CN113151149A

CN113151149A - Method for economically, simply and conveniently inducing lung organoid and establishment of experimental model

Info

Publication number: CN113151149A
Application number: CN202110262480.9A
Authority: CN
Inventors: 李秋伶; 乔玉龙; 赵健; 伍慧晴
Original assignee: Anhui University
Current assignee: Anhui University
Priority date: 2021-03-10
Filing date: 2021-03-10
Publication date: 2021-07-23
Anticipated expiration: 2041-03-10
Also published as: CN113151149B

Abstract

The invention provides an economical and simple culture method and an experimental model of lung organs, and relates to the technical field of biology. The method simulates the natural growth environment and mode of cells in vivo, and can realize the acquisition of the lung bronchial organs without adding exogenous growth factors. The mouse lung organoid can be used as an experimental model and used for research on lung development process, cell differentiation, lung toxicology, drug screening, organ regeneration, transplantation and the like.

Description

Method for economically, simply and conveniently inducing lung organoid and establishment of experimental model

Technical Field

The invention relates to the technical field of biology, in particular to a method for inducing mouse lung organoids economically, simply and conveniently in vitro, an experimental model and a culture medium composition used by the method.

Background

With the development of life science, the in vitro replication and reconstruction of lung organoids has become one of the important research directions in the fields of research on lung development, disease occurrence, drug screening, organ transplantation, precise treatment and the like. Lung organoids are small tissues structurally and functionally similar to the lungs formed by the induced differentiation of stem cells or lung progenitor cells in vitro using three-dimensional (3D) culture techniques, have stable phenotypic and genetic characteristics, and can be cultured in vitro for long periods of time. Compared with a two-dimensional (2D) cell culture model, the lung organoids cultured in a 3D mode contain multiple cell types, the simple physical contact relation between cells is broken through, the cells are promoted to cooperatively develop, functional micro lung tissues are formed, and the occurrence process and the physiological pathological state of organ tissues can be better understood under the physiologically relevant background, so that the lung organoids have wide application prospects in the aspects of lung-related basic research and lung disease clinical research.

Currently, respiratory organoids have been successfully induced using human pluripotent stem cells (hpscs) or lung tissue progenitors, and these organoids can mimic respiratory and pulmonary functions. In 2015, scientists first obtained lung organoids from human stem cells by using culture media rich in various growth factors to simulate the growth and development environment in the lung (see reference 1). A study published by Hans-Willem Snoeck professor and research team of Columbia university medical center in 2017, Nature Cell Biology, shows that human pluripotent stem cells are cultured in a culture solution containing Fgf10, KGF, Noggin, Insulin, retinoic acid and other factors, and that lung organs including branched airway and alveolar structures are generated by culturing the cells with varying concentrations of the factors at different culture stages, similar to human lung tissues (see references 2-3). Researchers from research institutions such as the Wildconnel medical college, Chicago university, Columbia university, and China Shanghai transportation university reported in Nature at 11.2020, who developed a new lung organoid using hPSC and used this organoid for SARS-CoV-2 biological characterization and drug screening studies to identify drug candidates against COVID-19 (see reference 4). In the mouse organoid study, Brigid L M Hogan team of the university of Duke medical center and Wellington V CardosoLaboratory, by inducing mouse airway region stem cells, in vitro culture formationHollow sphere lung organoids, induced to differentiate, contain Clara cells with secretory function and ciliated cells with scavenging function (see references 5-7). The lung organoid model was successfully constructed using basal cells isolated from the mouse upper bronchi over several weeks, the organoid cancer model was established, and molecular biological analyses were simultaneously performed on the normal and tissue repair status of the organoids, respectively (see references 8-9). The research shows that the establishment of a lung organoid culture model makes people make remarkable scientific progress in the aspects of lung basic research, disease drug screening and the like.

