CN113151413A - MicroRNA detection kit with calibration function - Google Patents
MicroRNA detection kit with calibration function Download PDFInfo
- Publication number
- CN113151413A CN113151413A CN202110467757.1A CN202110467757A CN113151413A CN 113151413 A CN113151413 A CN 113151413A CN 202110467757 A CN202110467757 A CN 202110467757A CN 113151413 A CN113151413 A CN 113151413A
- Authority
- CN
- China
- Prior art keywords
- hsa
- mir
- artificial sequence
- microrna
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 69
- 108700011259 MicroRNAs Proteins 0.000 title claims abstract description 51
- 239000002679 microRNA Substances 0.000 claims abstract description 36
- 102000004190 Enzymes Human genes 0.000 claims abstract description 26
- 108090000790 Enzymes Proteins 0.000 claims abstract description 26
- 239000013558 reference substance Substances 0.000 claims abstract description 24
- 239000012295 chemical reaction liquid Substances 0.000 claims abstract description 10
- 210000002966 serum Anatomy 0.000 claims abstract description 9
- 238000003908 quality control method Methods 0.000 claims description 25
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 20
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 16
- 239000000126 substance Substances 0.000 claims description 8
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 6
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 6
- 102100034343 Integrase Human genes 0.000 claims description 6
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims description 6
- 208000005718 Stomach Neoplasms Diseases 0.000 claims description 6
- 230000008014 freezing Effects 0.000 claims description 6
- 238000007710 freezing Methods 0.000 claims description 6
- 206010017758 gastric cancer Diseases 0.000 claims description 6
- 239000011148 porous material Substances 0.000 claims description 6
- 201000011549 stomach cancer Diseases 0.000 claims description 6
- 239000000843 powder Substances 0.000 claims description 5
- 238000010257 thawing Methods 0.000 claims description 4
- 108091068855 Homo sapiens miR-103a-1 stem-loop Proteins 0.000 claims description 3
- 108091068838 Homo sapiens miR-103a-2 stem-loop Proteins 0.000 claims description 3
- 108091069085 Homo sapiens miR-126 stem-loop Proteins 0.000 claims description 3
- 108091069017 Homo sapiens miR-140 stem-loop Proteins 0.000 claims description 3
- 108091068993 Homo sapiens miR-142 stem-loop Proteins 0.000 claims description 3
- 108091067469 Homo sapiens miR-181a-1 stem-loop Proteins 0.000 claims description 3
- 108091067618 Homo sapiens miR-181a-2 stem-loop Proteins 0.000 claims description 3
- 108091067605 Homo sapiens miR-183 stem-loop Proteins 0.000 claims description 3
- 108091070493 Homo sapiens miR-21 stem-loop Proteins 0.000 claims description 3
- 108091065168 Homo sapiens miR-29c stem-loop Proteins 0.000 claims description 3
- 108091065436 Homo sapiens miR-30e stem-loop Proteins 0.000 claims description 3
- 108091066899 Homo sapiens miR-340 stem-loop Proteins 0.000 claims description 3
- 108091032108 Homo sapiens miR-424 stem-loop Proteins 0.000 claims description 3
- 108091070377 Homo sapiens miR-93 stem-loop Proteins 0.000 claims description 3
- 108091008065 MIR21 Proteins 0.000 claims description 3
- 239000000463 material Substances 0.000 claims 1
- 239000002994 raw material Substances 0.000 abstract description 8
- 230000008859 change Effects 0.000 abstract description 7
- 230000004888 barrier function Effects 0.000 abstract description 3
- 238000011161 development Methods 0.000 abstract description 3
- 238000005516 engineering process Methods 0.000 abstract description 3
- 230000005856 abnormality Effects 0.000 abstract description 2
- 238000003757 reverse transcription PCR Methods 0.000 abstract description 2
- 239000000243 solution Substances 0.000 description 29
- 239000000523 sample Substances 0.000 description 19
- 238000010839 reverse transcription Methods 0.000 description 15
- 108090000623 proteins and genes Proteins 0.000 description 13
- 238000012360 testing method Methods 0.000 description 12
- 238000000034 method Methods 0.000 description 10
- 238000002156 mixing Methods 0.000 description 9
- 238000002360 preparation method Methods 0.000 description 7
- 238000012408 PCR amplification Methods 0.000 description 6
- 239000003153 chemical reaction reagent Substances 0.000 description 6
- 238000007789 sealing Methods 0.000 description 6
- 238000002474 experimental method Methods 0.000 description 5
- 239000007788 liquid Substances 0.000 description 5
- 206010028980 Neoplasm Diseases 0.000 description 4
- XAGFODPZIPBFFR-UHFFFAOYSA-N aluminium Chemical compound [Al] XAGFODPZIPBFFR-UHFFFAOYSA-N 0.000 description 4
- 229910052782 aluminium Inorganic materials 0.000 description 4
- 238000001035 drying Methods 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 239000011888 foil Substances 0.000 description 4
- 230000014509 gene expression Effects 0.000 description 4
- 238000000636 Northern blotting Methods 0.000 description 3
- 108091034117 Oligonucleotide Proteins 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 230000001404 mediated effect Effects 0.000 description 3
- 108091070501 miRNA Proteins 0.000 description 3
- 238000004806 packaging method and process Methods 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000003753 real-time PCR Methods 0.000 description 3
- 102000043276 Oncogene Human genes 0.000 description 2
- 108700020796 Oncogene Proteins 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 201000011510 cancer Diseases 0.000 description 2
- 238000007405 data analysis Methods 0.000 description 2
- 238000007865 diluting Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000011049 filling Methods 0.000 description 2
- 230000002401 inhibitory effect Effects 0.000 description 2
- 238000002372 labelling Methods 0.000 description 2
- 238000013507 mapping Methods 0.000 description 2
- 238000002844 melting Methods 0.000 description 2
