the group of nanoparticles loaded with siRNA, and siuc003/Trop2 NPs represent the group of nanoparticles loaded with both Trop2 antibody and siRNA.
Fifth, in vivo toxicity test of nanoparticles
25 nude mice were divided into 5 groups, and each of the groups was administered with PBS200uL (Control), a pure nanomaterial (Nano), a nanoparticle carrying a Trop2 antibody (Nano-Trop2), a nanoparticle carrying siRNA, and a nanoparticle carrying both the Trop2 antibody and siRNA. Injecting 200uL (si003 is 1nmoL) into the caudal vein every other day, observing for about 3 weeks after injecting for 3 times, firstly carrying out eye vein blood sampling on each group of nude mice, detecting the liver and kidney functions of each group, then killing the nude mice by a neck pulling method, collecting the heart, liver, spleen, lung, kidney and other important organs of each group of nude mice, carrying out paraffin embedded section and pathological tissue staining, and finding that the important organs in each treatment group have no obvious damage, thereby indicating that the nano particles and the wrappage thereof have safety and are beneficial to the subsequent practical clinical application. FIG. 25 shows the liver and kidney function of nude mice treated with each set of nanoparticles; FIG. 26 shows the pathological tissue staining of the heart, liver, spleen, lung and kidney of nude mice treated with each group of nanoparticles. In the figure, siuc003 NPs represent the group of nanoparticles (Nano) carrying fluorochrome-labeled siRNA, and siuc003/Trop2 NPs represent the group of nanoparticles carrying both Trop2 antibody and fluorochrome siRNA. The PBS group, the pure nanomaterial group, and the group of nanoparticles loaded with Trop2 antibody alone all had no effect on organ tissues and are not shown in the figure.
It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the technical solutions of the present invention, and are not intended to limit the specific embodiments of the present invention. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention claims should be included in the protection scope of the present invention claims.
SEQUENCE LISTING
<110> grand era memorial Hospital of Zhongshan university
<120> tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1917
<212> DNA
<213> unknown
<400> 1
gagacggtac ccgcgcccca cagtccaccc gctcctcgga gtccccccgc gccccggagt 60
ccacccgcgc cccggagtcc acccgcgcag gtccacttct ccatccctgc tctcgacctc 120
cgcccctgcg gtgggggaag ttcctggggc ggtggctggg accaggccgg gttttaggcg 180
ggcgcagatt tccgggctaa ctttcctcgc cgtctcagcg cgggaagggg gaaatgggaa 240
acccgggcca gagcagcgga gcttcccagc cgcacacttc ctccctccag ccgtttgtct 300
cggcagggga gggcccaggc agccaagccg gcaggcccac tggttatccg accttgtgct 360
ctggccgtgg gtggagacct tacatccagc tcagagcgcc tcctcccatc ccctgtgtcc 420
tctaggcctc cccagacttt gccttttagc cttccagtga aacaagttct gtatccaaga 480
tatacaatta agtggacaaa gcagattgca gaaagtcttt tcgtagctca caaggggaca 540
tcaaagatga caaagaggag tggaagaaga cagagagaat caatgtgagg agcctggaac 600
agggctctga attgtcttcc cgcagtgaaa tcacttgtct attgctgagc caagaatttg 660
actctgagca tctaggatga gaaagaagaa ctggcaccta cgccatctct gcccctcggg 720
actgactatt ttggcccagt ttcctcaaca atgaaatggg actaattatc ccaggtcaca 780
cttctctctg ggcttaccct gggaatcaga tgattgagct ttggatctca ctctgttgcc 840
caggctggaa tgcagtgata cgatcatgat tcactgcagc ctcaaactcc tgggttcaag 900
taaccctccc acctcagctt tctgagtaac tgggactaca gaatgcccca ccccacttag 960
tccatagtga tgcccacctg tggttaatgg agctgaggct gctggaccaa agggaggaag 1020
tctgttaggc atatgtggaa cccaaaagag gaacttcatc aactgtcatg gacagctctg 1080