In conclusion, the lung organoid has the advantages which are incomparable with the traditional cell and animal model, and has wide application prospect in the fields of lung development process, cell differentiation, lung toxicology, drug screening, organ regeneration, transplantation and the like. However, since lung organoids are formed by the development and differentiation of individual cells in vitro, the physiological environment of lung tissues is lacking during the culture process, and various growth factors and chemical components need to be artificially added to create a microenvironment similar to the existence of lung interstitial cells. Most of the required growth factors and biological components are expensive and difficult to obtain, and the effective components and activity of the growth factors and the biological components cannot be guaranteed, so that the problems of high culture cost and high requirement on culture technology of the conventional lung organoid culture are caused, and the application of the growth factors and the biological components in multiple research fields is severely limited.

The references are as follows:

1.Dye, B. R., et al. (2015). "In vitro generation of human pluripotent stem cell derived lung organoids." eLife4.

2.Chen, Y.-W., et al. (2017). "A three-dimensional model of human lung development and disease from pluripotent stem cells." Nature Cell Biology19(5): 542-549.

H-W Sinoko Y-W Chen generation of lung bud organoids with branched structures and their use for lung disease modeling. Application publication No.: CN 110494555 a.

4.Han, Y. L.,et al.( 2020) .“Identification of SARS-CoV-2 Inhibitors using Lung and Colonic Organoids.”.Nature 2020.

5.Tadokoro, T S. Y.; et al. ( 2014) “IL-6/STAT3 promotes regeneration of airway ciliated cells from basal stem cells.” Proc Natl Acad Sci U S A 2014, 111 (35), E3641-9.

6.Gao, X. M., et al. (2015).“ GRHL2 coordinates regeneration of a polarized mucociliary epithelium from basal stem cells.” Journal of Cell Biology 2015, 211 (11), 669-682.

7.Yang, Y. D. K., et al. ( 2018) “Spatial-Temporal Lineage Restrictions of Embryonic p63(+) Progenitors Establish Distinct Stem Cell Pools in Adult Airways.”Dev Cell 2018, 44 (6), 752-761 e4.

8.Afelik, S. M., et al. ( 2017 )“Pancreatic β-cell regeneration: Facultative or dedicated progenitors.” Molecular and Cellular Endocrinology 2017.

9.Zacharias, WJ. S.,et al.(2018)“Regeneration of the lung alveolus by an evolutionarily conserved epithelial progenitor. ”Nature. 2018Mar8;555(7695): 251-255。

Disclosure of Invention

The invention aims to provide an economic and simple method for culturing lung organoids, which solves the problems of high technical requirement and high culture cost of lung organoid culture and can be widely popularized and applied. The method of the invention cultures the lung epithelial cells and the interstitial cells together in the Transwell, and realizes the culture of the airway epithelial cells into the lung organoid similar to the shape and the cell structure of the bronchus of the lung in vivo under the condition of not adding exogenous growth factors.

To achieve the technical objects of the present invention, in one aspect, the present invention provides a method and a mouse model for sorting lung epithelial cells and mesenchymal cells using a flow cytometer, comprising:

mating the mTmG transgenic mouse with the Shh-Cre transgenic mouse to obtain mTmG;

digesting Shh-Cre genotype mouse lung tissue with 0.1% collagenase IV, and sorting by flow cytometry to obtain lung epithelial cells and interstitial cells;

in another aspect of the present invention, there is provided an economical and simple method and culture medium composition for inducing lung organoids, comprising:

2D culturing the lung interstitial cells in a lower chamber of a Transwell by using a culture solution as follows: 89% of DMEM, 10% of FBS, 1% of streptomycin mixed solution and Primocin^TM 100 μg/mL。

After the interstitial cells are full, mitomycin C is added to inhibit the continued expansion of the interstitial cells, and the interstitial cells provide growth factors and cell components for organoids in the upper chamber of the Transwell.

Lung epithelial cells were 3D cultured in the upper chamber of Transwell using the following media: advanced DMEM/F-12, streptomycin qing mixture 1%, GlutaMAX 4mM, NaHCO₃ 3.6 mM，HEPES 15 mM，Primocin^TM 100 μg/mL，FBS 5%，EGF 25 ng/mL。

Wherein, the digestion treatment of the method of the invention is to digest the enzyme by collagenase IV with the final concentration of 0.1 percent under the digestion condition of 37 ℃ for 45 minutes.