- 230000008018 melting Effects 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000002904 solvent Substances 0.000 description 2
- 238000012546 transfer Methods 0.000 description 2
- 101150066838 12 gene Proteins 0.000 description 1
- 108091070521 Homo sapiens let-7a-1 stem-loop Proteins 0.000 description 1
- 108091070522 Homo sapiens let-7a-2 stem-loop Proteins 0.000 description 1
- 108091070513 Homo sapiens let-7a-3 stem-loop Proteins 0.000 description 1
- 108091070491 Homo sapiens miR-16-1 stem-loop Proteins 0.000 description 1
- 108091068927 Homo sapiens miR-16-2 stem-loop Proteins 0.000 description 1
- 108091066985 Homo sapiens miR-335 stem-loop Proteins 0.000 description 1
- 108091066993 Homo sapiens miR-339 stem-loop Proteins 0.000 description 1
- 108091053841 Homo sapiens miR-483 stem-loop Proteins 0.000 description 1
- 108091053854 Homo sapiens miR-484 stem-loop Proteins 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000003149 assay kit Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000000090 biomarker Substances 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000009977 dual effect Effects 0.000 description 1
- 230000002431 foraging effect Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 238000000338 in vitro Methods 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 239000011259 mixed solution Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 239000013074 reference sample Substances 0.000 description 1
- 230000002441 reversible effect Effects 0.000 description 1
- 229920002477 rna polymer Polymers 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 239000000107 tumor biomarker Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a microRNA detection kit with a calibration function, which at least comprises RT reaction liquid, PCR reaction liquid, RT enzyme, PCR enzyme, a reference product, a blank control and a primer plate; the reference substance is mixed human serum stably expressed by microRNA after 2-4 times of freeze-thaw treatment. The kit disclosed by the invention can be used for simultaneously detecting various microRNAs by a fluorescent quantitative RT-PCR technology, reduces the detection difficulty by optimizing the kit, and is particularly suitable for multi-target high-flux rapid detection; through the establishment of the reference substance, the fluctuation caused by the factors such as raw material change, operation difference, equipment and the like is eliminated, the detection barrier is reduced, the abnormality of the detection result caused by the operation difference is avoided, and the market development of the kit depending on the microRNA detection is promoted.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a microRNA detection kit with a calibration function.
Background
micrornas are a class of single-stranded, non-coding RNA molecules of about 19-25 nucleotides in length that are typically targeted to one or more mrnas to regulate gene expression by inhibiting the translation process of a target gene. Current studies indicate that common cancers have associated altered microRNA expression and that microRNAs are usually localized to genomic regions associated with Cancer, and thus it is speculated that microRNAs may play a dual role in inhibiting oncogenes and oncogenes (Esquela-Kerscher, A.and Slack, F.J (2006) Nat Rev Cancer 6, 259-. Mature microRNAs and other proteins form miRNA-protein complexes, so that the microRNAs are very stable in vitro (Lu, J.et al., (2005) Nature 435,834 and 838; Lim, L.P.et al., (2005) Nature 433,769 and 773), have greater advantages than mRNA in serving as tumor biomarkers, and the proved abnormal expression of the microRNAs in cancers highlights the potential application value of the microRNAs serving as diagnosis and prognosis biomarkers.
The expression level of microRNA in different samples is greatly different, and the sequence is very short and homologous, which brings a challenge to the development of an ultra-sensitive detection method. At present, Northern blot and methods derived on the basis of the Northern blot are more detection methods, and the detection methods have the disadvantages of long detection process, relatively complex technology, relatively high requirement on the professional degree of detection personnel and unstable specificity level, so the application of the Northern blot is limited. And the extracted microRNA is not protected by protein, and is easily influenced by external factors, such as operator, equipment, experiment duration and reaction system, so that the detection result is not easily developed in a common laboratory, the difference of the operation detection results of different objects in the same sample is large, and the detection accuracy is seriously influenced.
Disclosure of Invention
The invention aims to provide a microRNA detection kit with a calibration function, which is used for simultaneously detecting various microRNAs by a fluorescent quantitative RT-PCR technology, reduces the detection difficulty by optimizing the kit, and is particularly suitable for multi-target high-flux rapid detection; through the establishment of the reference substance, the fluctuation caused by the factors such as raw material change, operation difference, equipment and the like is eliminated, the detection barrier is reduced, the abnormality of the detection result caused by the operation difference is avoided, and the market development of the kit depending on the microRNA detection is promoted.
The technical scheme adopted by the invention for solving the technical problems is as follows:
a microRNA detection kit with a calibration function at least comprises RT reaction liquid, PCR reaction liquid, RT enzyme, PCR enzyme, a reference substance, a blank control and a primer plate; the reference substance is mixed human serum stably expressed by microRNA after 2-4 times of freeze-thaw treatment.
