CN113151304A

CN113151304A - Application of PaNAC089 gene of plane barberry in delaying plant flowering

Info

Publication number: CN113151304A
Application number: CN202110586813.3A
Authority: CN
Inventors: 包满珠; 邵长生; 张佳琪; 蔡芳芳; 石戈辉; 李阳阳; 陈喜燕; 郑胜腾
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-05-27
Filing date: 2021-05-27
Publication date: 2021-07-23
Anticipated expiration: 2041-05-27
Also published as: CN113151304B

Abstract

The present invention belongs to the field of plant gene engineering technology. In particular to application of the PaNAC089 gene of sycamore in delaying plant flowering. The sycamore flowering phase regulatory gene, PaNAC089, which encodes a membrane-anchored transcription factor, was cloned. The full-length sequence of the PaNAC089 gene has no transcription factor function, and the truncated form of the PaNAC089 gene removes a membrane anchor domain and can delay flowering of plants. The nucleotide sequence of the PaNAC089 gene fragment is shown as SEQ ID NO:1 is shown in the specification; the coded protein sequence is shown in SEQ ID NO. 2. The nucleotide sequence of the Δ PaNAC089 fragment is set forth in SEQ ID NO: 3, and the coded protein sequence is shown as SEQ ID NO:4, respectively. Functional verification shows that the delta PaNAC089 gene fragment can delay flowering of plants, and overexpression of the gene in the plants can lead to delayed flowering of transgenic plants.

Description

Application of PaNAC089 gene of plane barberry in delaying plant flowering

Technical Field

The present invention belongs to the field of plant gene engineering technology. In particular to the application of a truncated form of the PaNAC089 gene (delta PaNAC089) of the plane globularis, in delaying the flowering of plants. Specifically, the invention relates to the separation, cloning, functional verification and application of a gene fragment of the two-ball sycamore. The PaNAC089 gene was transferred directly into the model plant Arabidopsis thaliana in a truncated form (i.e., with the membrane anchoring sequence removed), i.e., the Δ PaNAC089 fragment, in conjunction with the cauliflower mosaic virus promoter, and the transgenic plant (Arabidopsis thaliana) exhibited a delayed flowering phenotype.

Background

Plant flowering involves the transition of plants from vegetative to reproductive growth stages, and plays an important role in the process of plant progeny reproduction and ecological adaptation. The influence of multiple regulation and control ways of plant flowering audiences comprises gibberellin ways, photoperiod ways, vernalization ways, autonomous ways and the like. The regulation signals of the pathways are finally integrated by flowering regulation factors such as CO, SOC1, FT and the like, downstream genes such as AP1 and LFY are activated, and plant flowering induction is completed.

Suzuki (Platanus spp.) is a deciduous tree species of the genus Clerodendri of the family Convaliaceae. Only 3 types of cultivation are introduced in China: namely, Platanus occidentalis (also known as Sterculia urens), Platanus x aceifolia Willd (also known as Sterculia urens and Platanus orientalis) and Platanus trifolium (also known as Sterculia urens) in England, and Platanus orientalis (also known as Platanus orientalis). Wherein the two-ball sycamore is a hybrid obtained by hybridizing the one-ball sycamore and the three-ball sycamore, and has good hybrid vigor. Suzuki prefers light, warm and humid climate, and is cold resistant. Because the tree trunk is tall and big, the tree shape is beautiful, the crown is big and the shade is thick, the stress resistance is strong, soil is not selected, the sprouting ability is strong, the heavy shear resistance, the drought resistance, the rapid growth, the adaptability to the urban environment is strong, and the tree has the super-strong abilities of absorbing harmful gas, resisting smoke dust, isolating noise, resisting environmental pollution and the like, is a famous good shade tree and a street tree in the world, is widely applied to urban afforestation, and enjoys the reputation of the king of the street tree. However, the flying wool (floatage) problem (especially the fruit wool) not only causes pollution to the environment, but also influences the life and health of people. Therefore, the method can try to inhibit the sycamore from flowering and fruiting through a genetic engineering method, so as to cultivate the sycamore which does not bloom and does not bear fruits, and fundamentally solve the problem of flying hair (floatage) of the sycamore from the aspects of genetic breeding and germplasm improvement.

Disclosure of Invention

The present invention aims to overcome the disadvantages of the prior art by providing a gene fragment isolated from the sycamore NAC family gene, which applicants have designated as the PaNAC089 gene and a truncated form of this gene, designated Δ PaNAC089 (or referred to as Δ PaNAC089 fragment), for use in the regulation of plant flowering. Sequence analysis indicated that PaNAC089 encodes a membrane-anchored transcription factor (MTTF), whose truncated form (membrane-anchoring domain removed) the Δ PaNAC089 fragment functions as a transcription factor. Biological function verification shows that the gene fragment of the sycamore delta PaNAC089 is related to plant flowering phase regulation.