Collagenase IV is used herein for the digestion of airway epithelial cells. Collagenase is an enzyme crude extract derived from Clostridium histolyticum, and contains not only clostripain A, which can degrade natural collagen and reticular fiber, but also other proteases, polysaccharidases, lipases, etc. Collagenase IV can effectively hydrolyze proteins, polysaccharides, lipids and the like in extracellular matrixes of the connective tissue and the epithelial tissue, thereby achieving the purpose of separating cells. In addition, type IV collagenase contains lower trypsin activity to reduce damage to membrane proteins and receptors, which is beneficial to reduce damage to cells during tissue digestion.

The interstitial lung cell medium used in the present application is DMEM and FBS, which have been commercialized. The single component of the basic culture medium can be widely used for culturing a plurality of cell lines such as mouse embryo lung fibroblasts, 293, 293T, A549 and the like, and has low cost and convenient acquisition.

The advanced DMEM/F12 used in the epithelial cell culture medium can better maintain the characteristics of the epithelial cells, wherein EGF can continuously promote the continuous synthesis of DNA, thereby playing a role in keeping the proliferation and differentiation potential of the airway epithelial cells.

Advantageous effects

1. The mouse model provided by the invention can be used for successfully marking the lung epithelial cells and sorting the lung epithelial cells and the lung interstitial cells by a flow cytometer. Solves the problem that the primary airway epithelial cells of the mouse are difficult to obtain in the prior art.

2. The method successfully induces the mouse lung epithelial cells into the lung organoid under the condition of not adding exogenous growth factors and biological components, thereby obviously reducing the culture cost of the lung organoid. Solves the problems of high cost and difficult reagent acquisition in organoid culture in the prior art.

3. The method of the invention cultures the lung epithelial cells and the interstitial cells together, creates an environment similar to the growth of the lung in vivo for the lung epithelial cells, and successfully induces the organoid. Solves the problem that the lung organoid is difficult to popularize in the prior art due to high difficulty in culturing.

Description of the drawings:

FIG. 1 is a schematic diagram of the method of using mTmG, Shh-Cre mouse lung tissue, flow cytometry to sort lung epithelial cells and interstitial cells, and co-culturing the lung epithelial cells and interstitial cells to grow and develop lung organoid according to the present invention provided in example 1;

FIG. 2 is a graph showing the process of obtaining the Shh-Cre mouse (FIG. 2A) and the result of PCR identification (FIG. 2B);

FIG. 3 is a graph showing fluorescence expression patterns of GFP and Tomato in lung tissue sections of Shh-Cre mice (FIG. 3A), and a schematic diagram showing the results of flow cytometry sorting of lung epithelial and mesenchymal cells (FIG. 3B). A scale: 100 microns;

FIG. 4 is a cell morphology chart of the interstitial lung cells used in the present invention after 1 day, 3 days and 5 days of culture. A scale: 25 microns;

FIG. 5 is a photograph of immunofluorescence staining of cultured interstitial lung cells with an α -SMA antibody (FIG. 5A), and a chart of α -SMA positive cell ratios (FIG. 5B) according to the present invention. The lung interstitial cells express the specific marker gene alpha-SMA, and the nucleus is shown by Dapi staining. A scale: 20 microns;

figure 6 is a lung organoid image obtained by the present invention. The images were taken 3 days, 6 days and 9 days after the culture, respectively. A scale: 200 microns;

FIG. 7 is a bright field image and a GFP fluorescence image of lung organoids cultured according to the present invention. All organoids expressed GFP (statistical plots). A scale: 200 microns;

FIG. 8 is a photograph of immunofluorescent staining of lung organoids formed by culture according to the present invention. The lung organoids express basal cell marker genes p63 and Krt5, and simultaneously express lung epithelial cell specific marker gene Sox 2. A scale: 20 microns;

fig. 3 to 8 are all images taken by a confocal microscope.

