CN113151347A - Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria - Google Patents

Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria Download PDF

Info

Publication number
CN113151347A
CN113151347A CN202110255507.1A CN202110255507A CN113151347A CN 113151347 A CN113151347 A CN 113151347A CN 202110255507 A CN202110255507 A CN 202110255507A CN 113151347 A CN113151347 A CN 113151347A
Authority
CN
China
Prior art keywords
tobacco
ntchs
gene
resistance
black shank
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202110255507.1A
Other languages
Chinese (zh)
Other versions
CN113151347B (en
Inventor
李依婷
孙铭明
王程栋
蒋彩虹
陈帅
程立锐
杨爱国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chongqing Co Of China National Tobacco Corp
Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Original Assignee
Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS filed Critical Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Priority to CN202110255507.1A priority Critical patent/CN113151347B/en
Publication of CN113151347A publication Critical patent/CN113151347A/en
Application granted granted Critical
Publication of CN113151347B publication Critical patent/CN113151347B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12N9/1037—Naringenin-chalcone synthase (2.3.1.74), i.e. chalcone synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01074—Naringenin-chalcone synthase (2.3.1.74), i.e. chalcone synthase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses an application of a tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco phytophthora parasitica. The invention provides an application of a tobacco chalcone synthetase NtCHS gene in regulating tobacco resistance to tobacco phytophthora parasitica. According to the invention, the resistance of tobacco to tobacco phytophthora parasitica is reduced by silencing the NtCHS gene, and meanwhile, the content of the tobacco phytophthora parasitica in a transgenic strain with the NtCHS gene silencing is obviously higher than that of pathogenic bacteria in the macrolepia alba 599. The invention proves the new application of the NtCHS gene in the regulation of tobacco black shank resistance.