ccactttgtg accctgtgga ctttttggga agtgtttttg tggttcacca gtctctcatt 1140
aggcaaggcc atttgtcctg ggttggtctt cttcattggt ggaaagtaca gctgggagat 1200
ttggaatggt tgcagattga cttgactctc ataaggaact gccaccatga gcttttgggg 1260
aaagacctca agctgtggtg tgttgctgag gattgtggga ttcctccaaa tcttggggaa 1320
cattttgagt catcactggc agcagatttc tgttgacaac ttgagcaact tcagaatgaa 1380
gaagccatct tcatctctca catgaatatg actttgggta aatcatctcg aaatctgaac 1440
ccatggttgt gatccacact cctcctgagt tctgattttt agtgtaacct ttttcttctc 1500
attttttctt ctttgtgcat ctcttaagga ggtttttaaa atctcataat taaaaaattt 1560
atttcttcaa aactttttat tttgaaatca ctgtaaattc acatacattt gtataaaatg 1620
ccacagaaaa atcctgtgtg ccttttactc agtttattct aatgataaca tccttaaaga 1680
gatttaaaaa ttactgagat ataattgaaa tatgagaaaa ttcactcttt tatgcattta 1740
aatatccttt atgttttttc atagcttatt agctcatttc ttttcagtgc tgaataattc 1800
ttaattgtct ggatatacca tagcttattt atccattcac gtattgaagg atgttctagt 1860
gcttttaagt tttggcaatt atgaataaag ctgctgtata cattcaaaaa aaaaaaa 1917
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
aucucccagc uguacuuuct t 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
ccaucuucau cucucacaut t 21
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
Claims (17)
1. A nanometer medicinal preparation comprises a main drug for treating tumor, a high molecular polymer PDSA coated on the main drug and decomposed in the presence of glutathione in cytoplasm, and a Trop2 antibody linked with PDSA and/or the main drug.
2. The nano-drug of claim 1, wherein the main drug is a siRNA molecule.
3. The nano-drug according to claim 2, wherein the siRNA silences the expression of a long non-coding RNA, wherein the nucleotide sequence of the long non-coding RNA is represented by SEQ ID No. 1.
4. The nano-drug according to claim 3, wherein the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID No.2, and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID No. 3; or, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.4, and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 5.
5. Use of the nano-drug of any one of claims 1-2 in preparation of a medicament for treating tumors over-expressing Trop 2.
6. Use of the nano-drug of any one of claims 1 to 4 in the preparation of a medicament for the treatment of breast cancer.
7. The use according to claim 6, wherein the breast cancer is triple negative breast cancer.
8. The use according to claim 7, wherein the medicament for treating breast cancer is a medicament for inhibiting invasive metastasis of triple negative breast cancer.
9. A pharmaceutical composition comprising the nano-drug according to any one of claims 1 to 4.
10. A method for preparing a nano-drug according to any one of claims 1 to 4, comprising the steps of:
s1, adding cystine dimethyl ester hydrochloride into a mixed solution of fatty diacid and triethylamine to synthesize a PDSA high molecular polymer;
s2, preparing polyethylene glycol modified phospholipid (PEG-lipid) and polyethylene glycol-succinimide ester solution (PEG-NHS) capable of being specifically connected with the Trop2 antibody;
s3, preparing the Trop2 antibody-loaded primary drug-loaded PDSA nano-drug by using the PDSA solution, the PEG-lipid solution, the PEG-NHS solution, the primary drug solution and the Trop2 antibody based on a nano-precipitation method.
11. The application of long-chain non-coding RNA in preparing a medicament for diagnosing and treating triple-negative breast cancer is disclosed, wherein the nucleotide sequence of the long-chain non-coding RNA is shown as SEQ ID No. 1.