Detailed Description

The present invention is further described below with reference to the accompanying drawings and specific examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention, and it should be noted that the experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

It should be noted that the meanings represented by the acronyms referred to herein respectively refer to: GFP, green fluorescent protein; transwell: a penetrable cell culture chamber; mTmG mice: an induced specific recombinase fluorescent mouse; Shh-Cre mice: lung-specific knock-out mice; 2D: represents two dimensions, i.e. amplification culture; 3D: representing three dimensions, i.e. differentiation culture. Matrix gel: matrix gel; and (3) PCR: polymerase chain reaction; DMEM: a culture medium containing various amino acids and glucose. FBS: fetal bovine serum; primocin: oxytocin; GlutaMAX: a glutamic acid additive; NaHCO 2₃: sodium bicarbonate; HEPES (high efficiency particulate air): a buffer reagent name; EGF: an epidermal growth factor; alpha-SMA: alpha-smooth muscle actin; DAPI: fluorescent dyes that strongly bind to DNA; p 63: one of the family of cancer suppressor genes p 53; krt 5: keratin 5; sox2, Sox 9: one of the protooncogenes; PBS: a phosphate buffer; BSA: bovine serum albumin.

EXAMPLE 1 Compound combination

1. Lung interstitial cell culture medium

Preparation of the Medium for interstitial Lung cells according to the composition Table shown in Table 1

Name of reagent	Final concentration
		DMEM	89%
FBS	10%
		Penicillin streptomycin mixed liquor	1%
Primocin^TM	100 μg/mL

Specifically, in one embodiment of the present invention, the DMEM and the streptomycin mixture are obtained from Life Technologies, Inc., with the product numbers 11330032 and 15140-163, respectively, and the FBS is obtained from Biowest, with the product number S1580-500, Primocin^TMPurchased from Invivogen under the cat-pm-1 designation. Of course, the skilled person can also use reagents produced by other companies with the same efficacy to configure the amplification medium of the present application, and the present invention is not particularly limited.

Preferably, the inventor finds through a large number of experiments that the dosage of FBS can be selected from any value in the range of 5-10% and the other component concentrations in Table 1 to prepare the lung interstitial cell culture medium, and the dosage of the streptomycin qing mixed liquor can be selected from any value in the range of 1-2% and the other component concentrations in Table 1 to prepare the amplification culture medium.

2. Lung epithelial cell culture medium

The preparation of the lung epithelial cell culture medium was carried out according to the composition table shown in Table 2

Name of reagent	Final concentration
		Advanced DMEM/F-12	95%
FBS	5%
		Penicillin streptomycin mixed liquor	1%
GlutaMAX	4 mM
		NaHCO₃	3.6 mM
HEPES	15 mM
		Primocin^TM	100 μg/mL
EGF	25 ng/mL

In particular, in the present inventionIn one illustrative embodiment, the Advanced DMEM/F-12 and GlutaMAX, HEPES are available from Gibco as C11330500BT, 05966L17 and 15630-; the mixed solution of the penicillin streptomycin is purchased from Life Technologies, and the product number is 15140-; FBS is purchased from Biowest and has the product number of S1580-500; EGF was purchased from Corning, Inc. under the designation 354001. Primocin^TMPurchased from Invivogen, cat #: ant-pm-1.

Of course, the skilled person can also use reagents produced by other companies with the same efficacy to configure the amplification medium of the present application, and the present invention is not particularly limited.

Preferably, the inventors have found through a large amount of experiments that the amount of FBS can be selected from any value in the range of 5-10% and the other component concentrations in table 2 to configure the lung interstitial cell culture medium; the amount of the mixed solution of penicillin and streptomycin may be selected from any one of 1 to 2% and the concentrations of the other components in Table 2. The EGF may also be used in an amount selected from any of the values in the range of 25-50 ng/ml and in the other concentrations of the components in Table 2.