The technical scheme of the invention is as follows:

the invention provides a gene coding sequence of PaNAC089 expressed in plane bellybutton and a function of a gene truncation form delta PaNAC089 fragment thereof, which specifically comprises the following steps: cloning of the nucleotide coding sequence of the Δ PaNAC089 gene fragment, construction of the Δ PaNAC089 expression vector, and transformation of this gene fragment into arabidopsis thaliana for molecular characterization and phenotypic observation.

Wherein:

(1) the application of a gene fragment delta PaNAC089 from sycamore in regulating and controlling the flowering phase of plants, wherein the nucleotide sequence of the gene fragment is shown as a sequence table SEQ ID NO: 3, respectively. The protein sequence coded by the fragment is shown as SEQ ID NO. 4.

The technical scheme of the invention is as follows:

the present invention first clones a PaNAC089 gene fragment (shown in sequence SEQ ID NO: 1) from Platanus acerifolia Willd using primers P1 and P2. The gene fragment is a DNA molecule with a specific sequence, the open reading frame lengths are 1182bp respectively, and the protein sequence coded by the gene fragment is shown as a sequence table SEQ ID NO:2, respectively.

The invention also designs two pairs of primer combinations, namely a primer P3 and a primer P4, for amplifying the delta PaNAC089 fragment in the sycamore sample. Using this pair of primers, a fragment Δ PaNAC089 was cloned using the PaNAC089 gene, which was successfully sequenced, as a template. The fragment delta PaNAC089 corresponds to the first 1074bp of the open reading frame of the fragment PaNAC089, and the nucleotide sequence of the fragment is shown in a sequence table SEQ ID NO: 3, respectively.

The invention also provides a predicted protein coding sequence of the sycamore delta PaNAC089 gene fragment, wherein the gene codes 357 amino acid residues, and the sequence of the corresponding protein is shown as SEQ ID NO:4, respectively.

DNA sequence information of primer combinations (primer pairs):

the forward primer P1:5'GCTGTAAAACGAAAGGGTAGGAGGC 3',

reverse primer P2:5'AGAAACCCCACAGCCCTATGTTCAC 3';

the forward primer P3:5'ATGGCGGACACTTCTCGGTTC 3',

reverse primer P4:5'TTAGTTCTTGACTGTCCAAACTG 3';

the invention also provides a primer combination (primer pair) for detecting the expression of the Platanus occidentalis PaNAC089 gene fragment in transgenic Arabidopsis as shown in the specification. The primers are designed according to the nucleic acid sequence of the PaNAC089 gene fragment, the primer combination is utilized to carry out RT-PCR amplification on the cDNA of a transformed arabidopsis sample, whether the gene is expressed in transgenic arabidopsis is detected, and 82bp gene fragments are obtained respectively. The DNA sequences of these primer combinations (primer pairs) are as follows:

the forward primer P5:5'GGGAGAGGACAGATTGGATAA 3',

reverse primer P6:5'GTCCGAAGGCGACAAACAACA 3';

any vector capable of guiding the expression of a foreign gene in a plant can be used to introduce the coding sequence of the cloned Δ PaNAC089 into plant cells or tissues by conventional biotechnological means such as direct DNA transformation, gene gun or agrobacterium mediation, and the transformed plant tissues are cultivated into plants. When the gene fragment of the present invention is used to construct a plant expression vector, any one of an enhanced promoter and a specific promoter may be added in front of the transcription initiation nucleotide sequence. In order to facilitate the identification and selection of transgenic plant cells or plants, the vectors used may be appropriately processed and modified, for example, by adding antibiotic marker genes having resistance (e.g., kanamycin or hygromycin at an appropriate concentration) to improve the efficiency of gene selection.

Drawings

FIG. 1: is an intermediate vector to which the present invention relates

18 and a schematic structure of the recombinant plasmid. Description of reference numerals: FIG. 1A shows a primary intermediate carrier

18; FIG. 1B is

18-PaNAC089 recombinant plasmid map; FIG. 1C shows

18- Δ PaNAC089 recombinant plasmid map.

FIG. 2: is a structural schematic diagram of an excessive plant expression vector pCAMBIA2300s and a recombinant plasmid related to the invention. Description of reference numerals: FIG. 2A is a diagram of an original carrier; FIG. 2B is a diagram of pCAMBIA2300s- Δ PaNAC089 recombinant plasmid

FIG. 3: comparison of flowering time of control arabidopsis thaliana with that of arabidopsis thaliana transformed with Δ PaNAC089 gene. Description of reference numerals: FIG. 3A: CK and a transgenic line flowering chart; FIG. 3B: the growth days of CK plants and transgenic lines and the number of rosette leaves during flowering.

FIG. 4: delta PaNAC089 expression level in transgenic lines. Description of reference numerals: FIG. 4, left: expression quantification profiles; fig. 4 right: expression level semiquantitative graph.

FIG. 5: the result of the expression quantity of the gene of the arabidopsis thaliana origin gene in the transgenic line positively regulating and controlling the flowering phase is obtained.

Detailed Description

Description of the sequence listing:

sequence listing SEQ ID NO:1 is an isolated cloned PaNAC089 gene fragment of the invention. The total length of the sequence is 1182 bp.

