CN113151491A - Method and kit for rapidly identifying Rongchang pork - Google Patents
Method and kit for rapidly identifying Rongchang pork Download PDFInfo
- Publication number
- CN113151491A CN113151491A CN202110241217.1A CN202110241217A CN113151491A CN 113151491 A CN113151491 A CN 113151491A CN 202110241217 A CN202110241217 A CN 202110241217A CN 113151491 A CN113151491 A CN 113151491A
- Authority
- CN
- China
- Prior art keywords
- pork
- rongchang
- primer
- competitive
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000015277 pork Nutrition 0.000 title claims abstract description 49
- 238000000034 method Methods 0.000 title claims abstract description 24
- 230000002860 competitive effect Effects 0.000 claims abstract description 29
- 238000012408 PCR amplification Methods 0.000 claims abstract description 17
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 10
- 239000012634 fragment Substances 0.000 claims abstract description 9
- 230000035772 mutation Effects 0.000 claims abstract description 9
- 238000011144 upstream manufacturing Methods 0.000 claims description 12
- 238000006243 chemical reaction Methods 0.000 claims description 9
- 230000003321 amplification Effects 0.000 claims description 6
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 6
- 239000002773 nucleotide Substances 0.000 claims description 6
- 125000003729 nucleotide group Chemical group 0.000 claims description 6
- 230000004544 DNA amplification Effects 0.000 claims description 4
- 238000001514 detection method Methods 0.000 claims description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 3
- 239000000872 buffer Substances 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 102000003960 Ligases Human genes 0.000 claims description 2
- 108090000364 Ligases Proteins 0.000 claims description 2
- 235000006439 Lemna minor Nutrition 0.000 abstract description 4
- 244000242291 Lemna paucicostata Species 0.000 abstract description 4
- 235000013364 duck meat Nutrition 0.000 abstract description 4
- 244000068988 Glycine max Species 0.000 abstract description 3
- 235000010469 Glycine max Nutrition 0.000 abstract description 3
- 235000013330 chicken meat Nutrition 0.000 abstract description 3
- 241001465754 Metazoa Species 0.000 abstract description 2
- 239000000243 solution Substances 0.000 description 4
- 241000282887 Suidae Species 0.000 description 3
- 241000282898 Sus scrofa Species 0.000 description 3
- 235000013372 meat Nutrition 0.000 description 3
- 238000010009 beating Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 235000015167 meat floss Nutrition 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 241001107116 Castanospermum australe Species 0.000 description 1
- 241000252230 Ctenopharyngodon idella Species 0.000 description 1
- 241000287828 Gallus gallus Species 0.000 description 1
- 235000010627 Phaseolus vulgaris Nutrition 0.000 description 1
- 244000046052 Phaseolus vulgaris Species 0.000 description 1
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 1
- 235000019764 Soybean Meal Nutrition 0.000 description 1
- 240000004922 Vigna radiata Species 0.000 description 1
- 235000010721 Vigna radiata var radiata Nutrition 0.000 description 1
- 235000011469 Vigna radiata var sublobata Nutrition 0.000 description 1
- 235000015278 beef Nutrition 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 235000021279 black bean Nutrition 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 235000021374 legumes Nutrition 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000004570 mortar (masonry) Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 244000144977 poultry Species 0.000 description 1
- 235000013594 poultry meat Nutrition 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 239000004455 soybean meal Substances 0.000 description 1
- 238000010186 staining Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology application, and particularly relates to a method and a kit for rapidly identifying Changrong pork. The method is to detect the high-frequency G/A mutation on the miRNA-182 gene of the Rongchang pork by competitive PCR amplification, and the obtained products are two fragments with different sizes so as to identify the truth of the Rongchang pork. The identification method of the invention is a high-efficiency specificity method aiming at identifying the truth of Rongchang pork, can accurately identify fake Rongchang pork or pork products fake by using other animal-derived components such as duck meat, chicken meat and the like or soybean components, has convenient, rapid and accurate operation, and is convenient for rapid identification of fake brand pork by basic supervision departments and enterprises.
Description
Technical Field
The invention belongs to the technical field of molecular biology application, and particularly relates to a method and a kit for rapidly identifying Changrong pork.
Background
Rongchang pigs are one of the improved varieties in three places in China, and are listed as key protection varieties of national-grade livestock and poultry. The Rongchang pork has good quality and high commercial value, and is popular with consumers. Due to the large fluctuation of the price of pork in China, particularly the price of high-quality pork which takes local pigs as raw materials is continuously increased, and the phenomenon of pork adulteration in the market is also endless. Some bad vendors use cheap duck meat to impersonate streaky pork. Some bad merchants add a large amount of essence into soybean meal to prepare meat floss, and the meat floss is sold as pure pork. The common pork is often used to serve brand pork with good quality. For a long time, a detection technical method for identifying the authenticity of Changlong pork is lacked in the market, and necessary technical support is lacked in market supervision and management.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a method for rapidly identifying Rongchang pork, and another object of the present invention is to provide a kit for rapidly identifying Rongchang pork.
In order to achieve the purpose, the invention provides the following technical scheme:
1. a method for rapidly identifying Rongchang pork is characterized in that high-frequency G/A mutation on a Rongchang pork miRNA-182 gene is identified through a gene amplification technology, and the Rongchang pork miRNA-182 gene sequence is SEQ ID NO. 1.
As one of the preferred technical schemes, the gene amplification technology is competitive PCR amplification.
As one of the preferable technical schemes, the primers used for the competitive PCR amplification comprise 1 universal upstream primer and 2 competitive downstream primers.
As one of the preferred technical schemes, the products of the competitive PCR amplification are two fragments with different sizes.
As one of the preferable technical proposal, the nucleotide sequence of the universal upstream primer is SEQ ID NO.2, the nucleotide sequence of the inner primer in the competitive downstream primer is SEQ ID NO.3, and the nucleotide sequence of the outer primer is SEQ ID NO. 4.
As one of the preferred technical schemes, the competitive PCR amplification comprises the following steps:
1) preparing a DNA sample of a sample to be detected as an amplification template;
2) performing competitive PCR amplification using the primers of claim 5;
3) after the PCR reaction is finished, agarose gel electrophoresis detection is directly carried out, the product fragments of 182bp and 295bp are Rongchang pork, the product fragments of 295bp are common pork, and the product fragments without any positive product bands are non-pork samples.
As one of the preferable technical schemes, the competitive PCR amplification system is as follows: ddH2O16.375. mu.l, universal upstream primer 1. mu.l, downstream inner primer 1.5. mu.l, downstream outer primer 0.5. mu.l, 10 XTaq Buffer 2.5. mu.l, dNTP Mix (5U/. mu.l) 2. mu.l, Takarar Taq (5U/. mu.l) 0.125. mu.l, amplification template 1. mu.l, 25. mu.l total.
As one of the preferable technical schemes, the competitive PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; 45s at 94 ℃, 45s at 58 ℃ and 1min at 72 ℃ for 33 cycles; finally, extension is carried out for 10min at 72 ℃.
2. A kit for rapidly identifying Rongchang pork comprises the universal upstream primer and a competitive downstream primer.
As one of the preferable technical schemes, the kit also comprises dNTP, ligase and corresponding buffer solution.
The invention has the beneficial effects that:
the identification method of the invention is a high-efficiency specificity method aiming at identifying the truth of Rongchang pork, can accurately identify fake Rongchang pork or pork products fake by using other animal-derived components such as duck meat, chicken meat and the like or soybean components, has convenient, rapid and accurate operation, and is convenient for rapid identification of fake brand pork by basic supervision departments and enterprises.
Drawings
FIG. 1 is a schematic diagram of the principle of competitive PCR.