The freezing temperature of the freeze-thaw treatment is-15 ℃ to-80 ℃.
The RT reaction solution comprises: 5 multiplied by 20% -45% of RT premix, 30-150nM specific RT primer, 1-4mM dNTP, 5-20mM MgCL2And the balance of nuclease-free water.
The PCR reaction solution contains: PCR premix 10X 20%, MgCL with concentration 2-8mM2And the balance of nuclease-free water.
The RT enzyme is reverse transcriptase; the PCR enzyme is DNA polymerase.
The blank was nuclease-free water.
The primer plate is a 384-pore plate or a 96-pore plate, and positive and negative primer dry powder for detecting a target is arranged on the primer plate.
The microRNA is unstable and difficult to detect due to the short and homologous sequence, has poor specificity and high requirement on the professional degree of detection personnel, is difficult to carry out detection work in a common laboratory, and limits the promotion of industrialization due to detection barriers. In addition, microRNA detection is easily influenced by a plurality of factors, the change of raw materials, personnel operation difference, equipment and the like can cause the fluctuation of a detection result, and the stability of a developed product can be influenced. If a plurality of microRNA targets need to be detected simultaneously, the detection process is more complex, the operation time is longer, the instability characteristic of the microRNA is more obvious, and more variables are added for accurate detection. According to the invention, the mixed human serum stably expressed by microRNA is used as a reference substance in the kit, when the microRNA contained in a sample is detected, the detection result fluctuates due to factors such as raw material change, operation difference and equipment, but the fluctuation of the sample is consistent with that of the reference substance, and the sample can be calibrated according to the fluctuation of the reference substance, so that the detection deviation of the sample is reduced. The introduction of the reference product calibrates the detection deviation caused by the factors such as personnel operation difference, raw material change, equipment and the like, and ensures that the detection result is relatively accurate. The primer plate is used, the operation is simple, the operation time is reduced, and the detection deviation is reduced. Multiple targets in a single reaction system synchronously carry out reverse transcription reaction, and the method is simple to operate and has strong specificity.
As a specific application mode, the invention provides a microRNA detection kit with a calibration function for gastric cancer detection, and the kit comprises RT reaction liquid, PCR reaction liquid, RT enzyme, PCR enzyme, a reference substance, a positive quality control substance, a negative quality control substance, a blank control and a primer plate;
the RT reaction solution comprises: 5 multiplied by 20% -45% of RT premix, 12 target-specific RT primers with the concentration of 30-150nM, dNTP with the concentration of 1-4mM and MgCL with the concentration of 5-20mM2The balance of nuclease-free water;
the PCR reaction solution contains: PCR premix 10X 20%, MgCL with concentration 2-8mM2The balance of nuclease-free water;
the RT enzyme is reverse transcriptase with the concentration of 100U/ul-300U/ul;
the PCR enzyme is DNA polymerase with the concentration of 2U/ul-10U/ul;
the blank control is nuclease-free water;
the reference substance is mixed human serum stably expressed by microRNA after 2-4 times of freeze thawing treatment;
the targets comprise hsa-miR-29c-3p, hsa-miR-424-5p, hsa-miR-103a-3p, hsa-miR-93-5p, hsa-miR-181a-5p, hsa-miR-21-5p, hsa-miR-140-5p, hsa-miR-30e-5p, hsa-miR-142-5p, hsa-miR-126-3p, hsa-miR-183-5p and hsa-miR-340-5 p.
The positive quality control product is a mixed RNA solution containing 12 kinds of target microRNAs;
the negative quality control product is a mixed RNA solution without 12 kinds of target microRNAs;
the primer plate is a 384-pore plate, and positive and negative primer dry powder of the detection target is contained on the primer plate.
The invention has the beneficial effects that:
(1) the RT primer design in the RT reaction liquid of the kit adopts a method of a patent 'modified stem-loop oligonucleotide mediated reverse transcription and base spacing limited quantitative PCR' (patent number CN201180038333.8), so that the specificity is enhanced, the requirement of a sample for carrying out multi-target reverse transcription reaction in a single reaction system can be met, when a plurality of targets are detected, the reverse transcription of all targets can be completed only by preparing one reaction system, and the operation flow of multi-target detection is simplified.
(2) The kit uses mixed human serum stably expressed by microRNA as a reference substance, when the microRNA contained in a sample is detected, the detection result fluctuates due to factors such as raw material change, operation difference and equipment, but the fluctuation of the sample is consistent with the fluctuation of the reference substance, and the sample can be calibrated according to the fluctuation of the reference substance, so that the detection deviation of the sample is reduced.
(3) The primer plate in the kit contains target PCR positive and negative primer dry powder, for multi-target detection, each sample needs to be prepared into a different reaction system and then added into the reaction plate for PCR reaction, so that the operation time is longer, and the detection errors can be increased due to different preparations. After the primer plate is used, only a system without the primer needs to be prepared, the primer plate is directly added for reaction, the operation time is short, the deviation is increased without preparing multiple systems, and the difficulty in detecting the target is reduced.
Drawings
FIG. 1 is a primer mapping layout of the kit of example 1.