Sequence listing SEQ ID NO:2 is the protein sequence (excluding the start codon and terminator sequences) encoded by the fragment of the PaNAC089 gene of the present invention.

Sequence listing SEQ ID NO: 3 is an isolated cloned Δ PaNAC089 fragment of the invention. The total length of the sequence is 1074 bp.

Sequence listing SEQ ID NO:4 is the protein sequence (excluding the start codon and the terminator sequence) encoded by the isolated cloned Δ PaNAC089 fragment of the invention.

Example 1: isolation and cloning of PaNAC089 Gene

The earlier research of the invention carries out transcriptome sequencing on a mixed sample of different parts of the plane barberry, obtains the full-length sequence of the PaNAC089 gene in the transcriptome sequencing result, designs a specific primer P1 (forward primer) and a specific primer P2 (reverse primer), amplifies 1-1329bp of the sequencing sequence from cDNA obtained by reverse transcription of the plane barberry leaf RNA, and specifically amplifies the obtained fragments as follows (the sequence of the following DNA fragment is a schematic diagram) (the ATG at the underline is an initiation codon and the TAA is a termination codon):

GCTGTAAAACGAAAGGGTAGGAGGCAAGCAAGTAATTAGACCTTGGAAGCAAGTTCGTTCTCTGTTGAGATGTCTCTGTTTTGCAGAGATACTTCGATTTCCAATGGCGGACACTTCTCGGTTCCCCGGTTTTAGATTTTGCCCAACCGACGATGAACTGATTTCTTACTATCTGAATCGGAAGATCGAGGGTCTGGAGAAGAGCGTTGAAGTGATTTCGGAGGTTGATCTCTGTAAACACGAGCCTTGGGACTTACCAGACAAATCCGTCATTCAATCGGACCATGAGTGGTTCTTCTTTGCTCCTCGCGGGAGGAAATACCCAAATGGCTCGCAAACAAAGAGGGCCACCGAAACCGGTTACTGGAAAGCAACTGGGAAAGAGCGTCCCGTCAAGTCGGCTTCCCGTTTGAGCGGTACGAAACGGACTCTTGTGTTCCACAAAGGGCGTGCGCCGGAAGGGGAGAGGACAGATTGGATAATGCATGAGTACTCTATCAAAGGAAAATCCCAGGATTCTTTTGTTGTTTGTCGCCTTCGGACAAAGAATGGTGTGAAGGGTAACAGTCTGAACTGCAAGTCAGAAAGCCAAAGAGATTTATCACCTACAAATGCTGGTCTTTCTTCTGTGTCTCTAGGCTGTAGTGACACGAAGCAGCCACAATTGGGATTGCATGAAGAGGGAAAAGACAATGAATGCTGCTCAGGGAAGCAGGGAAGCATTTCACATTCTCCTTTTATAGACCAGATTGATTCTACATCTGACTCTGTTCAGGATCTACCTGATGGAACATGCTCTCCTCAGTCAGACTCTGTGATCACCCAGAAGGATTGGAATGCAGAAGACGAATGTTTTGCTGAAATTATGAAAGAAGATATCATCAAGCTTGATTACTTTTCATTGCAAGAAACTCCTTTACAGTTGCGAGAAGTTGCGGAGAAGTATGCGACTGAGAGAATATCTAAACATCAGGCTGACACAGTTGGATCAAATGTGCTTCCCTTCCAAGGGACAGCACAACGCAGGATCAGATTGCAAGAACATAAAGTAGGGTTTTATCGTGCAAAGAAACTGGAAGTCGGCAATGAGGATTGTGCAGAGAAAGTGATCTGGGGCGATGCAAAGCAGTGGTTGAAAGGCACGAGGATTAGAATTTCAGTTTGGACAGTCAAGAACAGGCTCATATTTACGGTTTTACTAGTCATGGCTTTGCTGGTTTTGTTTCTGCTGAAGCTCAGAGAGATCAGTCATCACAAAATGTTTATATCTAATATCATGTCGTAAGGAGTTCTGGGTGATGAATGTGAACATAGGGCTGTGGGGTTTCT

the nucleotide sequence of 104-52 1285bp in the amplification product is the full-length PaNAC089 sequence cloned by the invention, wherein 104-1177bp is a truncated sequence delta PaNAC089 fragment of the PaNAC089 gene.