FIG. 2 is a diagram showing the results of competitive PCR detection of amplification specificity. Lane M is DNAmarker DL 2000; lanes 1-2 are Rongchang pork; lanes 3-4 are Enshi black pork; lanes 5-6 white pork; lanes 7-8 are chicken; lanes 9-10 are duck meat; lanes 11-12 are grass carp meat; lanes 13-14 are beef; lanes 15-16 are mutton; lanes 17-18 are soybean; lanes 19-20 are mung bean; lanes 21-22 are black beans; lanes 23-24 are negative controls without template.
Detailed Description
The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Example 1
1. Principle of competitive PCR amplification
The competitive PCR amplification principle is shown in figure 1, and the complete genome sequence of Rongchang pig at NCBI is analyzed to find that the miRNA-182 gene sequence (SEQ ID NO.1) of Rongchang pig has high-frequency G/A mutation, and the site is relatively highly conserved in other pig species. Therefore, a universal upstream primer and a competitive downstream outer primer are respectively designed aiming at the upstream and downstream sequences of the miRNA-182 gene of Rongchang pigs, and a mismatch A is artificially introduced at the 3' terminal-3 site of the downstream outer primer. And aiming at the high-frequency mutation site G → A on the Rongchang miRNA-182 gene, 1 competitive downstream inner primer is designed, the 3 'terminal T of the inner primer is complementary with the mutation site A, and a mismatch A is artificially introduced at the 3' terminal-2 site of the inner primer.
miRNA-182 gene sequence: underlined bold for G → A mutation sites
TCGCACCGTTTTTGGCAATGGTAGAACTCACACTGGTGAGATAATGGGATCCGGTG GTTCTAGACTTGCCAACTATGGTGCGAG(SEQ ID NO.1)；
An upstream primer RC-F: 5'TAACTGTCGCTGCCTCTTCT 3' (SEQ ID NO. 2);
the downstream inner primer RC-N: 5'GCAGAGTTGCTTGCTGAGCCATT 3' (SEQ ID NO. 3);
the downstream outer primer RC-W: 5'ACTGTGTGTCACTTCCAGATGC 3' (SEQ ID NO. 4);
PCR reactions initiated by the upstream and downstream inner primers yielded 182bp products. The PCR reaction initiated by the upstream primer and the downstream outer primer can produce a 295bp product. Rongchang pork can be combined with inner and outer primers simultaneously to generate 2 PCR products because of having miRNA-182 gene high-frequency mutation site G → A. And other types of pork can only be specifically combined with the outer primer due to the absence of the mutation site, so that a 295bp product is generated. The non-pork samples did not produce any PCR products.
2. Competitive PCR amplification
Cutting meat sample into small pieces, placing into homogenizing bag, adding normal saline, and beating with beating type homogenizer for 5-8 min. The legume samples were ground to a fine powder on ice with a mortar. A DNA sample of a sample extracted by a commercial kit is used as an amplification template, and a competitive PCR amplification system comprises the following steps:
the reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; 45s at 94 ℃, 45s at 58 ℃ and 1min at 72 ℃ for 33 cycles; finally, extension is carried out for 10min at 72 ℃. After the reaction, 5. mu.L of the reaction solution was subjected to 1.5% agarose gel electrophoresis, and Goldview was added to the gel for staining. And after the electrophoresis is finished, observing and photographing under an ultraviolet projector.
As shown in FIG. 2, only Rongchang pork amplified 2 PCR products, other pork amplified one PCR product, and none of the other meat and bean samples. The result shows that the method has good specificity for detecting and distinguishing Rongchang pork.
Finally, the above embodiments are only intended to illustrate the technical solutions of the present invention and not to limit the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions, and all of them should be covered by the claims of the present invention.
Sequence listing
<110> institute of zootechnics in Chongqing City
Wuhan University of Light Industry
<120> method and kit for rapidly identifying Rongchang pork
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 84
<212> DNA
<213> native Sequence (Natural Sequence)
<400> 1
tcgcaccgtt tttggcaatg gtagaactca cactggtgag ataatgggat ccggtggttc 60
tagacttgcc aactatggtg cgag 84
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcagagttgc ttgctgagcc att 23
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
actgtgtgtc acttccagat gc 22
Claims (10)
1. The method for rapidly identifying Rongchang pork is characterized in that the method is used for detecting high-frequency G/A mutation on Rongchang pork miRNA-182 gene by gene amplification technology, wherein the Rongchang pork miRNA-182 gene sequence is SEQ ID NO. 1.