Example 2

The lung epithelial cells marked by GFP are separated by a flow cytometer, are cultured together with the lung interstitial cells, and are promoted to form lung organoids by utilizing natural growth factors and cell components secreted by the interstitial cells. The process of lung epithelial cell isolation and organoid formation is shown in fig. 1, and specifically comprises:

1. obtaining of transgenic mice (mTmG;;;;. Shh-Cre mice) in which lung epithelial cells express GFP.

1.1 As shown in FIG. 2A, the present invention uses mTmG transgenic mouse as female parent and Shh-Cre transgenic mouse as male parent, and mates them to obtain offspring (F1) mouse.

1.2 As shown in FIG. 2B, the PCR identification of the offspring mice shows that the mice with positive mTmG and Shh-Cre PCR amplification are mTmG, and Shh-Cre genotype mice.

1.3 the PCR identification primer of mTmG mouse used in the invention is:

mTmG Forward:5’ CTCTGCTGCCTCCTGGCTTCT 3’

mTmG Reverse：5’TCAATGGGCGGGGGTCGTT 3’。

1.4 the PCR identification primer of the Shh-Cre mouse used in the invention is as follows:

Shh-Cre Forward：5’ATGAACTTCAGGGTCAGCTTGC 3’

Shh-Cre Reverse: 5’ GATGTGTTCCGTTACCAGCGA 3’

2. flow cytometry is used to separate mTmG, lung epithelial cell and interstitial cell of Shh-Cre mouse.

The present invention utilizes mTmG and Shh-Cre genotype C57 BL/6J mouse as experimental material. As shown in fig. 3A, the genotyped mice express membrane-localized GFP protein in lung epithelial cells and membrane-localized Tomato protein in mesenchymal cells. The method comprises the following steps of (1) sorting lung epithelial cells and interstitial cells by a flow cytometer:

2.1 intraperitoneal injection of 10% chloral hydrate anesthetizes mice, the limbs are fixed on the operating table with pins, the thoracic and neck are cut, lung tissue is taken out, and placed in pre-cooled 1 × PBS containing 1% streptomycin mixture.

2.2 mouse Lung tissue was washed once with PBS and cut to 1mm³The small pieces were placed in a 35 mm petri dish.

2.3 adding 1-2 ml of 0.1% collagenase IV to digest for 45min-1.5h, 37 ℃. When the tissue mass becomes smaller and less, the tissue mass stops, and a layer of cells including red blood cells are seen at the bottom of the dish. The cell suspension was passed through a filter tube (BD 352235) to remove tissue mass,

2.4 tissue lysates were collected using EP tubes with smooth inner surface, and centrifuged at 300g and 5% BSA at 4 ℃.

2.5 removing supernatant after centrifugation, adding 100-200. mu.l of erythrocyte lysate, lysing erythrocytes on ice for 2min, then adding 1ml of cold 5% BSA (in PBS) to neutralize the lysate, collecting cells at 300g and 4 ℃, and removing red cells after centrifugation to whiten the cells. The supernatant was removed, leaving about 100. mu.l of PBS-BSA.

2.6 adding 1ml PBS-BSA washing, then 4 degrees C, 300 rpm centrifugal cell collection, supernatant, adding 500 u l PBS-BSA suspension cells, transfer to the flow tube, samples can be machine for flow cell sorting.

2.7 flow cytometry sorting of the cells revealed that the GFP-positive cells were lung epithelial cells and the GFP-invisible cells were lung mesenchymal cells, as shown in FIG. 3B.

2D culturing the lung interstitial cells.

The lung stromal cells isolated in step 2 were cultured in the lower chamber of Transwell. The culture medium is shown in table 1, and the specific steps are as follows:

3.1 flow cytometry sorted lung interstitial cells were centrifuged at 1000 rpm for 5min and the supernatant was removed.