FIG. 2 is a layout diagram of primer mapping in the kit of example 2.
FIG. 3 shows the values of the uncalibrated positive control tests.
FIG. 4 shows the test values of positive quality control substances after calibration.
FIG. 5 is a comparison of sample deviations between the experimental group and the control group.
Detailed Description
The technical solution of the present invention will be further specifically described below by way of specific examples.
In the present invention, the raw materials and equipment used are commercially available or commonly used in the art, unless otherwise specified. The methods in the following examples are conventional in the art unless otherwise specified.
Example 1:
kit for detecting 6 kinds of micro ribonucleic acids (microRNAs)
Target micrornas were detected as in table 1:
TABLE 1 kit target genes
| Encoding | Target gene | Sequence 5 '-3' |
| g1 | hsa-miR-484 | UCAGGCUCAGUCCCCUCCCGAU(SEQ ID No.1) |
| g2 | hsa-let-7a-5p | UGAGGUAGUAGGUUGUAUAGUU(SEQ ID No.2) |
| g3 | hsa-miR-16-5p | UAGCAGCACGUAAAUAUUGGCG(SEQ ID No.3) |
| g4 | hsa-miR-339-3p | UGAGCGCCUCGACGACAGAGCCG(SEQ ID No.4) |
| g5 | hsa-miR-483-5p | AAGACGGGAGGAAAGAAGGGAG(SEQ ID No.5) |
| g6 | hsa-miR-335-5p | UCAAGAGCAAUAACGAAAAAUGU(SEQ ID No.6) |
The preparation method comprises the following specific steps:
(1) RT reaction solution: comprises 35% of RT premix 5X (commercially available, Promega), 90nM of each of the 6 target-specific RT primers, 1.8mM of dNTP, MgCL2The concentration is 9mM, and the rest is nuclease-free water;
the specific RT primer design is described in the patent "modified stem-loop oligonucleotide mediated reverse transcription and base spacing limited quantitative PCR" (patent No. CN201180038333.8 application No. 2011.06.13), and the RT primer sequence is shown in Table 2:
TABLE 2 RT primer sequence Listing
| Serial number | RT primer sequences |
| g1 | 5’-TGACCTTGTGGTCAATCGGGAGG-3’(SEQ ID No.7) |
| g2 | 5’-CGCGATGTCTCGCGAACTATAC-3’(SEQ ID No.8) |
| g3 | 5’-GGGTCGCAAGACCCCGCCAATATTT-3’(SEQ ID No.9) |
| g4 | 5’-AGGTGCTTCCACCTCGGCTCTG-3’(SEQ ID No.10) |
| g5 | 5’-CTGACCAACGTCAGCTCCCTTCTT-3’(SEQ ID No.11) |
| g6 | 5’-GACCCAGGCGGGTCACATTTTTCGT-3’(SEQ ID No.12) |
(2) PCR reaction solution: contains 10X (commercially available, MiRXES) 20% of PCR premix, MgCL2The concentration is 5mM, and the rest is nuclease-free water;
RT enzyme: reverse transcriptase, concentration 160U/ul, brand Promega;
PCR enzyme: DNA polymerase, concentration 5U/ul, brand Klear Taq;
reference product: freezing and thawing the mixed human serum (commercially available, Innovative Research) for 2 times at-80 ℃, mixing uniformly and packaging (melting at room temperature, shaking uniformly, freezing at low temperature, melting at room temperature, shaking uniformly and packaging);
blank control: nuclease-free water;
positive quality control product: mixed RNA solution containing 6 detection targets, each target gene concentration being 2 x 105copies/ul, 20ng/ul of MS2 RNA (brand: Roche) solution as a dilution solvent;
negative quality control product: 20ng/ul of MS2 RNA (brand: Roche) solution;
(3) primer plate: preparing synthesized positive and negative primers of g1-g6 into an equal concentration solution according to a concentration report provided by a manufacturer, mixing the solution in equal proportion according to different genes after the preparation is finished, diluting the solution to the concentration of 0.75uM, adding the primers into a 384-pore plate by using a liquid transfer workstation according to the sequence shown in figure 1 after the mixing, transferring the plate into an oven, drying the plate for 80min at the temperature of 55 ℃, sealing the plate by using a sealing plate film after the drying, filling the plate into an aluminum foil bag, sealing the opening of the aluminum foil bag, and labeling the plate.
The sequences of the g1-g6 primers are shown in Table 3:
TABLE 3 primer sequence Listing g1-g6
Example 2:
stomach cancer detects uses microRNA detect reagent box with calibration function
Target micrornas were detected as in table 4:
TABLE 4 kit target genes (detailed sequence see CN 110029169A)
| Encoding | Target gene |
| G1 | hsa-miR-29c-3p |
| G2 | hsa-miR-424-5p |
| G3 | hsa-miR-103a-3p |
| G4 | hsa-miR-93-5p |
| G5 | hsa-miR-181a-5p |
| G6 | hsa-miR-21-5p |
| G7 | hsa-miR-140-5p |
| G8 | hsa-miR-30e-5p |
| G9 | hsa-miR-142-5p |
| G10 | hsa-miR-126-3p |
| G11 | hsa-miR-183-5p |
| G12 | hsa-miR-340-5p |
The preparation method comprises the following specific steps:
(1) RT reaction solution: comprises RT premix 5X (commercially available, Promega) 35%, 12 target-specific RT primers 90nM, dNTP 1.8mM, MgCL2The concentration is 9mM, and the rest is nuclease-free water;
the specific RT primer design is described in the patent "modified stem-loop oligonucleotide mediated reverse transcription and base spacing limited quantitative PCR" (patent No. CN201180038333.8 application No. 2011.06.13), and the RT primer sequences are shown in Table 5:
TABLE 5 RT primer sequence Listing
| Serial number | RT primer sequences |
| G1 | 5’-TTTAGCCAATGCCGTGGAGACGGC-3’(SEQ ID No.25) |
| G2 | 5’-AGTACAAAACTTGGCGAGCAGTCGCC-3’(SEQ ID No.26) |
| G3 | 5’-TCCCGATACTCCCTGGCTTCAGGG-3’(SEQ ID No.27) |
| G4 | 5’-CACGTCCATCCCCAGTCGCCTGGG-3’(SEQ ID No.28) |
| G5 | 5’-CAGCCACTCACTCGCTCTGGCGAG-3’(SEQ ID No.29) |
| G6 | 5’-ACTACAACTGCTCGCCAACGAGC-3’(SEQ ID No.30) |
| G7 | 5’-GGATACCATCACCCGAACGCGGGT-3’(SEQ ID No.31) |
| G8 | 5’-CTGACCTTCTCCCGCTGACGGGA-3’(SEQ ID No.32) |
| G9 | 5’-TCGTGATGATACCCTGGAGGGTA-3’(SEQ ID No.33) |
| G10 | 5’-ATTATTACGCGCAGTTTCGACTGC-3’(SEQ ID No.34) |
| G11 | 5’-ATCTTAAGTGATCTGCGGGTGCAGA-3’(SEQ ID No.35) |
| G12 | 5’-TCTGACTAAGGGTCGCGTGACCC-3’(SEQ ID No.36) |
(2) PCR reaction solution: contains 10X (commercially available, MiRXES) 20% of PCR premix, MgCL2The concentration is 5mM, and the rest is nuclease-free water;
RT enzyme: reverse transcriptase, concentration 160U/ul, brand Promega;
PCR enzyme: DNA polymerase, concentration 5U/ul, brand Klear Taq;
reference product: freezing and thawing a mixed human serum (commercially available, Innovative Research) at-80 ℃ for 2 times, mixing uniformly and packaging; blank control: nuclease-free water;
positive quality control product: mixed RNA solution containing 12 detection targets with target gene concentration of 2 x 105copies/ul, 20ng/ul of MS2 RNA (brand: Roche) solution as a dilution solvent;
negative quality control product: 20ng/ul of MS2 RNA (brand: Roche) solution;
(3) primer plate: preparing the synthesized positive and negative primers G1-G12 into an equal-concentration solution according to a concentration report provided by a manufacturer, mixing the solution in equal proportion according to different genes after the preparation is finished, diluting the solution to the concentration of 0.75uM, adding the primers into a 384-pore plate by using a liquid transfer workstation according to the sequence shown in figure 2 after the mixing, transferring the plate into an oven, drying the plate for 80min at the temperature of 55 ℃, sealing the plate by using a sealing plate film after the drying, filling the plate into an aluminum foil bag, sealing the opening of the aluminum foil bag, and labeling the plate.
The sequences of the G1-G12 primers are shown in Table 6:
TABLE 6 primer sequence Listing G1-G12
Example 3:
analysis of calibration effect of reference substance of gastric cancer detection kit
Referring to example 2, 3 batches of the assay kit were produced using 3 batches of the PCR premix (10X) (brand: MiRXES), each batch 1/2/3. The component reference substances and the positive quality control substances in the three batches of kits are in the same batch, and the primer typesetting is shown in figure 2.
The specific use steps are as follows:
(1) RNA extraction: extracting reference substance and blank control by using extracting or purifying reagent, and extracting or purifying reagent manufacturer: hangzhou Song Yuan Biotechnology Ltd; the model is as follows: MY-02;
(2) reverse transcription: carrying out reverse transcription reaction on the extracted reference substance and blank control, negative quality control substance and positive quality control substance, wherein the reaction mixed solution is prepared as follows:
TABLE 7 reverse transcription reaction solution ratio
| Components | Adding amount of |
| Sample(s) | 6ul |
| RT reaction solution | 8.25ul |
| RT enzymes | 0.75ul |
Setting a program of a PCR amplification instrument: 10min at 25 ℃; 10min at 30 ℃; 10min at 35 ℃; 10min at 40 ℃; 5min at 95 ℃; storing at 20 ℃.
(3) And (3) PCR amplification: adding 3749ul of PCR reaction solution into a 15ml centrifuge tube, adding 3800ul of nuclease-free water, adding 51ul of PCR enzyme, mixing uniformly, transferring into a deep-well plate, adding 435ul of each well and 4 wells (how many samples are added, how many are added, and 16 wells at most), transferring the reverse-transcribed samples into the deep-well plate, mixing uniformly, transferring to a primer plate, adding one line for each sample, 15ul of each well, centrifuging, and then performing reaction on a machine, wherein the reaction procedures are shown in Table 8:
TABLE 8 PCR amplification set-up conditions
And (3) data analysis: and (3) completing 3 batches of experimental operations according to the steps 1-3, automatically setting a base line, manually setting a threshold line to be 0.4, and exporting data, wherein the negative quality control product and the blank control have no normal amplification curve.