2. The method of claim 1, wherein the gene amplification technique is competitive PCR amplification.
3. The method of claim 2, wherein the primers used for competitive PCR amplification comprise 1 universal forward primer and 2 competitive reverse primers.
4. The method of claim 2 or 3, wherein the products of the competitive PCR amplification are two fragments of different sizes.
5. The method of claim 3, wherein the nucleotide sequence of the universal upstream primer is SEQ ID No.2, the nucleotide sequence of the inner primer of the competitive downstream primer is SEQ ID No.3, and the nucleotide sequence of the outer primer is SEQ ID No. 4.
6. The method of claim 5, wherein the competitive PCR amplification comprises the steps of:
1) preparing a DNA sample of a sample to be detected as an amplification template;
2) performing competitive PCR amplification using the primers of claim 5;
3) after the PCR reaction is finished, agarose gel electrophoresis detection is directly carried out, the product fragments of 182bp and 295bp are Rongchang pork, the product fragments of 295bp are common pork, and the product fragments without any positive product bands are non-pork samples.
7. The method of claim 6, wherein the competitive PCR amplification system is: ddH2O16.375. mu.l, universal upstream primer 1. mu.l, downstream inner primer 1.5. mu.l, downstream outer primer 0.5. mu.l, 10 XTaq Buffer 2.5. mu.l, dNTPmix (5U/. mu.l) 2. mu.l, Takarar Taq (5U/. mu.l) 0.125. mu.l, amplification template 1. mu.l, 25. mu.l total.
8. The method of claim 6, wherein the competitive PCR reaction conditions are: pre-denaturation at 94 ℃ for 5 min; 45s at 94 ℃, 45s at 58 ℃ and 1min at 72 ℃ for 33 cycles; finally, extension is carried out for 10min at 72 ℃.
9. A kit for rapidly identifying Rongchang pork, which comprises the universal upstream primer and the competitive downstream primer in claim 5.
10. The kit of claim 9, wherein the kit further comprises dntps, ligase, and a corresponding buffer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110241217.1A CN113151491A (en) | 2021-03-04 | 2021-03-04 | Method and kit for rapidly identifying Rongchang pork |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110241217.1A CN113151491A (en) | 2021-03-04 | 2021-03-04 | Method and kit for rapidly identifying Rongchang pork |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113151491A true CN113151491A (en) | 2021-07-23 |
Family
ID=76884399
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110241217.1A Pending CN113151491A (en) | 2021-03-04 | 2021-03-04 | Method and kit for rapidly identifying Rongchang pork |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151491A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050266418A1 (en) * | 2004-05-28 | 2005-12-01 | Applera Corporation | Methods, compositions, and kits comprising linker probes for quantifying polynucleotides |
| US20070031843A1 (en) * | 2004-04-02 | 2007-02-08 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory bacterial and bacterial associated oligonucleotides and uses thereof |
| CN101805800A (en) * | 2010-04-21 | 2010-08-18 | 中国农业大学 | Method for distinguishing indigenous pig breed in China from indigenous pig breed in Europe |
| CN106987651A (en) * | 2017-06-07 | 2017-07-28 | 中南大学湘雅二医院 | Diagnosis of glaucoma molecular marked compound lncRNAsNR_026887, kit and application |
| CN107586857A (en) * | 2017-10-26 | 2018-01-16 | 重庆市畜牧科学院 | Nucleic acid, kit and method for the red-black coat color gene of Rapid identification pig |
-
2021
- 2021-03-04 CN CN202110241217.1A patent/CN113151491A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070031843A1 (en) * | 2004-04-02 | 2007-02-08 | Rosetta Genomics | Bioinformatically detectable group of novel regulatory bacterial and bacterial associated oligonucleotides and uses thereof |
| US20050266418A1 (en) * | 2004-05-28 | 2005-12-01 | Applera Corporation | Methods, compositions, and kits comprising linker probes for quantifying polynucleotides |
| CN101805800A (en) * | 2010-04-21 | 2010-08-18 | 中国农业大学 | Method for distinguishing indigenous pig breed in China from indigenous pig breed in Europe |
| CN106987651A (en) * | 2017-06-07 | 2017-07-28 | 中南大学湘雅二医院 | Diagnosis of glaucoma molecular marked compound lncRNAsNR_026887, kit and application |
| CN107586857A (en) * | 2017-10-26 | 2018-01-16 | 重庆市畜牧科学院 | Nucleic acid, kit and method for the red-black coat color gene of Rapid identification pig |
Non-Patent Citations (3)
| Title |
|---|
| GUOXI LI等: ""MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"", 《JOURNAL OF CELLULAR BIOCHEMISTRY》 * |
| 冉茂良等: ""猪microRNA组学研究进展"", 《遗传》 * |
| 龙熙等: ""荣昌猪miR-182基因序列多态性分析"", 《中国畜牧杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110106261B (en) | SNP marker combination and identification method of Jiaxing black pig and raw meat product | |
| CN110106262B (en) | SNP marker combination and identification method of Zhongmeishan pigs and raw meat products | |
| CN108624659A (en) | A kind of real time quantitative PCR method of detection meat product ingredient | |
| CN114908176B (en) | Molecular marker related to chicken carcass and growth traits and application thereof | |
| CN104099405A (en) | PCR (polymerase chain reaction) detection method and kit for one-time identification of mutton, chicken, duck and pork | |
| CN113481306B (en) | Method for rapidly detecting 13 longli fish-derived components by using real-time fluorescence PCR (polymerase chain reaction) means | |
| CN109136387A (en) | A kind of molecular labeling primer and method identifying foxiness Yong and India Yong | |
| Hubalkova et al. | Identification of gadoid species in fish meat by polymerase chain reaction (PCR) on genomic DNA | |
| CN101962677A (en) | Method for identifying poultry gender | |
| Silva et al. | PCR cloning combined with DNA barcoding enables partial identification of fish species in a mixed-species product | |
| CN102312003A (en) | PCR primer pair for identifying or assisting identification of animal tissue / or organ and application thereof | |
| CN102242220B (en) | Polymerase chain reaction (PCR) primer pair for identifying or assisting in identifying duck tissues and/or organs and application of PCR primer pair | |
| CN107345250B (en) | PCR amplification identification method and special primer for quail meat source components based on 16SrRNA | |
| CN113151491A (en) | Method and kit for rapidly identifying Rongchang pork | |
| CN110106263B (en) | SNP marker combination and identification method of Pudong white pig and raw meat product | |
| CN110241226B (en) | SNP marker combination and identification method for various varieties of local variety breeding pigs in Taihu lake basin and raw meat products | |
| CN113293216A (en) | Identification method for animal-derived components in salmonidae products based on high-throughput sequencing | |
| CN110042168B (en) | Primer pair, kit and method for distinguishing brachymystax lenok from hucho taimen | |
| CN102559874A (en) | Polymerase chain reaction (PCR) authenticating method for sashimi of blue-fin tunas, bigeye tunas and yellow-fin tunas | |
| CN102312011A (en) | PCR primer pair for identification or auxiliary identification of tissues and/or organs of mouse and applications thereof | |
| CN110157813B (en) | SNP marker combination and identification method for Sanwu pigs and raw meat products | |
| CN106811534B (en) | Detection primer, method and kit for detecting multiple meat-derived components at one time | |
| CN112921105B (en) | Primer, kit and detection method for identifying carcasses of silky fowl and black-bone chicken | |
| CN112795663B (en) | Primer pair composition, kit and method for distinguishing cyprinus carpio from non-cyprinus carpio | |
| CN108841944A (en) | The method for identifying molecules that raw material fish forms in fish meal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210723 |