The specific operation steps are as follows:

(1) the method adopts a commonly used CTAB method (refer to plant genetic engineering, Wangguan, Main weaving of Square-Honghun Yun) to extract total RNA of leaves from the leaves of the Artocarpus bicolor, and comprises the following specific steps:

1) taking a proper amount of CTAB (hexadecyl trimethyl ammonium bromide) extraction buffer solution (2 percent (W/V) CTAB, 1.4mol/L NaCl, 20mmol/L EDTA (ethylene diamine tetraacetic acid), 100mmol/L Tris & Cl, 2 percent (W/V) pvp) and 2 percent beta-mercaptoethanol, and preheating the buffer solution in a water bath kettle at 65 ℃;

2) grinding the leaves of Platanus acerifolia into powder with liquid nitrogen, adding 4ml of preheated extracting solution, mixing, and water-bathing at 65 deg.C for 5 min;

3) equal volume of chloroform was added: mixing isoamyl alcohol (volume ratio 24: 1), reversing, mixing, standing for 5min, and centrifuging at 4 ℃ at 10000rpm/min for 10 min;

4) taking 3ml of supernatant, and repeating the step 3);

5) taking the supernatant, adding LiCl with the final concentration of 2mol/L, precipitating for 10-12 hours at-20 ℃, centrifuging for 10 minutes at 4 ℃ and 10000rpm/min, discarding the supernatant, washing the precipitate twice with 75% ethanol, and dissolving in appropriate amount of DEPC (diethyl pyrocarbonate) processing water for later use;

6) the total leaf RNA extracted from sycamore is used as a template, and is reversely transcribed into a cDNA first strand by reverse transcriptase (purchased from Takara Shuzo Co., Ltd.) under the reaction conditions of: 42 ℃ for 2min,37 ℃ for 15min, 85 ℃ for 5s (refer to Takara reverse transcription kit instructions);

7) PaNAC089 was amplified from cDNA reverse transcribed from the RNA of the leaf of Dolichos bicolor, using specific primers P1 (forward primer) + P2 (reverse primer) designed based on the sequence in the transcriptional sequencing. Using this as template, Δ PaNAC089 was cloned using primer P3 (forward primer) + P4 (reverse primer). Reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; 94 ℃ for 30sec, Tm (59 ℃, 58 ℃, 63 ℃) for 30sec,72 ℃ for 30s,37 cycles; extending for 10min at 72 ℃;

8) ligating the PCR product obtained by amplification

18-T vector (purchased from Takara Bio-engineering Ltd.), screening positive clones and sequencing to obtain the desired full length of the gene. The obtained clone was named

18-PaNAC089，

18- Δ PaNAC089 plasmid (see FIG. 1B, FIG. 1C for plasmid map construction).

(2) The specific steps of construction of the Δ PaNAC089 overexpression vector are as follows:

1) sequencing of the Δ PanAC089 Gene fragment with the fast-cutting enzymes KpnI and SalI

The 18- Δ PaNAC089 plasmid was excised and purified using a kit to recover the Δ PaNAC089 gene fragment. The overexpression vector pCAMBIA2300s (P2300) was digested simultaneously with the fast-cutting enzymes KpnI and SalI and purified and recovered.

2) The delta PaNAC089 gene fragment recovered by enzyme digestion and purification is fused with the super-expression vector P2300 by using T4 ligase. The fusion condition is 16 ℃, and the reaction lasts 8-16 h.

3) Heat shock the ligation solution of step 2) into the e.coli strain EH5 a. The method comprises the following steps: the connecting liquid and EH5a are subjected to competent mixing and ice bath for 30min under the aseptic condition; ② 90S at 42 ℃; ③ carrying out ice bath for 5 min; adding liquid LB into the mixture, and shaking the mixture at 37 ℃ for 200 r.min-warm bath for 1 h; fifthly, the bacterial liquid in the step (iv) is coated on LB culture medium with ampicillin resistance and cultured for 10h at 37 ℃.

4) Detecting the single colony obtained in the step 3) by using a primer 35sF and a P4 reverse primer; and obtaining positive strains to obtain the successfully constructed delta PaNAC089-P2300 super-surface vector.

(3) Transformation of Arabidopsis thaliana by the flower-soaking method of Δ PaNAC089

1) The Δ PaNAC089-P2300 overexpression vector was used to transform Agrobacterium strain GV3101 using a heat shock method. The method comprises the following steps: mixing delta PaNAC089-P2300 plasmid with GV3101 competence under aseptic condition, ice-bath for 5 min; ② placing the mixed solution into liquid nitrogen for 5 min; ③ 5min at 37 ℃ of the mixed solution; fourthly, the mixed solution is iced for 5 min; adding liquid LB into the mixed solution, placing the mixed solution at the temperature of 28 ℃ for 200r.min, and carrying out warm bath on a shaking table for 1 h; sixthly, smearing the mixed solution on LB culture medium with kala resistance for culturing for 36h at 28 ℃. Seventhly, detecting the single colony obtained in the step (c) by using primers 35sF and P4 reverse primers, and obtaining positive bacteria.

2) Selecting positive GV3101 strain, inoculating into Kana resistant liquid LB, and standing at 28 deg.C for 200r.min^-Shaking overnight.

3) Sucking 1ml of the overnight cultured GV3101 bacterial liquid, adding into 30ml of Kana resistant liquid LB, and standing at 28 deg.C for 200r.min^-Shaking culture to OD 0.8.

4) 5000r.min of the bacterial liquid in the step 3)^-The cells were harvested and resuspended to OD 0.8 using a resuspension (5% sucrose + arabidopsis thaliana helper transformation reagent).

5) Soaking the arabidopsis inflorescence in the bacterial liquid resuspended in the step 4) for 90s, and carrying out dark culture overnight.