Reference target values are given in the table below:
TABLE 8 reference 12 Gene target values
| Gene | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 | G9 | G10 | G11 | G12 |
| CT | 24.71 | 25.58 | 20.97 | 25.13 | 25.20 | 22.03 | 29.05 | 24.45 | 24.33 | 22.94 | 29.88 | 27.11 |
The reference substance and positive quality control detection data of the 3 batches of kit are shown in table 9, the positive quality control data after the reference substance calibration are shown in table 10, the test value of the uncalibrated positive quality control is shown in fig. 3, and the test value of the calibrated positive quality control is shown in fig. 4. As can be seen from fig. 3 and 4, the change of the raw material causes the fluctuation of the microRNA detection, but the deviation is cancelled by the calibration of the reference product for synchronous detection, so as to achieve the accurate measurement result.
The calibration formula is:
the calibration value of the positive quality control product is positive quality control product detection value + (reference product target value-reference product detection value).
TABLE 9 reference/Positive quality control three-batch test values
TABLE 10 CT values of three batches of positive quality control products calibrated with reference
The analysis and comparison of the test effect of the primer plate and the preparation test effect
The kit components in example 2 are used for carrying out a test, after a reference substance is extracted, the kit components are used for carrying out reverse transcription reaction, then, samples after reverse transcription are divided into 2 groups, wherein the experimental group uses a primer plate for carrying out PCR detection, the control group prepares PCR premix (including positive and negative primers) for carrying out PCR detection, and test results are compared.
The specific implementation steps are as follows:
(1) sample extraction: 16 reference samples were extracted using extraction or purification reagents, the extraction or purification reagent manufacturer: hangzhou Song Yuan Biotechnology Ltd; the model is as follows: MY-02.
(2) Reverse transcription: carrying out reverse transcription reaction on the extracted reference sample, and mixing the reaction mixture according to the proportion shown in Table 11:
TABLE 11 reverse transcription reaction solution ratio
| Components | Adding amount of |
| Sample(s) | 6ul |
| RT reaction solution | 8.25ul |
| RT enzymes | 0.75ul |
Setting a program of a PCR amplification instrument: 10min at 25 ℃; 10min at 30 ℃; 10min at 35 ℃; 10min at 40 ℃; 5min at 95 ℃; storing at 20 ℃.
(3) And (3) PCR amplification: dividing the reverse transcribed samples into 2 groups, namely an experimental group and a control group, wherein each group comprises 8 samples, the experimental group uses a primer plate to perform PCR amplification reaction, the control group uses prepared reaction liquid, the liquid preparation ratio of each hole is shown in table 12, the single target gene is independently prepared, the samples are moved into a 384 plate to perform PCR reaction after being prepared, and the reaction procedure is shown in table 8. In the experiment, only one tube of premix liquid needs to be prepared for each sample of the experiment group, and 12 tubes of premix liquid needs to be prepared for each sample of the control group, so that the time is longer.
TABLE 12 PCR premix ratio for each well reaction
| Components | Adding amount of | Description of the invention |
| Sample(s) | 0.5ul | Reverse transcription product |
| PCR reaction solution | 7.15ul | In accordance with the kit of example 2 |
| PCR enzymes | 0.1ul | In accordance with the kit of example 2 |
| Positive and negative primers | 2.9ul | Primer concentration 1uM |
| Nuclease-free water | 4.35ul | |
| Total up to | 15ul |
Different detection targets are independently prepared, so that the consistency of the concentration of each component in each reaction hole of the experimental group and the control group is ensured.
(4) And (3) data analysis: automatically set baseline, manually set threshold line to 0.4, derive data, compare primer plate and directly prepare reagent test results, mean and deviation of experimental and control groups as in table 13:
TABLE 13 test data for experimental and control groups
The test results of the experimental group and the control group have the same mean value, the effect is equivalent, the control group has longer operation time and more complex experiment, the experimental group can shorten the experiment time, the operation is simple and convenient, and the operation difference among samples can be reduced.
The above-described embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention in any way, and other variations and modifications may be made without departing from the spirit of the invention as set forth in the claims.
SEQUENCE LISTING
<110> Hangzhou foraging reason Biotechnology Ltd
<120> microRNA detection kit with calibration function
<130> 2021.04
<160> 60
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 1
ucaggcucag uccccucccg au 22
<210> 2
<211> 22
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 2
ugagguagua gguuguauag uu 22
<210> 3
<211> 22
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 3
uagcagcacg uaaauauugg cg 22
<210> 4
<211> 23
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 4
ugagcgccuc gacgacagag ccg 23
<210> 5
<211> 22
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 5
aagacgggag gaaagaaggg ag 22
<210> 6
<211> 23
<212> RNA
<213> Artificial sequence (Artificial sequence)
<400> 6
ucaagagcaa uaacgaaaaa ugu 23
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
tgaccttgtg gtcaatcggg agg 23
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
cgcgatgtct cgcgaactat ac 22
<210> 9
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
gggtcgcaag accccgccaa tattt 25
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
aggtgcttcc acctcggctc tg 22
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
ctgaccaacg tcagctccct tctt 24
<210> 12
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
gacccaggcg ggtcacattt ttcgt 25
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
gggtaggttc aggctcagt 19
<210> 14
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
gtggtcaatc gggagggg 18
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
<210> 16
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
gcgatgtctc gcgaactata caac 24
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
<210> 18
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
gcaagacccc gccaatattt ac 22
<210> 19
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
cttccacctc ggctctgtc 19
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
<210> 22
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
<210> 23
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
atcacacctc cgtcaagagc aa 22
<210> 24
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
caggcgggtc acatttttcg tt 22
<210> 25
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
tttagccaat gccgtggaga cggc 24
<210> 26
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
agtacaaaac ttggcgagca gtcgcc 26
<210> 27
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
tcccgatact ccctggcttc aggg 24
<210> 28
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
cacgtccatc cccagtcgcc tggg 24
<210> 29
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
cagccactca ctcgctctgg cgag 24
<210> 30
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
actacaactg ctcgccaacg agc 23
<210> 31
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
ggataccatc acccgaacgc gggt 24
<210> 32
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
ctgaccttct cccgctgacg gga 23
<210> 33
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
tcgtgatgat accctggagg gta 23
<210> 34
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
attattacgc gcagtttcga ctgc 24
<210> 35
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
atcttaagtg atctgcgggt gcaga 25
<210> 36
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
<210> 37
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
<210> 38
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
ctttagccaa tgccgtggag a 21
<210> 39
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
<210> 40
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
aagtacaaaa cttggcgagc agtc 24
<210> 41
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
cgtcttccga agcagcattg tac 23
<210> 42
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
<210> 43
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 43
tgagccgtca aagtgctgtt c 21
<210> 44
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 44
<210> 45
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 45
<210> 46
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 46
acagccactc actcgctc 18
<210> 47
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 47
gcgtcccgta gcttatcaga c 21
<210> 48
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 48
<210> 49
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 49
<210> 50
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 50
<210> 51
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 51
ctccgtgcct ctgtaaacat cct 23
<210> 52
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 52
<210> 53
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 53
cggccgcgtc acataaagta gaaa 24
<210> 54
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 54
<210> 55
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 55
<210> 56
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 56
cattattacg cgcagtttcg a 21
<210> 57
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 57
<210> 58
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 58
<210> 59
<211> 24
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 59
cgtatcgccg gttataaagc aatg 24
<210> 60
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 60
Claims (10)
1. A microRNA detection kit with a calibration function is characterized by at least comprising RT reaction liquid, PCR reaction liquid, RT enzyme, PCR enzyme, a reference substance, a blank control and a primer plate; the reference substance is mixed human serum stably expressed by microRNA after 2-4 times of freeze-thaw treatment.
2. The microRNA detection kit with the calibration function according to claim 1, wherein the freezing temperature of the freezing and thawing treatment is-15 to-80 ℃.
3. The microRNA detection kit with the calibration function according to claim 1, wherein the RT reaction solution comprises: 5 multiplied by 20% -45% of RT premix, 30-150nM specific RT primer, 1-4mM dNTP, 5-20mM MgCL2And the balance of nuclease-free water.
4. The microRNA detection kit with the calibration function according to claim 1, wherein the PCR reaction solution comprises: PCR premix 10X 20%, MgCL with concentration 2-8mM2And the balance of nuclease-free water.
5. The microRNA detection kit with calibration function according to claim 1, wherein the RT enzyme is reverse transcriptase; the PCR enzyme is DNA polymerase.
6. The microRNA detection kit with the calibration function according to claim 1, wherein the blank control is nuclease-free water.
7. The microRNA detection kit with the calibration function according to claim 1, wherein the primer plate is a 384-well plate or a 96-well plate, and positive and negative primer dry powder for detecting a target is arranged on the primer plate.
8. A microRNA detection kit with a calibration function for gastric cancer detection is characterized by comprising an RT reaction solution, a PCR reaction solution, an RT enzyme, a PCR enzyme, a reference substance, a positive quality control substance, a negative quality control substance, a blank control and a primer plate;
the RT reaction solution comprises: 5 multiplied by 20% -45% of RT premix, 12 target-specific RT primers with the concentration of 30-150nM, dNTP with the concentration of 1-4mM and MgCL with the concentration of 5-20mM2The balance of nuclease-free water;
the PCR reaction solution contains: PCR premix 10X 20%, MgCL with concentration 2-8mM2The balance of nuclease-free water; the RT enzyme is reverse transcriptase with the concentration of 100U/ul-300U/ul;
the PCR enzyme is DNA polymerase with the concentration of 2U/ul-10U/ul;
the blank control is nuclease-free water;
the reference substance is mixed human serum stably expressed by microRNA after 2-4 times of freeze-thaw treatment.
9. The microRNA detection kit with calibration function for gastric cancer detection according to claim 8, wherein the targets comprise hsa-miR-29c-3p, hsa-miR-424-5p, hsa-miR-103a-3p, hsa-miR-93-5p, hsa-miR-181a-5p, hsa-miR-21-5p, hsa-miR-140-5p, hsa-miR-30e-5p, hsa-miR-142-5p, hsa-miR-126-3p, hsa-miR-183-5p and hsa-miR-340-5 p.
10. The microRNA detection kit with the calibration function for gastric cancer detection according to claim 8, wherein the positive quality control material is a mixed RNA solution containing 12 kinds of target microRNAs; the negative quality control product is a mixed RNA solution without 12 kinds of target microRNAs; the primer plate is a 384-pore plate, and positive and negative primer dry powder of the detection target is contained on the primer plate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110467757.1A CN113151413A (en) | 2021-04-28 | 2021-04-28 | MicroRNA detection kit with calibration function |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110467757.1A CN113151413A (en) | 2021-04-28 | 2021-04-28 | MicroRNA detection kit with calibration function |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113151413A true CN113151413A (en) | 2021-07-23 |
Family
ID=76872089
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110467757.1A Pending CN113151413A (en) | 2021-04-28 | 2021-04-28 | MicroRNA detection kit with calibration function |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151413A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892314A (en) * | 2010-06-22 | 2010-11-24 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human platelet alloantigen gene |
| CN103210092A (en) * | 2010-06-14 | 2013-07-17 | 新加坡国立大学 | Modified stem-loop oligonucleotide mediated reverse transcription and base-spacing constrained quantitative PCR |
| CN103255209A (en) * | 2013-03-27 | 2013-08-21 | 天津市秀鹏生物技术开发有限公司 | Primer combination and kit for detecting human leucocyte HLA-B27 antigenic gene |
| CN107075578A (en) * | 2014-09-16 | 2017-08-18 | 东丽株式会社 | The comparative analysis method and apparatus of miRNA expression quantity |
| CN108474033A (en) * | 2016-02-22 | 2018-08-31 | 东丽株式会社 | From the evaluation method of the quality of the miRNA of body fluid |
| CN110029169A (en) * | 2019-04-30 | 2019-07-19 | 觅瑞实验室私人有限公司 | It is a kind of detect gastric cancer miRNA marker combination and kit |
-
2021
- 2021-04-28 CN CN202110467757.1A patent/CN113151413A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103210092A (en) * | 2010-06-14 | 2013-07-17 | 新加坡国立大学 | Modified stem-loop oligonucleotide mediated reverse transcription and base-spacing constrained quantitative PCR |
| CN101892314A (en) * | 2010-06-22 | 2010-11-24 | 天津市秀鹏生物技术开发有限公司 | Primer group and kit for detecting human platelet alloantigen gene |
| CN103255209A (en) * | 2013-03-27 | 2013-08-21 | 天津市秀鹏生物技术开发有限公司 | Primer combination and kit for detecting human leucocyte HLA-B27 antigenic gene |
| CN107075578A (en) * | 2014-09-16 | 2017-08-18 | 东丽株式会社 | The comparative analysis method and apparatus of miRNA expression quantity |
| CN108474033A (en) * | 2016-02-22 | 2018-08-31 | 东丽株式会社 | From the evaluation method of the quality of the miRNA of body fluid |
| CN110029169A (en) * | 2019-04-30 | 2019-07-19 | 觅瑞实验室私人有限公司 | It is a kind of detect gastric cancer miRNA marker combination and kit |
Non-Patent Citations (1)
| Title |
|---|
| 张开滋等: "《临床心力衰竭学》", 31 October 2014, 湖南科学技术出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11466311B2 (en) | Method for identification and quantification of nucleic acid expression, splice variant, translocation, copy number, or methylation changes | |
| US20180066311A1 (en) | Methods of constructing small rna libraries and their use for expression profiling of target rnas | |
| EP2419537B1 (en) | Methods and compositions for detection of small rnas | |
| US9096895B2 (en) | Method for quantification of small RNA species | |
| CN107893109A (en) | A kind of low abundance gene mutation enrichment method based on removal wild-type sequence | |
| WO2023025259A1 (en) | Method and kit for detecting microrna | |
| CN111936635A (en) | Generation of single stranded circular DNA templates for single molecule sequencing | |
| CN102925577A (en) | Real-time quantitative polymerase chain reaction (PCR) detection method of micro ribonucleic acid (miRNAs) and application thereof | |
| Yilmaz et al. | Real-time PCR for gene expression analysis | |
| CN110872609A (en) | Method for accurately establishing library and sequencing small RNA molecules and application | |
| CN113151413A (en) | MicroRNA detection kit with calibration function | |
| CN107012241B (en) | Triple RT-qPCR detection method and kit for U6, miR92a and miR21 | |
| US20210032701A1 (en) | Pcr controls | |
| EP3289095B1 (en) | Detection of nucleic acid molecules | |
| CN114410831B (en) | Novel detection kit for coronavirus Delta mutant strain | |
| CN111315895A (en) | Novel method for generating circular single-stranded DNA library | |
| EP2251436B1 (en) | Sirna detection method | |
| KR101874089B1 (en) | A kit and method for detecting RNA molecules | |
| CN117625608A (en) | siRNA of m6A methyltransferase complex related gene and application thereof | |
| CN116179679A (en) | Detection primer pair and detection probe of SMN1 gene and kit for detecting spinal muscular atrophy | |
| Abdalla et al. | Effect of RNA Isolation Methods on microRNA Quantity and Quality in Plasma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210723 |
|
| RJ01 | Rejection of invention patent application after publication |