Description

Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria
Technical Field
The invention discloses an application of a tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco phytophthora parasitica.
Background
The tobacco black shank is a soil-borne oomycete disease commonly occurring on tobacco and is one of devastating diseases threatening the growth of tobacco, and main tobacco producing areas in China occur in different degrees. It is estimated that the direct and indirect economic losses to tobacco leaf production and tobacco growers due to black shank infection can reach tens of millions each year. The pathogenic bacteria of the tobacco black shank is phytophthora parasitica which can infect tobacco strains through stomata, wounds or directly penetrating epidermal cells, the infected tobacco strains can form black spots on stem bases or are attacked from bottom leaves and then spread to stems, so that the tissue of the tobacco strains is necrotic, the water and nutrient transport is obstructed, and finally the tobacco strains die. The spreading way of the parasitic phytophthora is wide, the spreading efficiency is high, and the spreading of the parasitic phytophthora can be promoted by the agricultural operations such as soil, wind and rain, irrigation and the like. The pathogenic bacteria live through the winter on plant tissues in soil or compost in the form of mycelium, oospore and chlamydospore, and the latency time can reach more than 3 years to the maximum. In addition, the host range of phytophthora parasitica is wide, and important economic crops such as hot peppers, tomatoes, potatoes, eggplants and the like can be infected under natural conditions besides tobacco.
Strengthening cultivation management and chemical agent control are the main measures for controlling black shank in the tobacco area at present. The occurrence degree of diseases can be reduced to a certain extent by measures such as reasonable crop rotation, high-ridge cultivation seedling raising, timely intertillage weeding, field humidity reduction and the like, but the tobacco black shank belongs to high-temperature and high-humidity diseases, so that the measures are not obvious in effect once the disease selection pressure is high, and only can play an auxiliary role. And long-term use of a large amount of chemical agents is easy to cause the improvement of the drug resistance of pathogenic bacteria and the generation of cross resistance, thereby greatly reducing the drug effect, greatly increasing the control cost, and solving the problems of environmental pollution, pesticide residue and the like. The disease-resistant gene is excavated, and the breeding of resistant varieties is a fundamental way and a method for solving the harm of the tobacco black shank, but the current reports on the tobacco black shank resistant gene are relatively limited, and the black shank resistance of the main cultivar needs to be further improved.
The chalcone synthase CHS gene is a key enzyme and a rate-limiting enzyme of a flavonoid metabolic pathway in a plant body, has very important functions in the aspects of growth and development of the plant, secondary metabolite accumulation, stress resistance and the like, but has no clear regulation and control mechanism of the CHS gene in the flavonoid metabolic pathway and the action mechanism of the CHS gene in the stress resistance and disease resistance of the plant. At present, no report that the resistance of tobacco to phytophthora parasitica is regulated by the gene NtCHS of the chalcone synthase of tobacco at home is available.
Disclosure of Invention
The invention aims to provide the application of the gene NtCHS of the chalcone synthetase in tobacco in regulating the resistance of the tobacco to phytophthora parasitica.
The purpose of the invention can be realized by the following technical scheme:
the application of the tobacco chalcone synthase NtCHS gene in regulating the resistance of tobacco black shank is disclosed, and the GenBank number of the tobacco chalcone synthase NtCHS gene is AF 311783.1.
A method for improving the resistance of tobacco to tobacco phytophthora parasitica is used for improving the expression level of chalcone synthetase NtCHS genes in tobacco so as to improve the resistance of tobacco to the tobacco phytophthora parasitica.
Has the advantages that:
the invention provides an application of a tobacco chalcone synthetase NtCHS gene in regulating tobacco resistance to tobacco phytophthora parasitica. The invention leads the resistance of tobacco to the tobacco phytophthora parasitica to be reduced by silencing the NtCHS gene. The invention proves the new application of the NtCHS gene in the regulation of tobacco black shank resistance.
Drawings
FIG. 1 is a graph of silencing efficiency of each line after silencing NtCHS gene in tobacco variety Baijin 599;
FIG. 2 shows resistance expression of strains inoculated with black shank after silencing NtCHS gene in tobacco variety Banjin 599;
FIG. 3 is the disease index after inoculation of black shank in each strain after silencing NtCHS gene in tobacco variety Baijin 599;
FIG. 4 shows the pathogen content after inoculation of black shank in each strain after silencing NtCHS gene in tobacco variety Banjin 599;
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and specific embodiments
Example 1
First, experimental material
1. The seeds of the tobacco variety of the Dabaijin 599 used in the experiment are provided by a germplasm resource bank of the tobacco institute of Chinese academy of agricultural sciences. The conserved sequence of the NtCHS gene is amplified by PCR technology, the length is 293bp, and the primer is provided with a partial sequence of attB of a specific binding site (NtCHS-F: AAAAAGCAGGCTTCGTATCACTAATAGCGAGCAT (SEQ ID NO. 1); NtCHS-R: AGAAAGCTGGGTCGGGCATGTCTACACCAC (SEQ ID NO. 2)). Then, the purified attB-PCR product is recombined on an entry vector pDONR201 under the catalytic action of BP clonase II enzyme mix, and then, under the action of LR clonase II enzyme mix, sequencing identified entry vector plasmid is recombined and integrated with pH7GWIWG2(I) to construct an RNAi expression vector of the NtCHS gene with an inverted repeat sequence, wherein primers used for LR reaction are attB1 and attB2(attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCT (SEQ ID NO. 3); attB2: GGGGACCACTTTGTACAAGAAAGCTGGGT (SEQ ID NO. 4)). Finally, transfecting a tobacco variety of ligamentum glaucophyllum 599 by an agrobacterium-mediated method, designing specific primers RNAi-F and RNAi-R according to a sequence on a pH7GWIWG2(I) vector to carry out PCR identification (RNAi-F: CGATTTGTGTACGCCCGACAGTC (SEQ ID NO. 5); RNAi-R: TCGTTATGTTTATCGGCACTTTG (SEQ ID NO.6)), and obtaining 3 homozygous transgenic strains, namely NtCHS-RNAi-1, -2 and-3 respectively, by generation breeding. The silencing efficiency of each line after silencing NtCHS gene in tobacco variety Baijin 599 is shown in FIG. 1.
2. The phytophthora parasitica used in the experiment is a strain stored in a laboratory incubator at 28 ℃, and the adopted culture medium is an oat culture medium.
The formula of the oat culture medium comprises: 33g of oat, 18g of agar and 1L of ultrapure water.
The configuration method comprises the following steps: weighing 33g of oat, adding water, boiling, filtering with gauze after boiling, and putting into a beaker. Then adding 18g of agar, stirring uniformly, metering to 1L, sterilizing for 30 minutes at 121 ℃, cooling and pouring. Then the phytophthora parasitica is cultured on an oat culture medium for about 14 days for later use (28 ℃).
Second, Experimental methods
The method for inoculating the tobacco black shank bacteria in the seedling stage comprises the following steps: transplanting the 4-leaf stage seedlings into Hoagland nutrient solution, and inoculating tobacco black shank bacteria when the seedlings are cultured to 8-leaf stage; inoculating by adopting a spore suspension root dipping method, adding 25ml of 0.1% potassium nitrate solution into each dish of phytophthora parasitica cultured for 14 days, inducing at 4 ℃ for 30 minutes, inducing at 28 ℃ for 25 minutes by illumination, collecting liquid, dipping the plant in the root for 3 hours (under dark conditions), and taking out, and observing the disease condition after 3-5 days;
disease index (%) ═ Σ [ (disease grade + number of disease-grade plants)/(total number of plants + highest disease grade) ] × 100
Detecting the content of the tobacco black shank bacteria: and (3) respectively taking each strain material (three biological repetitions, each repetition comprises 8 seedlings) 5d after inoculating the tobacco black shank bacteria, fully grinding by using liquid nitrogen, extracting DNA, respectively obtaining Ct values of the tobacco housekeeping genes and the tobacco black shank bacteria housekeeping genes by qRT-PCR, and determining the content of pathogenic bacteria.
Ct content of pathogenic bacteriaPhytophthora parasitica-CtTobacco
Thirdly, resistance expression of each strain inoculated with black shank after silencing NtCHS gene in tobacco variety Baijin 599
Tobacco phytophthora parasitica was inoculated to each transgenic line at the seedling stage, and it was found that the resistance of the transgenic line with NtCHS gene silencing was significantly lower than that of the great sinew 599 (fig. 2-3). Meanwhile, after the pathogenic bacteria in the transgenic line inoculated for 5 days and the tendon accumbens 599 are detected, the tobacco phytophthora parasitica content of the transgenic line with the NtCHS gene silencing is found to be obviously higher than that of the phytophthora parasitica in the tendon accumbens 599 (figure 4).
Sequence listing
<110> tobacco institute of Chinese academy of agricultural sciences (Qingzhou tobacco institute of Chinese tobacco Co., Ltd.)
Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco phytophthora parasitica
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aaaaagcagg cttcgtatca ctaatagcga gcat 34
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
agaaagctgg gtcgggcatg tctacaccac 30
<210> 3
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggggacaagt ttgtacaaaa aagcaggct 29
<210> 4
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggggaccact ttgtacaaga aagctgggt 29
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgatttgtgt acgcccgaca gtc 23
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcgttatgtt tatcggcact ttg 23

Claims (2)

1. The application of the tobacco chalcone synthase NtCHS gene in regulating the resistance of tobacco black shank is disclosed, and the GenBank number of the tobacco chalcone synthase NtCHS gene is AF 311783.1.
2. A method for improving the resistance of tobacco to tobacco phytophthora parasitica is characterized in that the expression level of chalcone synthase NtCHS genes in the tobacco is improved so as to improve the resistance of the tobacco to the tobacco phytophthora parasitica.
CN202110255507.1A 2021-03-09 2021-03-09 Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria Active CN113151347B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110255507.1A CN113151347B (en) 2021-03-09 2021-03-09 Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110255507.1A CN113151347B (en) 2021-03-09 2021-03-09 Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria

Publications (2)

Publication Number Publication Date
CN113151347A true CN113151347A (en) 2021-07-23
CN113151347B CN113151347B (en) 2022-07-19

Family

ID=76886514

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110255507.1A Active CN113151347B (en) 2021-03-09 2021-03-09 Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria

Country Status (1)

Country Link
CN (1) CN113151347B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725643A (en) * 2022-10-19 2023-03-03 河南农业大学 Application of NtMYB35 transcription factor in tobacco black shank resistance

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101550420A (en) * 2008-11-25 2009-10-07 云南省烟草科学研究所 Tobacco receptor albuminoid kinase gene and application thereof
CN105861545A (en) * 2016-04-27 2016-08-17 中国烟草总公司郑州烟草研究院 Method for enhancing flavonoid content in tobaccos and enhancing drought resistance of tobaccos and detection method thereof
CN106047905A (en) * 2016-04-15 2016-10-26 中国农业科学院烟草研究所 Chalcone synthetase NtCHS1 gene of tobacco, and application thereof
CN108913702A (en) * 2018-08-13 2018-11-30 青岛农业大学 For improving method, specific primer and the kit of tobacco black shank resistance

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101550420A (en) * 2008-11-25 2009-10-07 云南省烟草科学研究所 Tobacco receptor albuminoid kinase gene and application thereof
CN106047905A (en) * 2016-04-15 2016-10-26 中国农业科学院烟草研究所 Chalcone synthetase NtCHS1 gene of tobacco, and application thereof
CN105861545A (en) * 2016-04-27 2016-08-17 中国烟草总公司郑州烟草研究院 Method for enhancing flavonoid content in tobaccos and enhancing drought resistance of tobaccos and detection method thereof
CN108913702A (en) * 2018-08-13 2018-11-30 青岛农业大学 For improving method, specific primer and the kit of tobacco black shank resistance