(4) Screening positive plants

1) Preparing and screening an MS culture medium: basal MS medium (commonly used MS medium) +50mg.L^-Kanamycin +50mg.L^-And (3) the cefamycin.

2) Seed disinfection: placing the obtained arabidopsis seeds in a 1.5ml centrifuge tube under the aseptic condition, and adding 75% alcohol for disinfection for 10 min; (② washing twice with pure alcohol; and thirdly washing 5-6 times with sterile water.

3) The disinfected seeds are sown on the screening MS culture medium on a clean bench, then are vernalized in a refrigerator at 4 ℃ for 2 days, and are transferred to a refrigerator at 23 ℃ for 16h/8h for long-day culture.

(5) Positive plant phenotype description

Experiments show that delta PaNAC089 positive plants show an obvious late flowering phenotype. Flowering time was measured as the height of the inflorescence as 1 cm. Statistical results of T3 generation homozygous plant phenotypes were as follows: the average flowering time of Control (CK) (transformed P2300-unloaded arabidopsis plants) plants was 26.2 d; the flowering time of Δ PaNAC089 transgenic line OE1, 2, 4 was 37.3d, 36.6d and 38.8d, respectively. In addition, the applicant also counted the number of rosette leaves of CK and transgenic lines at flowering: the number of rosette leaves at flowering Control (CK) was 12.4; at flowering time Δ PaNAC089 transgenic line OE1, 2, 4 had rosette leaf numbers of 23, 21.8 and 24.7 leaves, respectively.

In conclusion, functional verification shows that the delta PaNAC089 gene fragment can delay flowering of plants, and overexpression of the gene in the plants can lead to delayed flowering of transgenic plants.

Sequence listing

<110> university of agriculture in Huazhong

<120> application of PaNAC089 gene of plane barberry in delaying plant flowering

<141> 2021-05-27

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1182

<212> DNA

<213> Suzuki (Platanus spp.)

<220>

<221> gene

<222> (1)..(1182)

<220>

<221> CDS

<222> (4)..(1179)

<400> 1

atg gcg gac act tct cgg ttc ccc ggt ttt aga ttt tgc cca acc gac 48

Ala Asp Thr Ser Arg Phe Pro Gly Phe Arg Phe Cys Pro Thr Asp

1 5 10 15

gat gaa ctg att tct tac tat ctg aat cgg aag atc gag ggt ctg gag 96

Asp Glu Leu Ile Ser Tyr Tyr Leu Asn Arg Lys Ile Glu Gly Leu Glu

20 25 30

aag agc gtt gaa gtg att tcg gag gtt gat ctc tgt aaa cac gag cct 144

Lys Ser Val Glu Val Ile Ser Glu Val Asp Leu Cys Lys His Glu Pro

35 40 45

tgg gac tta cca gac aaa tcc gtc att caa tcg gac cat gag tgg ttc 192

Trp Asp Leu Pro Asp Lys Ser Val Ile Gln Ser Asp His Glu Trp Phe

50 55 60

ttc ttt gct cct cgc ggg agg aaa tac cca aat ggc tcg caa aca aag 240

Phe Phe Ala Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln Thr Lys

65 70 75

agg gcc acc gaa acc ggt tac tgg aaa gca act ggg aaa gag cgt ccc 288

Arg Ala Thr Glu Thr Gly Tyr Trp Lys Ala Thr Gly Lys Glu Arg Pro

80 85 90 95

gtc aag tcg gct tcc cgt ttg agc ggt acg aaa cgg act ctt gtg ttc 336

Val Lys Ser Ala Ser Arg Leu Ser Gly Thr Lys Arg Thr Leu Val Phe

100 105 110

cac aaa ggg cgt gcg ccg gaa ggg gag agg aca gat tgg ata atg cat 384

His Lys Gly Arg Ala Pro Glu Gly Glu Arg Thr Asp Trp Ile Met His

115 120 125

gag tac tct atc aaa gga aaa tcc cag gat tct ttt gtt gtt tgt cgc 432

Glu Tyr Ser Ile Lys Gly Lys Ser Gln Asp Ser Phe Val Val Cys Arg

130 135 140

ctt cgg aca aag aat ggt gtg aag ggt aac agt ctg aac tgc aag tca 480

Leu Arg Thr Lys Asn Gly Val Lys Gly Asn Ser Leu Asn Cys Lys Ser

145 150 155

gaa agc caa aga gat tta tca cct aca aat gct ggt ctt tct tct gtg 528

Glu Ser Gln Arg Asp Leu Ser Pro Thr Asn Ala Gly Leu Ser Ser Val

160 165 170 175

tct cta ggc tgt agt gac acg aag cag cca caa ttg gga ttg cat gaa 576

Ser Leu Gly Cys Ser Asp Thr Lys Gln Pro Gln Leu Gly Leu His Glu

180 185 190

gag gga aaa gac aat gaa tgc tgc tca ggg aag cag gga agc att tca 624

Glu Gly Lys Asp Asn Glu Cys Cys Ser Gly Lys Gln Gly Ser Ile Ser

195 200 205

cat tct cct ttt ata gac cag att gat tct aca tct gac tct gtt cag 672

His Ser Pro Phe Ile Asp Gln Ile Asp Ser Thr Ser Asp Ser Val Gln

210 215 220

gat cta cct gat gga aca tgc tct cct cag tca gac tct gtg atc acc 720

Asp Leu Pro Asp Gly Thr Cys Ser Pro Gln Ser Asp Ser Val Ile Thr

225 230 235

cag aag gat tgg aat gca gaa gac gaa tgt ttt gct gaa att atg aaa 768

Gln Lys Asp Trp Asn Ala Glu Asp Glu Cys Phe Ala Glu Ile Met Lys

240 245 250 255

gaa gat atc atc aag ctt gat tac ttt tca ttg caa gaa act cct tta 816

Glu Asp Ile Ile Lys Leu Asp Tyr Phe Ser Leu Gln Glu Thr Pro Leu

260 265 270

cag ttg cga gaa gtt gcg gag aag tat gcg act gag aga ata tct aaa 864

Gln Leu Arg Glu Val Ala Glu Lys Tyr Ala Thr Glu Arg Ile Ser Lys

275 280 285

cat cag gct gac aca gtt gga tca aat gtg ctt ccc ttc caa ggg aca 912

His Gln Ala Asp Thr Val Gly Ser Asn Val Leu Pro Phe Gln Gly Thr

290 295 300

gca caa cgc agg atc aga ttg caa gaa cat aaa gta ggg ttt tat cgt 960

Ala Gln Arg Arg Ile Arg Leu Gln Glu His Lys Val Gly Phe Tyr Arg

305 310 315

gca aag aaa ctg gaa gtc ggc aat gag gat tgt gca gag aaa gtg atc 1008

Ala Lys Lys Leu Glu Val Gly Asn Glu Asp Cys Ala Glu Lys Val Ile

320 325 330 335

tgg ggc gat gca aag cag tgg ttg aaa ggc acg agg att aga att tca 1056

Trp Gly Asp Ala Lys Gln Trp Leu Lys Gly Thr Arg Ile Arg Ile Ser

340 345 350

gtt tgg aca gtc aag aac agg ctc ata ttt acg gtt tta cta gtc atg 1104

Val Trp Thr Val Lys Asn Arg Leu Ile Phe Thr Val Leu Leu Val Met

355 360 365

gct ttg ctg gtt ttg ttt ctg ctg aag ctc aga gag atc agt cat cac 1152

Ala Leu Leu Val Leu Phe Leu Leu Lys Leu Arg Glu Ile Ser His His

370 375 380

aaa atg ttt ata tct aat atc atg tcg taa 1182

Lys Met Phe Ile Ser Asn Ile Met Ser

385 390

<210> 2

<211> 392

<212> PRT

<213> Suzuki (Platanus spp.)

<400> 2

Ala Asp Thr Ser Arg Phe Pro Gly Phe Arg Phe Cys Pro Thr Asp Asp

1 5 10 15

Glu Leu Ile Ser Tyr Tyr Leu Asn Arg Lys Ile Glu Gly Leu Glu Lys

20 25 30

Ser Val Glu Val Ile Ser Glu Val Asp Leu Cys Lys His Glu Pro Trp

35 40 45

Asp Leu Pro Asp Lys Ser Val Ile Gln Ser Asp His Glu Trp Phe Phe

50 55 60

Phe Ala Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln Thr Lys Arg

65 70 75 80

Ala Thr Glu Thr Gly Tyr Trp Lys Ala Thr Gly Lys Glu Arg Pro Val

85 90 95

Lys Ser Ala Ser Arg Leu Ser Gly Thr Lys Arg Thr Leu Val Phe His

100 105 110

Lys Gly Arg Ala Pro Glu Gly Glu Arg Thr Asp Trp Ile Met His Glu

115 120 125

Tyr Ser Ile Lys Gly Lys Ser Gln Asp Ser Phe Val Val Cys Arg Leu

130 135 140

Arg Thr Lys Asn Gly Val Lys Gly Asn Ser Leu Asn Cys Lys Ser Glu

145 150 155 160

Ser Gln Arg Asp Leu Ser Pro Thr Asn Ala Gly Leu Ser Ser Val Ser

165 170 175

Leu Gly Cys Ser Asp Thr Lys Gln Pro Gln Leu Gly Leu His Glu Glu

180 185 190

Gly Lys Asp Asn Glu Cys Cys Ser Gly Lys Gln Gly Ser Ile Ser His

195 200 205

Ser Pro Phe Ile Asp Gln Ile Asp Ser Thr Ser Asp Ser Val Gln Asp

210 215 220

Leu Pro Asp Gly Thr Cys Ser Pro Gln Ser Asp Ser Val Ile Thr Gln

225 230 235 240

Lys Asp Trp Asn Ala Glu Asp Glu Cys Phe Ala Glu Ile Met Lys Glu

245 250 255

Asp Ile Ile Lys Leu Asp Tyr Phe Ser Leu Gln Glu Thr Pro Leu Gln

260 265 270

Leu Arg Glu Val Ala Glu Lys Tyr Ala Thr Glu Arg Ile Ser Lys His

275 280 285

Gln Ala Asp Thr Val Gly Ser Asn Val Leu Pro Phe Gln Gly Thr Ala

290 295 300

Gln Arg Arg Ile Arg Leu Gln Glu His Lys Val Gly Phe Tyr Arg Ala

305 310 315 320

Lys Lys Leu Glu Val Gly Asn Glu Asp Cys Ala Glu Lys Val Ile Trp

325 330 335

Gly Asp Ala Lys Gln Trp Leu Lys Gly Thr Arg Ile Arg Ile Ser Val

340 345 350

Trp Thr Val Lys Asn Arg Leu Ile Phe Thr Val Leu Leu Val Met Ala

355 360 365

Leu Leu Val Leu Phe Leu Leu Lys Leu Arg Glu Ile Ser His His Lys

370 375 380

Met Phe Ile Ser Asn Ile Met Ser

385 390

<210> 3

<211> 1077

<212> DNA

<213> Suzuki (Platanus spp.)

<220>

<221> gene

<222> (1)..(1077)

<220>

<221> CDS

<222> (4)..(1074)

<400> 3

atg gcg gac act tct cgg ttc ccc ggt ttt aga ttt tgc cca acc gac 48

Ala Asp Thr Ser Arg Phe Pro Gly Phe Arg Phe Cys Pro Thr Asp

1 5 10 15

gat gaa ctg att tct tac tat ctg aat cgg aag atc gag ggt ctg gag 96

Asp Glu Leu Ile Ser Tyr Tyr Leu Asn Arg Lys Ile Glu Gly Leu Glu

20 25 30

aag agc gtt gaa gtg att tcg gag gtt gat ctc tgt aaa cac gag cct 144

Lys Ser Val Glu Val Ile Ser Glu Val Asp Leu Cys Lys His Glu Pro

35 40 45

tgg gac tta cca gac aaa tcc gtc att caa tcg gac cat gag tgg ttc 192

Trp Asp Leu Pro Asp Lys Ser Val Ile Gln Ser Asp His Glu Trp Phe

50 55 60

ttc ttt gct cct cgc ggg agg aaa tac cca aat ggc tcg caa aca aag 240

Phe Phe Ala Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln Thr Lys

65 70 75

agg gcc acc gaa acc ggt tac tgg aaa gca act ggg aaa gag cgt ccc 288

Arg Ala Thr Glu Thr Gly Tyr Trp Lys Ala Thr Gly Lys Glu Arg Pro

80 85 90 95

gtc aag tcg gct tcc cgt ttg agc ggt acg aaa cgg act ctt gtg ttc 336

Val Lys Ser Ala Ser Arg Leu Ser Gly Thr Lys Arg Thr Leu Val Phe

100 105 110

cac aaa ggg cgt gcg ccg gaa ggg gag agg aca gat tgg ata atg cat 384

His Lys Gly Arg Ala Pro Glu Gly Glu Arg Thr Asp Trp Ile Met His

115 120 125

gag tac tct atc aaa gga aaa tcc cag gat tct ttt gtt gtt tgt cgc 432

Glu Tyr Ser Ile Lys Gly Lys Ser Gln Asp Ser Phe Val Val Cys Arg

130 135 140

ctt cgg aca aag aat ggt gtg aag ggt aac agt ctg aac tgc aag tca 480

Leu Arg Thr Lys Asn Gly Val Lys Gly Asn Ser Leu Asn Cys Lys Ser

145 150 155

gaa agc caa aga gat tta tca cct aca aat gct ggt ctt tct tct gtg 528

Glu Ser Gln Arg Asp Leu Ser Pro Thr Asn Ala Gly Leu Ser Ser Val

160 165 170 175

tct cta ggc tgt agt gac acg aag cag cca caa ttg gga ttg cat gaa 576

Ser Leu Gly Cys Ser Asp Thr Lys Gln Pro Gln Leu Gly Leu His Glu

180 185 190

gag gga aaa gac aat gaa tgc tgc tca ggg aag cag gga agc att tca 624

Glu Gly Lys Asp Asn Glu Cys Cys Ser Gly Lys Gln Gly Ser Ile Ser

195 200 205

cat tct cct ttt ata gac cag att gat tct aca tct gac tct gtt cag 672

His Ser Pro Phe Ile Asp Gln Ile Asp Ser Thr Ser Asp Ser Val Gln

210 215 220

gat cta cct gat gga aca tgc tct cct cag tca gac tct gtg atc acc 720

Asp Leu Pro Asp Gly Thr Cys Ser Pro Gln Ser Asp Ser Val Ile Thr

225 230 235

cag aag gat tgg aat gca gaa gac gaa tgt ttt gct gaa att atg aaa 768

Gln Lys Asp Trp Asn Ala Glu Asp Glu Cys Phe Ala Glu Ile Met Lys

240 245 250 255

gaa gat atc atc aag ctt gat tac ttt tca ttg caa gaa act cct tta 816

Glu Asp Ile Ile Lys Leu Asp Tyr Phe Ser Leu Gln Glu Thr Pro Leu

260 265 270

cag ttg cga gaa gtt gcg gag aag tat gcg act gag aga ata tct aaa 864

Gln Leu Arg Glu Val Ala Glu Lys Tyr Ala Thr Glu Arg Ile Ser Lys

275 280 285

cat cag gct gac aca gtt gga tca aat gtg ctt ccc ttc caa ggg aca 912

His Gln Ala Asp Thr Val Gly Ser Asn Val Leu Pro Phe Gln Gly Thr

290 295 300

gca caa cgc agg atc aga ttg caa gaa cat aaa gta ggg ttt tat cgt 960

Ala Gln Arg Arg Ile Arg Leu Gln Glu His Lys Val Gly Phe Tyr Arg

305 310 315

gca aag aaa ctg gaa gtc ggc aat gag gat tgt gca gag aaa gtg atc 1008

Ala Lys Lys Leu Glu Val Gly Asn Glu Asp Cys Ala Glu Lys Val Ile

320 325 330 335

tgg ggc gat gca aag cag tgg ttg aaa ggc acg agg att aga att tca 1056

Trp Gly Asp Ala Lys Gln Trp Leu Lys Gly Thr Arg Ile Arg Ile Ser

340 345 350

gtt tgg aca gtc aag aac taa 1077

Val Trp Thr Val Lys Asn

355

<210> 4

<211> 357

<212> PRT

<213> Suzuki (Platanus spp.)

<400> 4

Ala Asp Thr Ser Arg Phe Pro Gly Phe Arg Phe Cys Pro Thr Asp Asp

1 5 10 15

Glu Leu Ile Ser Tyr Tyr Leu Asn Arg Lys Ile Glu Gly Leu Glu Lys

20 25 30

Ser Val Glu Val Ile Ser Glu Val Asp Leu Cys Lys His Glu Pro Trp

35 40 45

Asp Leu Pro Asp Lys Ser Val Ile Gln Ser Asp His Glu Trp Phe Phe

50 55 60

Phe Ala Pro Arg Gly Arg Lys Tyr Pro Asn Gly Ser Gln Thr Lys Arg

65 70 75 80

Ala Thr Glu Thr Gly Tyr Trp Lys Ala Thr Gly Lys Glu Arg Pro Val

85 90 95

Lys Ser Ala Ser Arg Leu Ser Gly Thr Lys Arg Thr Leu Val Phe His

100 105 110

Lys Gly Arg Ala Pro Glu Gly Glu Arg Thr Asp Trp Ile Met His Glu

115 120 125

Tyr Ser Ile Lys Gly Lys Ser Gln Asp Ser Phe Val Val Cys Arg Leu

130 135 140

Arg Thr Lys Asn Gly Val Lys Gly Asn Ser Leu Asn Cys Lys Ser Glu

145 150 155 160

Ser Gln Arg Asp Leu Ser Pro Thr Asn Ala Gly Leu Ser Ser Val Ser

165 170 175

Leu Gly Cys Ser Asp Thr Lys Gln Pro Gln Leu Gly Leu His Glu Glu

180 185 190

Gly Lys Asp Asn Glu Cys Cys Ser Gly Lys Gln Gly Ser Ile Ser His

195 200 205

Ser Pro Phe Ile Asp Gln Ile Asp Ser Thr Ser Asp Ser Val Gln Asp

210 215 220

Leu Pro Asp Gly Thr Cys Ser Pro Gln Ser Asp Ser Val Ile Thr Gln

225 230 235 240

Lys Asp Trp Asn Ala Glu Asp Glu Cys Phe Ala Glu Ile Met Lys Glu

245 250 255

Asp Ile Ile Lys Leu Asp Tyr Phe Ser Leu Gln Glu Thr Pro Leu Gln

260 265 270

Leu Arg Glu Val Ala Glu Lys Tyr Ala Thr Glu Arg Ile Ser Lys His

275 280 285

Gln Ala Asp Thr Val Gly Ser Asn Val Leu Pro Phe Gln Gly Thr Ala

290 295 300

Gln Arg Arg Ile Arg Leu Gln Glu His Lys Val Gly Phe Tyr Arg Ala

305 310 315 320

Lys Lys Leu Glu Val Gly Asn Glu Asp Cys Ala Glu Lys Val Ile Trp

325 330 335

Gly Asp Ala Lys Gln Trp Leu Lys Gly Thr Arg Ile Arg Ile Ser Val

340 345 350

Trp Thr Val Lys Asn

355

Claims

1. The application of a truncated form delta PaNAC089 fragment of PaNAC089 gene fragment of the Platanus occidentalis shown in a sequence table SEQ ID NO:1 in delaying plant flowering through overexpression is characterized in that a protein sequence coded by the delta PaNAC089 fragment is shown in the sequence table SEQ ID NO:4, respectively.

2. The use as claimed in claim 1, wherein the plant is Arabidopsis thaliana.