12. The application of an inhibitor in preparing a medicament for treating triple negative breast cancer inhibits the expression of a long-chain non-coding RNA gene, and the nucleotide sequence of the long-chain non-coding RNA is shown as SEQ ID No. 1.
13. The use according to claim 12, wherein the medicament for treating triple negative breast cancer is a medicament for inhibiting invasive metastasis of triple negative breast cancer.
14. The use according to claim 12, wherein the inhibitor is an siRNA molecule.
15. The use according to claim 14, wherein the nucleotide sequence of the sense strand of the siRNA is represented by SEQ ID No.2, and the nucleotide sequence of the antisense strand of the siRNA is represented by SEQ ID No. 3; or, the nucleotide sequence of the sense strand of the siRNA is shown as SEQ ID NO.4, and the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO. 5.
16. A pharmaceutical composition is characterized by comprising an inhibitor for inhibiting the gene expression of a long-chain non-coding RNA, wherein the nucleotide sequence of the long-chain non-coding RNA is shown as SEQ ID No. 1.
17. The pharmaceutical composition of claim 16, further comprising a nanoparticle carrier, wherein the inhibitor is an siRNA molecule, the nanoparticle carrier comprises PDSA and Trop2 antibody, PDSA is coated outside the inhibitor, and Trop2 antibody is linked to PDSA and/or the inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011112535.XA CN113171469B (en) | 2020-10-16 | 2020-10-16 | Tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011112535.XA CN113171469B (en) | 2020-10-16 | 2020-10-16 | Tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113171469A true CN113171469A (en) | 2021-07-27 |
| CN113171469B CN113171469B (en) | 2022-06-14 |
Family
ID=76921541
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011112535.XA Active CN113171469B (en) | 2020-10-16 | 2020-10-16 | Tumor treatment nano-drug targeting tumor cell surface Trop2 protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113171469B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108601841A (en) * | 2016-02-10 | 2018-09-28 | 免疫医疗公司 | The combination of ABCG2 inhibitor and SACITUZUMAB GOVITECAN (IMMU-132) overcome the resistance to SN-38 in the cancer for expressing TROP-2 |
| US20190117799A1 (en) * | 2016-04-01 | 2019-04-25 | The Brigham And Women's Hospital, Inc. | Stimuli-responsive nanoparticles for biomedical applications |
| CN110392570A (en) * | 2017-03-27 | 2019-10-29 | 免疫医疗公司 | With husky trastuzumab lattice dimension for the triple negative breast cancer of health and RAD51 inhibitor for treating expression TROP-2 |
| CN111087471A (en) * | 2017-08-11 | 2020-05-01 | 百奥泰生物制药股份有限公司 | Compounds and methods for treatment of Trop2 positive diseases |
-
2020
- 2020-10-16 CN CN202011112535.XA patent/CN113171469B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108601841A (en) * | 2016-02-10 | 2018-09-28 | 免疫医疗公司 | The combination of ABCG2 inhibitor and SACITUZUMAB GOVITECAN (IMMU-132) overcome the resistance to SN-38 in the cancer for expressing TROP-2 |
| US20190117799A1 (en) * | 2016-04-01 | 2019-04-25 | The Brigham And Women's Hospital, Inc. | Stimuli-responsive nanoparticles for biomedical applications |
| CN110392570A (en) * | 2017-03-27 | 2019-10-29 | 免疫医疗公司 | With husky trastuzumab lattice dimension for the triple negative breast cancer of health and RAD51 inhibitor for treating expression TROP-2 |
| CN111087471A (en) * | 2017-08-11 | 2020-05-01 | 百奥泰生物制药股份有限公司 | Compounds and methods for treatment of Trop2 positive diseases |
Non-Patent Citations (1)
| Title |
|---|