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115725643A (en) * 2022-10-19 2023-03-03 河南农业大学 Application of NtMYB35 transcription factor in tobacco black shank resistance
CN115725643B (en) * 2022-10-19 2023-08-15 河南农业大学 Application of NtMYB35 transcription factor in tobacco black shank resistance

Also Published As

Publication number Publication date
CN113151347B (en) 2022-07-19

Similar Documents

Publication Publication Date Title
LI et al. Effect of potassium on ultrastructure of maize stalk pith and young root and their relation to stalk rot resistance
CN110699361B (en) Rice salt stress resistance related gene Os16 and encoding protein and application thereof
WO2022135246A1 (en) R gene for controlling matching of soybean-rhizobium, protein and use thereof
CN110105438A (en) The albumen and application of alfalfa anti-drought gene MsTHI1 and its coding
CN110747210B (en) Application of tea tree glycosyltransferase gene UGT91Q2 in improving cold resistance of plants
CN104327173A (en) Cotton WRKY transcription factor GarWRKY22 for regulating salt tolerance of plants and application thereof
CN110004156A (en) GhCML20 gene relevant to resistance to verticillium wilt and its application
CN113388526A (en) Endophytic fungus FO-R20 and application thereof
CN113151347B (en) Application of tobacco chalcone synthetase NtCHS gene in regulation of tobacco resistance to tobacco black shank bacteria
CN105018501B (en) Application of the arabidopsis AtACS2 genes in terms of cotton drought resisting and precocity
CN110819635A (en) Application of HAN homologous gene of leguminous plant in regulating and controlling number of root nodules of leguminous plant
CN107926549B (en) Method for improving resistance of crops to herbicide bensulfuron methyl by utilizing Piriformospora indica
Jocković et al. Helianthus species as a sources for broomrape resistance
CN103205504A (en) Real-time fluorescence quantification PCR (Polymerase Chain Reaction) method for detecting ustilago scitaminea
CN103451225A (en) Application of rice WRKY transcription factor gene OsWRKY21 in cultivation of resistant varieties of plants
CN115369122A (en) Cucumber CC-type glutaredoxin gene CsGRX1 and application thereof in negative regulation of botrytis cinerea resistance
CN101948870A (en) Method for reducing branch quantity of plant and improving chlorophyll and anthocyanin contents of plant
CN115418410A (en) Defense response and identification method for OsPIL1 transgenic rice line induced by dark inoculation of rice blast fungus
CN111471620B (en) Biocontrol bacterium BV03, application thereof, microbial inoculum and preparation method of microbial inoculum
CN110257254B (en) Biocontrol strain TMN-1 and preparation method and application of biocontrol microbial inoculum
Zhao et al. Azospirillum brasilense activates peroxidase-mediated cell wall modification to inhibit root cell elongation
CN105219785A (en) Comospore poplar PtHSFA4a gene and aminoacid sequence thereof and application
CN112458100A (en) Application of apple HD-Zip I transcription factor gene MdHB-7 in improving plant water utilization efficiency
CN110564813A (en) miRNAs related to highland barley stripe disease and mining method thereof
US20240182918A1 (en) R gene for controlling matching of soybean-rhizobium, protein and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CB03 Change of inventor or designer information

Inventor after: Li Yiting

Inventor after: Sun Mingming

Inventor after: Wang Chengdong

Inventor after: Jiang Caihong

Inventor after: Chen Shuai

Inventor after: Cheng Lirui

Inventor after: Yang Aiguo

Inventor before: Li Yiting

Inventor before: Sun Mingming

Inventor before: Wang Chengdong

Inventor before: Jiang Caihong

Inventor before: Chen Shuai

Inventor before: Cheng Lirui

Inventor before: Yang Aiguo

CB03 Change of inventor or designer information
TR01 Transfer of patent right

Effective date of registration: 20221028

Address after: 266000 Shandong Province, Qingdao city Laoshan District Four Keyuan Road No. 11

Patentee after: INSTITUTE OF TOBACCO RESEARCH OF CAAS, QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO Co.

Patentee after: CHONGQING COMPANY OF CHINA NATIONAL TOBACCO Corp.

Address before: 266000 Shandong Province, Qingdao city Laoshan District Four Keyuan Road No. 11

Patentee before: INSTITUTE OF TOBACCO RESEARCH OF CAAS, QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO Co.

TR01 Transfer of patent right