3.2 the obtained lung interstitial cells were resuspended in 0.5 ml interstitial cell culture medium and cultured in a culture dish coated with 100 mg/ml type I rat tail collagen under 37 ℃ and 5% CO₂And (4) concentration.

3.3 in the above culture process, the amplification medium was changed every 2 days for a total of 5 days.

3.4 after 5 days of stromal cell culture, mitomycin C was added to inhibit further expansion of the cells.

The cultured lung interstitial cells were subjected to cytological observation and immunofluorescence staining, and the results of cell morphology observation and immunofluorescence staining are shown in fig. 4 and fig. 5, respectively. As can be seen in FIG. 4, adherent growth of cells was observed after 1 day of culturing with the interstitial lung cells cultured according to the present invention, an increase in cell number was observed after 3 days, and cell confluency was observed after 5 days. In FIG. 5, it can be seen that the cells cultured for 3 days and 5 days all expressed the marker gene α -SMA specific to the interstitial lung cells. Therefore, the lung interstitial cells cultured by the method can maintain the characteristics of the lung interstitial cells in vivo without function loss and weakening.

3D culture process of lung epithelial cells.

The lung epithelial cells isolated in step 2 were cultured in the upper chamber of Transwell. The culture medium is shown in table 2, and the specific steps are as follows:

4.1 Add 3 ml of epithelial cell medium to the flow cytometric separated lung epithelial cells, centrifuge at 1000 rpm for 5min, and remove the supernatant.

3.2 the obtained lung epithelial cells are re-suspended by 150 mul of epithelial cell culture medium, the cell suspension is evenly mixed with 150 mul of matrix glue in an ice-water mixture, and mixed solution with the final concentration of the matrix glue being 50% is obtained.

3.3 placing the mixture of Matril gel and cells in the upper chamber of the Transwell, standing for 20 minutes at 37 ℃ to solidify the Matril gel in the mixture.

3.4 adding 300. mu.l epithelial cell culture medium to culture at 37 deg.C and 5% CO₂And (4) concentration.

3.3 in the above culture process, the amplification culture medium is changed every 2 days, and the change method is half of each change.

The cultured lung organoids were subjected to cytological observation, GFP fluorescence detection and analysis by antibody immunofluorescence staining after sectioning. Organoid morphology observation results are shown in fig. 6, and it can be seen from fig. 6 that, after 3 days of 3D culture of lung epithelial cells, formation of minute spherical organoids is observed, and then organoids further grow and increase, and that lung organoids with a diameter of 50 to 350 μm can be formed after 9 days of culture. The results of GFP fluorescence measurements are shown in FIG. 7, and it can be seen from FIG. 7 that all lung organoids formed express GFP, indicating that the organoid is derived from GFP-positive lung epithelial cells. The analysis of antibody immunofluorescence staining after lung organoid section is shown in fig. 8, and it can be seen from fig. 8 that the organoids formed by the culture of the invention express the proximal airway marker gene Sox2, and the lung airway epithelial basal cell marker genes Krt5 and p63, which indicates that the lung organoids formed by the culture are similar to lung bronchial cells in terms of cell structure and composition.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention.

Claims

1. An economical and simple method for inducing lung organoids in vitro, comprising:

mating the mTmG transgenic mouse with the Shh-Cre transgenic mouse to obtain mTmG; (ii) a Shh-Cre genotype mice, lung epithelial cells of the mice express GFP green fluorescent protein, and lung interstitial cells express red Tomato protein.

2. Taking mTmG; (ii) a Shh-Cre mouse lung tissue is digested into single cells by collagenase IV, and then lung epithelial cells and interstitial cells are sorted by a flow cytometer.

3. The flow cytometric sorted interstitial lung cells were cultured in the lower chamber of Transwell in 2D.

4. And 3D culturing the lung epithelial cells sorted by the flow cytometer in an upper chamber of a Transwell, wherein the 3D culture condition is that 50% Matril gel is used as a matrix.

5. The mesenchymal cells and the epithelial cells are cultured together in a Transwell, and a structure and an environment similar to the lung in vivo are established in vitro, so that the lung epithelial cells are cultured to form the lung organoid.

6. mTmG of claim 1; (ii) a Shh-Cre mice, characterized in that the progeny produced by the mating of the transgenic mice with mTmG and Shh-Cre contains both mTmG and Shh-Cre mice, and the genotype of the mice is identified by PCR.

7. The method of digesting lung tissue according to claim 1, wherein said digestion treatment is shearing lung tissue to 1mm³Then collagenase IV was added to a final concentration of 0.1% under digestion conditions of 37 c for 45 minutes.

8. The method of claim 1, wherein the lung stromal cell culture medium comprises DMEM, FBS, streptomycin mixed media, Primocin^TMThe concentration of each component in the lung interstitial cell culture medium is as follows: 89% of DMEM, 10% of FBS, 1% of streptomycin mixed solution and Primocin^TM 100μg/mL。

9. The method of claim 1, wherein the mesenchymal cells are cultured under conditions selected from the group consisting of: culturing on a culture dish coated with 100ng/ml type I rat tail collagen, changing the culture medium every 2 days, and adding mitomycin C to terminate cell expansion after culturing for 5 days.

10. Wherein the lung interstitial cell culture medium comprises: DMEM, FBS, mixed streptomycin solution, Primocin^TMThe concentration of each component in the lung interstitial cell culture medium is as follows: 89% of DMEM, 10% of FBS, 1% of streptomycin mixed solution and Primocin^TM 100μg/mL。

11. The method of claim 1, wherein the epithelial cells are cultured by:

adding the airway epithelial cells sorted by the flow cytometer into a culture medium for resuspension and blowing into single cells, and uniformly mixing the formed single cell suspension and Matril gel on ice to ensure that the final concentration of the single cell suspension is 50%.

12. Adding the mixed solution of the cell-matrix glue and the culture medium into a Transwell upper chamber, standing for 20 minutes at 37 ℃, and adding the culture medium after the matrix glue is solidified; wherein the lung epithelial cell culture solution comprises: advanced DMEM/F-12, streptomycin mixture, GlutaMAX, NaHCO3, HEPES, Primocin^TM，FBS，EGF。

13. The concentration of each component in the lung epithelial cell culture medium is as follows: advanced DMEM/F-12, streptomycin 1%, GlutaMAX 4mM, NaHCO 33.6 mM, HEPES 15mM, Primocin^TM 100μg/mL，FBS 5％，EGF 25ng/mL。

14. The method according to claim 1, wherein the culture medium replacement method comprises: the medium was changed every two days, half the volume of the original culture medium was changed with the cell culture medium each time.

15. The culture conditions were: 37 ℃ and 5% CO2 concentration.

16. An experimental model obtained by the method of claims 1-7, which is a mouse lung organoid with a luminal bronchial structure and containing lung basal epithelial cells.

17. Use of a mouse lung organoid obtained by the method of claims 1-7 or the experimental model of claim 8 for the mechanistic study of lung development, precision medicine, organ transplantation, drug screening, drug action.

18. A compound composition for inducing lung organoid in vitro, economically and simply comprises a lung interstitial cell culture solution and a lung epithelial cell culture solution;

wherein the lung interstitial cell culture solution comprises: DMEM, FBS, mixed streptomycin solution, Primocin^TMThe concentration of each component in the lung interstitial cell culture medium is as follows: 89% of DMEM, 10% of FBS, 1% of streptomycin mixed solution and Primocin^TM 100μg/mL。

19. Wherein the lung epithelial cell culture medium comprises: advanced DMEM/F-12, penicillin mixed solution GlutaMAX, NaHCO3, HEPES, Primocin^TMFBS and EGF, wherein the concentration of each component in the lung epithelial cell culture medium is as follows: advanced DMEM/F-12, 1% streptomycin mixture, GlutaMAX 4mM, NaHCO 33.6 mM, HEPES 15mM, Primocin^TM 100μg/mL，FBS 5％，EGF 25ng/mL。