| 蒋小华等: "Trop2靶向药物在肿瘤治疗中的前景", 《中国细胞生物学学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113171469B (en) | 2022-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xue et al. | Gold nanoparticles delivered miR-375 for treatment of hepatocellular carcinoma | |
| Wang et al. | Barbaloin loaded polydopamine-polylactide-TPGS (PLA-TPGS) nanoparticles against gastric cancer as a targeted drug delivery system: Studies in vitro and in vivo | |
| EP2860193B1 (en) | Polypeptide with function of targeted diagnosis and therapy of nasopharyngeal carcinoma, nanoparticles carrying same and use thereof | |
| CN107184987B (en) | Lipoic acid modified targeted integrin alpha v beta 3 nano-polypeptide carrier and preparation method and application thereof | |
| Xu et al. | Co-delivery of 5-fluorouracil and miRNA-34a mimics by host-guest self-assembly nanocarriers for efficacious targeted therapy in colorectal cancer patient-derived tumor xenografts | |
| Wang et al. | Dual‐targeting heparin‐based nanoparticles that re‐assemble in blood for glioma therapy through both anti‐proliferation and anti‐angiogenesis | |
| Li et al. | A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells | |
| CN109762821B (en) | Interfering RNA for inhibiting expression of AFAP1-AS1 and application of interfering RNA in increasing sensitivity of breast cancer radiotherapy | |
| Wu et al. | Biocompatible AIEgen/p-glycoprotein siRNA@ reduction-sensitive paclitaxel polymeric prodrug nanoparticles for overcoming chemotherapy resistance in ovarian cancer | |
| Shang et al. | Enhancing cancer chemo-immunotherapy by biomimetic nanogel with tumor targeting capacity and rapid drug-releasing in tumor microenvironment | |
| CN109381705A (en) | Reversible crosslink Biodegradable polymer vesicles and preparation method thereof with asymmetric membrane structure | |
| Yang et al. | GSH/pH Dual Activatable Cross‐linked and Fluorinated PEI for Cancer Gene Therapy Through Endogenous Iron De‐Hijacking and in Situ ROS Amplification | |
| CN110229323A (en) | The polymer vesicle with asymmetric membrane structure for restoring sensitive reversible crosslink and its application in preparation treatment liver-cancer medicine | |
| Wang et al. | Polyethylene glycol–poly (ε-benzyloxycarbonyl-L-lysine)-conjugated VEGF siRNA for antiangiogenic gene therapy in hepatocellular carcinoma | |
| Bai et al. | CXCR4 and CD44 dual-targeted Prussian blue nanosystem with daunorubicin loaded for acute myeloid leukemia therapy | |
| Faria et al. | Liposomal paclitaxel induces apoptosis, cell death, inhibition of migration capacity and antitumoral activity in ovarian cancer | |
| Shesh et al. | A novel view of ferritin in cancer | |
| Shao et al. | Tumor-triggered personalized microRNA cocktail therapy for hepatocellular carcinoma | |
| Yuan et al. | Reshaping hypoxia and silencing CD73 via biomimetic gelatin nanotherapeutics to boost immunotherapy | |
| Zhong et al. | Co-delivery of sorafenib and crizotinib encapsulated with polymeric nanoparticles for the treatment of in vivo lung cancer animal model | |
| Liu et al. | Biomimetic multifunctional nanodrugs enable regulating abnormal tumor metabolism and amplifying PDT-induced immunotherapy for synergistically enhanced tumor ablation | |
| Hyldbakk et al. | Intraperitoneal administration of cabazitaxel-loaded nanoparticles in peritoneal metastasis models | |
| CN108126210A (en) | A kind of application of single targeting reduction response vesica Nano medication in treatment of brain tumor drug is prepared | |
| Zhang et al. | Poly-antioxidants for enhanced anti-miR-155 delivery and synergistic therapy of metastatic breast cancer | |
| Gulia et al. | Physiological Pathway, diagnosis and nanotechnology based treatment strategies for ovarian Cancer: A review |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |