CN113151044B - Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application - Google Patents
Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application Download PDFInfo
- Publication number
- CN113151044B CN113151044B CN202110204065.8A CN202110204065A CN113151044B CN 113151044 B CN113151044 B CN 113151044B CN 202110204065 A CN202110204065 A CN 202110204065A CN 113151044 B CN113151044 B CN 113151044B
- Authority
- CN
- China
- Prior art keywords
- pseudomonas
- bbh16
- radix pseudostellariae
- strain
- fusarium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/27—Pseudomonas
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to pseudostellaria heterophylla disease control pseudostellaria heterophylla, a separation, screening and identification method and application. The research separates pseudostellaria root from pseudostellaria root plant to obtain pseudomonad, which has strong stress resistance, no toxicity and harm to human and livestock and is environment-friendly. Meanwhile, the bacterium has obvious inhibition effect on various pathogenic bacteria such as leaf spot disease, damping off, root rot, rhaponticum uniflorum and the like of the radix pseudostellariae, and can be used as a biocontrol bactericide for preventing and treating various fungal diseases of the radix pseudostellariae.
Description
Technical Field
The invention relates to the technical field of plant disease control, in particular to pseudomonas for controlling diseases, a separation, screening and identification method and application.
Background
Radix Pseudostellariae is dry root tuber of Pseudostellaria heterophylla (Miq.) Pax ex Pax et Hoffm, and has effects of invigorating qi, invigorating spleen, promoting fluid production and moistening lung. Modern pharmacological studies show that the heterophylly falsestarwort root has the effects of reducing blood sugar, improving chronic heart failure, resisting oxidation and the like. In the artificial cultivation process, the radix pseudostellariae has a serious continuous cropping obstacle problem which is mainly manifested by frequent diseases, common diseases comprise damping off, leaf spot, root rot and the like, and the incidence rate is increased year by year, and related reports show that the yield of the radix pseudostellariae is reduced by about 30% compared with that of the main stubbles in 2 years and more than 50% compared with that of the main stubbles in 3 years on the same land, so that the yield and the quality of the radix pseudostellariae are reduced, and the drug delivery agriculture causes great economic loss. In the process of preventing and treating diseases of radix pseudostellariae, currently, chemical agents such as propamocarb hydrochloride, fluopicolide, deltamethrin and the like are mainly used by ginseng farmers to prevent and treat the diseases, but the excessive use of the chemical agents can cause adverse effects such as destruction of ecological balance, increase of pesticide residue, improvement of drug resistance of pathogenic bacteria, strong acidification of soil and the like. The search for a new method which can protect the environment and effectively prevent plant diseases becomes a problem which needs to be solved urgently in the cultivation process of the pseudostellaria heterophylla.
In disease control of crops, vegetables and fruits, more than 200 biological pesticide products are mature in China at present, and few biological pesticides are used for disease control of traditional Chinese medicinal materials. In the research, pseudomonas is separated from the radix pseudostellariae plant, has strong stress resistance, is nontoxic and harmless to people and livestock, and is environment-friendly. Meanwhile, the bacterium has obvious inhibition effect on various pathogenic bacteria such as leaf spot disease, damping off, root rot, purple stripe disease and the like of the radix pseudostellariae, and can be used as a biocontrol bactericide for preventing and treating various pathogenic bacteria diseases of the radix pseudostellariae.
Disclosure of Invention
The invention aims to provide a pseudostellaria heterophylla disease control pseudomonas BBH16-1;
the invention also aims to provide a pseudomonas separation screening method for preventing and treating diseases;
another object of the present invention is to provide a method for identifying Pseudomonas for controlling diseases;
the invention also aims to provide application of the pseudomonas BBH16-1 strain in preparing the radix pseudostellariae antagonist.
Another object of the invention is to provide the use of the Pseudomonas BBH16-1 strain in preparing radix Pseudostellariae pathogenic bacteria antagonists such as Fusarium, alternaria alternata, staphylotrichum Funiculatum, rhizopus oryzae, chaetomium globosum, schizophyllum commune, coprinus comatus, pediococcus nigra, microplatina Wo Liya, charcoal Pi Jun, and the like.
The pseudomonas is pseudomonas BBH16-1.
The separation and screening method of pseudomonas BBH16-1 specifically comprises the following steps:
1) Collecting fresh radix Pseudostellariae leaves and root tuber, and washing with water;
2) Cutting into pieces with sterilized scissors, and placing in a mortar;
3) Adding 10mL PBS solution into 0.5-1.5 g leaf and root tuber tissues, carrying out ultrasonic treatment for 15-25 min, collecting suspension, and sequentially diluting to 10 times of 10 times in volume -2 Obtaining a bacterium-containing diluent;
4) Get 10 -2 Coating 100 μ L of diluted solution containing bacteria on PDA plate, and repeating three times;
5) After culturing for 1-3 days at 25-30 ℃, selecting single colonies with phenotype difference, and streaking the single colonies on an LB culture medium for purification culture;
6) Identifying the isolated strain pseudomonas;
7) Screening pseudomonas by adopting a plate confronting culture method;
inoculating fusarium, alternaria, colletotrichum and rhizopus oryzae on the surface of a PDA culture medium flat plate, and culturing at 20-30 ℃ for 2-4 days to prepare fresh hypha;
8) Punching a 1mL gun head, picking fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks, inoculating the fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks to the center of a PDA flat plate, simultaneously respectively inoculating bacterial liquid for culturing for 20-28 h at four equidistant points at the 3cm position around the PDA flat plate, taking inoculated escherichia coli DH5 alpha as negative control, and repeating each treatment for three times;
9) All treatments are cultured for 2-4 days at 20-30 ℃ to obtain pseudomonas: pseudomonas BBH16-1.
Preferably, the method for separating and screening pseudomonas BBH16-1 specifically comprises the following steps:
1) Collecting fresh radix Pseudostellariae leaves and root tuber, and washing with water;
2) Cutting into pieces with sterilized scissors, and placing in a mortar;
3) Adding 10mL PBS solution into 1g leaf and root tissue, performing ultrasonic treatment for 20min, collecting suspension, and sequentially diluting to 10 times by volume -2 Obtaining a bacterium-containing diluent;
4) Get 10 -2 Coating 100 μ L of diluted solution containing bacteria on PDA plate, and repeating three times;
5) After culturing for 2d at 28 ℃, selecting single colonies with phenotype difference, and streaking the single colonies on an LB culture medium for purification culture;
6) Identifying the isolated strain pseudomonas;
7) Screening pseudomonas by adopting a plate confronting culture method;
inoculating fusarium, alternaria, colletotrichum and rhizopus oryzae on the surface of a PDA culture medium flat plate, and culturing at 25 ℃ for 3d to prepare fresh hypha;
8) Punching a 1mL gun head, picking fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks, inoculating the fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks to the center of a PDA (personal digital assistant) flat plate, simultaneously respectively inoculating bacterial liquid for culturing 24h at four equidistant points at the 3cm positions around the PDA flat plate, taking inoculated escherichia coli DH5 alpha as negative control, and repeating each treatment for three times;
9) All treatments were incubated at 25 ℃ for 3d to obtain pseudomonas: pseudomonas BBH16-1.
The PDA culture medium of the invention has the following formula: 160-230 g of potato, 15-25 g of glucose, 0.5-2.1 g of monopotassium phosphate, 0.3-0.7 g of magnesium sulfate heptahydrate and 10-20 g of agar.
Preferably, the PDA culture medium of the invention has the following formula: 200g of potato, 20g of glucose, 1.5g of monopotassium phosphate, 0.5g of magnesium sulfate heptahydrate and 15g of agar.
The preparation method of the PDA culture medium comprises the following steps: boiling potato for 4-6 min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar and distilled water to constant volume of 0.5-1.5L.
The LB culture medium of the invention has the following formula: 5-15 g of tryptone, 2-8 g of yeast extract, 5-15 g of sodium chloride, 10-20 g of agar and distilled water with constant volume of 0.5-1.5L.
The preferable formula of the LB culture medium of the invention is as follows: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of agar and distilled water to a constant volume of 1L.
The identification method comprises morphological identification and biological identification, and specifically comprises the following steps:
1) Morphological identification
After the pseudomonas BBH16-1 strain is inoculated to an LB culture medium to be cultured for 48 hours, a yellow-white colony of the colony on the LB culture medium can be seen, the colony is circular, and the edge is neat and transparent.
2) Molecular biological identification
Culturing a pseudomonas BBH16-1 strain in an LB (lysogeny broth) culture medium for 48 hours, extracting genome DNA (deoxyribonucleic acid) by adopting a CTAB (cetyltrimethyl ammonium bromide)/NaCl (NaCl) extraction method, extracting by using phenol-chloroform-isoamylol (25;
sequencing primer DNA sequence:
V3V4 rDNA (forward primer): CTACGGGMSGCAGCAG;
V3V4 rDNA (reverse primer): GGACTACHVGGGTWTCTAAT;
in the GenBank database at NCBI, the V3V4 rDNA sequence of BBH16-1 strain was identified by BLASTn search.
The pseudomonas BBH16-1 strain is applied to preparation of traditional Chinese medicinal materials and crop antagonists.
Preferably, the pseudomonas BBH16-1 strain is applied to preparation of radix pseudostellariae pathogenic bacteria antagonists such as fusarium, alternaria, staphylococcus fukuchii, rhizopus oryzae, chaetomium globosum, schizophyllum, coprinus comatus, ectococcus nigra, diplodia theobromae, wo Liya charcoal Pi Jun and the like.
Has the advantages that:
compared with the prior art, the invention has the following beneficial effects:
1. the problems existing in the prior art are as follows: in the process of preventing and treating diseases of radix pseudostellariae, currently, chemical agents such as propamocarb hydrochloride, fluopicolide, deltamethrin and the like are mainly used by ginseng farmers to prevent and treat the diseases, but the excessive use of the chemical agents can cause adverse effects such as destruction of ecological balance, increase of pesticide residue, improvement of drug resistance of pathogenic bacteria, strong acidification of soil and the like.
The present invention solves the above problems: the pseudomonas BBH16-1 strain obtained by the pseudomonas separation, screening and identification method for preventing and treating the pseudostellaria root diseases is applied to the preparation of an antagonist for the pathogenic bacteria of the pseudostellaria root, such as fusarium, alternaria alternate, staphylococcus fulvus, rhizopus oryzae, chaetomium globosum, schizophyllum, coprinus comatus, ectococcus melanocarpus, diplodia theobromae, wo Liya charcoal Pi Jun and the like. Solves the problems of bad influences of destruction of ecological balance, increase of pesticide residue, improvement of drug resistance of pathogenic bacteria, strong acidification of soil and the like caused by chemicals.
2. The invention proves that the pseudomonas BBH16-1 broad-spectrum bacteriostasis test proves that the pseudomonas BBH16-1 strain has an inhibition rate of 29.3 percent on fusarium graminearum, 28.0 percent on fusarium trilorum, 31.8 percent on alternaria alternata, 68.0 percent on staphylococcus fulvus, 31.7 percent on rhizopus oryzae, 21.8 percent on chaetomium globosum, 36.1 percent on schizophyllum, 51.8 percent on coprinus comatus, 40.5 percent on ectococcus melanocorticus, 34.0 percent on Erysipelothrix theobroma theobromae and 36.7 percent on Microapplanatum Wo Liya corium, and the pseudomonas BBH16-1 strain has obvious inhibition effect on the pathogenic bacteria.
3. The experiment for reducing colonization of pathogenic bacteria fusarium in radix pseudostellariae root tuber by BBH16-1 strain fermentation liquor proves that the BBH16-1 strain fermentation liquor can effectively reduce colonization of pathogenic bacteria in the radix pseudostellariae root tuber.
4. The field plot experiment of BBH16-1 strain fermentation liquor on the disease control of the radix pseudostellariae proves that the BBH16-1 strain fermentation liquor can effectively inhibit the disease of the radix pseudostellariae; after the BBH16-1 strain fermentation liquor is subjected to spray treatment, the disease indexes of the radix pseudostellariae at two experimental points of Huangping county and Schenken county are obviously reduced compared with those of a clear water control group, the prevention and treatment effects are respectively 33.4% and 47.3%, and the disease indexes are superior to those of a commercial bactericide carbendazim (26.5%) at the experimental point of Schenken county; the BBH16-1 strain fermentation liquor can inhibit the disease attack of the radix pseudostellariae, the yield of fresh products is obviously increased, the yield increase rates of two test points in the Shinbin county and the Huangping county are respectively 20.7% and 35.7%, and the yield increase rates are both superior to those of a carbendazim treatment group.
The isolated strain was named: pseudomonas BBH16-1 (Pseudomonas sp. BBH 16-1);
the preservation unit: china Center for Type Culture Collection (CCTCC);
and (4) storage address: wuhan university of Wuhan, china
The preservation date is as follows: 12 month and 25 days 2020;
the preservation number is: CCTCC NO: m2020971.
Drawings
The sequence table is a Pseudomonas BBH16-1 strain V3V4 rDNA sequence, a forward primer sequence for amplifying the V3V4 rDNA sequence and a reverse primer sequence for amplifying the V3V4 rDNA sequence which are separated by the invention.
FIG. 1 shows the colony morphology of Pseudomonas BBH16-1 after culturing for 48h on LB medium.
FIG. 2 shows the result of the growth inhibition of Pseudomonas BBH16-1 on the hypha of various pathogenic bacteria.
FIG. 3 Pseudomonas BBH16-1 strain and other closely related species rDNA phylogenetic tree.
FIG. 4 is a plot of the effect of pseudostellaria root disease prevention and control field plot of pseudostellaria root fermentation broth BBH16-1.
Detailed Description
The technical solution of the present invention will be further specifically described below by way of specific examples.
Example 1 Pseudomonas separation and screening method for preventing and treating diseases of radix Pseudostellariae
1) Collecting fresh radix Pseudostellariae leaves and root tuber, and washing with water;
2) Cutting into pieces with sterilized scissors and placing in a mortar;
3) Adding 10mL PBS solution into 1g leaf and root tissue, performing ultrasonic treatment for 20min, collecting suspension, and sequentially diluting to 10 times by volume -2 Obtaining a bacterium-containing diluent;
4) Get 10 -2 Coating 100 μ L of diluted solution containing bacteria on PDA plate, and repeating three times;
5) After culturing at 28 ℃ for 2d, selecting single colonies with phenotype difference, and streaking the single colonies on an LB culture medium for purification culture;
6) Identifying the isolated strain pseudomonas;
7) Screening pseudomonas, fusarium, alternaria alternata, colletotrichum botrytis and rhizopus oryzae by adopting a plate confrontation culture method, placing the pseudomonas, fusarium, alternaria alternata, colletotrichum botrytis and rhizopus oryzae on the surface of a PDA culture medium flat plate, and culturing at 25 ℃ for 3 days to prepare fresh hypha;
8) Punching a 1mL gun head, picking fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks, inoculating the fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks to the center of a PDA (personal digital assistant) flat plate, simultaneously respectively inoculating bacterial liquid for culturing 24h at four equidistant points at the 3cm positions around the PDA flat plate, taking inoculated escherichia coli DH5 alpha as negative control, and repeating each treatment for three times;
9) All treatments were incubated at 25 ℃ for 3d to obtain pseudomonas: pseudomonas BBH16-1.
The application comprises the following steps: the pseudomonas BBH16-1 strain is applied to preparing the radix pseudostellariae pathogenic bacteria antagonist, and is particularly applied to preparing the radix pseudostellariae pathogenic bacteria antagonist such as fusarium, alternaria alternata, staphylococcus fukuchii, rhizopus oryzae, chaetomium globosum, schizophyllum commune, coprinus comatus, ectococcus nigra, trichoderma theobromae, micro-flat Wo Liya charcoal Pi Jun and the like.
Example 2 Pseudomonas separation and screening method for preventing and treating diseases of radix Pseudostellariae
1) Collecting fresh radix Pseudostellariae leaves and root tuber, and washing with water;
2) Cutting into pieces with sterilized scissors and placing in a mortar;
3) Adding 10mL PBS solution into 0.5g leaf and root tuber tissue, performing ultrasonic treatment for 15min, collecting suspension, and sequentially adopting 10 times volume ratioDiluting to 10 -2 Obtaining a bacterium-containing diluent;
4) Get 10 -2 Coating 100 μ L of diluted solution containing bacteria on PDA plate, and repeating three times;
5) After culturing for 1d at 25 ℃, selecting single colonies with phenotype difference, and streaking the single colonies on an LB culture medium for purification culture;
6) Identifying the isolated strain pseudomonas;
7) Screening pseudomonas, fusarium, alternaria alternata, colletotrichum botrytis and rhizopus oryzae by adopting a plate confrontation culture method, placing the pseudomonas, fusarium, alternaria alternata, colletotrichum botrytis and rhizopus oryzae on the surface of a PDA culture medium flat plate, and culturing at 20 ℃ for 2d to prepare fresh hyphae;
8) Punching a 1mL gun head, picking fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks, inoculating the fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks to the center of a PDA flat plate, simultaneously respectively inoculating bacterial liquid for culturing for 20h at four equidistant points of 3cm around the PDA flat plate, taking inoculated escherichia coli DH5 alpha as negative control, and repeating each treatment for three times;
9) All treatments were incubated at 20 ℃ for 2d to obtain pseudomonas: pseudomonas BBH16-1.
The application comprises the following steps: the pseudomonas BBH16-1 strain is applied to preparation of radix pseudostellariae pathogenic bacteria antagonists, and particularly applied to preparation of radix pseudostellariae pathogenic bacteria antagonists such as fusarium, alternaria alternata, sclerotium fukuii, rhizopus oryzae, chaetomium globosum, schizophyllum commune, coprinus comatus, ectococcus nigra, trichoderma theobroma, micropinocladium oblate Wo Liya charcoal Pi Jun and the like.
Example 3 Pseudomonas separation and screening method for preventing and treating diseases of radix Pseudostellariae
1) Collecting fresh radix Pseudostellariae leaves and root tuber, and washing with water;
2) Cutting into pieces with sterilized scissors and placing in a mortar;
3) Adding 10mL PBS solution into 1.5g leaf and root tissue, performing ultrasonic treatment for 25min, collecting suspension, and sequentially diluting to 10 times of 10 volume -2 Obtaining a bacterium-containing diluent;
4) Get 10 -2 Coating 100 μ L of diluted solution containing bacteria on PDA plate, and repeating three times;
5) After culturing for 3d at 30 ℃, selecting single colonies with phenotype difference, and streaking the single colonies on an LB culture medium for purification culture;
6) Identifying the isolated strain pseudomonas;
7) Screening pseudomonas, fusarium, alternaria alternata, aschersonia richardensis and rhizopus oryzae by adopting a plate opposite culture method, inoculating the pseudomonas, fusarium, alternaria alternata, sclerotinia sclerotiorum and rhizopus oryzae on the surface of a PDA culture medium flat plate, and culturing at 30 ℃ for 4d to prepare fresh hyphae;
8) Punching a 1mL gun head, picking fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks, inoculating the fresh fusarium, alternaria, colletotrichum and rhizopus hypha blocks to the center of a PDA flat plate, simultaneously respectively inoculating bacterial liquid for culturing 28h at four equidistant points at the 3cm positions around the PDA flat plate, taking inoculated escherichia coli DH5 alpha as negative control, and repeating each treatment for three times;
9) All treatments were incubated at 30 ℃ for 4 days to obtain pseudomonas: pseudomonas BBH16-1.
The application comprises the following steps: the pseudomonas BBH16-1 strain is applied to preparing the radix pseudostellariae pathogenic bacteria antagonist, and is particularly applied to preparing the radix pseudostellariae pathogenic bacteria antagonist such as fusarium, alternaria alternata, staphylococcus fukuchii, rhizopus oryzae, chaetomium globosum, schizophyllum commune, coprinus comatus, ectococcus nigra, trichoderma theobromae, micro-flat Wo Liya charcoal Pi Jun and the like.
PDA culture medium used in examples 1 to 3 was prepared according to the recipe and preparation method of PDA culture medium used in any of examples 4 to 11.
The LB medium used in examples 1-3 was prepared according to the recipe and preparation method of the LB medium used in any of examples 12-14.
EXAMPLE 4 PDA Medium
The formula is as follows: 200g of potato, 20g of glucose, 1.5g of monopotassium phosphate, 0.5g of magnesium sulfate heptahydrate and 15g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to desired volume of 1.0L.
EXAMPLE 5 PDA Medium
The formula is as follows: 200g of potato, 20g of glucose, 1.5g of monopotassium phosphate, 0.5g of magnesium sulfate heptahydrate and 15g of agar.
The preparation method comprises the following steps:
boiling potato for 4min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to desired volume of 1.5L.
EXAMPLE 6 PDA Medium
The formula is as follows: 200g of potato, 20g of glucose, 1.5g of monopotassium phosphate, 0.5g of magnesium sulfate heptahydrate and 15g of agar.
The preparation method comprises the following steps:
boiling potato for 6min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to constant volume of 0.5L.
Example 7 PDA Medium
The formula is as follows: 160g of potato, 15g of glucose, 0.5g of monopotassium phosphate, 0.3g of magnesium sulfate heptahydrate and 10g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to desired volume of 1.0L.
EXAMPLE 8 PDA Medium
The formula is as follows: 160g of potato, 15g of glucose, 0.5g of monopotassium phosphate, 0.3g of magnesium sulfate heptahydrate and 10g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to constant volume of 0.5L.
Example 9 PDA Medium
The formula is as follows: 160g of potato, 15g of glucose, 0.5g of monopotassium phosphate, 0.3g of magnesium sulfate heptahydrate and 10g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to desired volume of 1.5L.
EXAMPLE 10 PDA Medium
The formula is as follows: 230g of potato, 25g of glucose, 2.1g of monopotassium phosphate, 0.7g of magnesium sulfate heptahydrate and 20g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to constant volume of 0.5L.
EXAMPLE 11 PDA Medium
The formula is as follows: 230g of potato, 25g of glucose, 2.1g of monopotassium phosphate, 0.7g of magnesium sulfate heptahydrate and 20g of agar.
The preparation method comprises the following steps:
boiling potato for 5min, filtering with gauze, collecting filtrate, adding glucose, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, agar, and distilled water to desired volume of 1.5L.
Example 12 LB Medium
10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of agar and distilled water to a constant volume of 1L.
Example 13 LB Medium
5g of tryptone, 2g of yeast extract, 5g of sodium chloride, 10g of agar and distilled water to a constant volume of 0.5L.
EXAMPLE 14 LB Medium
15g of tryptone, 8g of yeast extract, 15g of sodium chloride, 20g of agar and distilled water to a constant volume of 1.5L.
Examples 1-3 identification by the identification method of example 15
Example 15 identification of Pseudomonas BBH16-1
1) Morphological identification
After the pseudomonas BBH16-1 strain is inoculated to an LB culture medium to be cultured for 48 hours, a yellow-white colony of the colony on the LB culture medium can be seen, the colony is circular, and the edge is neat and transparent.
2) Molecular biological identification
Culturing a pseudomonas BBH16-1 strain in an LB culture medium for 48h, extracting genome DNA by adopting a CTAB/NaCl extraction method, extracting with phenol-chloroform-isoamyl alcohol (25;
sequencing primer DNA sequence:
V3V4 rDNA (forward primer): CTACGGGMSGCAGCAG;
V3V4 rDNA (reverse primer): GGACTACHVGGGTWTCTAAT;
in the GenBank database at NCBI, the V3V4 rDNA sequence of BBH16-1 strain was identified by BLASTn search.
To further verify the effectiveness and feasibility of the present invention, the inventors performed a series of tests, as follows:
test equipment: an ultra-clean workbench (Shanghai Jixun industries Co., ltd., BSD-50), a light constant-temperature incubator (Tester instruments Co., ltd., tianjin, GZX-400 EF), an automatic steam sterilization pot (TOMY KOGYO, ES-315), an ultrasonic cleaner (Ningbo Xinzhi Biotech Co., ltd., SB25-12 DTD), a desktop refrigerated Centrifuge (Eppendorf, centrifuge S810R), a constant-temperature water bath pot (Tester instruments Co., ltd., tianjin, DR-98-II), a nucleic acid quantifier (Thermo, nanodrop 2000), and a PCR amplification instrument (BIO-RAD, C1000); electrophoresis apparatus (BIO-RAD, powerpac Basic), gel imaging apparatus (BIO-RAD, chemidoc) TM Touch Imaging System), pure water preparation System (FDEER, FL-UP-JX-30), pH acidimeter (Mettler, toledo), pipette (Eppendorf, research).
Test reagents: glucose (Tianjin Yongda chemical reagent Co., ltd.), potassium dihydrogen phosphate (Tianjin Kemiou chemical reagent Co., ltd.), magnesium sulfate (Tianjin Yongda chemical reagent Co., ltd.), tryptone (Oxoid), yeast extract (Oxoid), anhydrous magnesium sulfate (Tianjin Yongda chemical reagent Co., ltd.), potassium dihydrogen phosphate (Tianjin Kemiou chemical reagent Co., ltd.), sodium chloride (national group chemical reagent Co., ltd.), agar (Solarbio), 75% ethanol (Sichuan Jinshan pharmaceutical Co., ltd.), isopropanol (Chengdu Jinshan chemical reagent Co., ltd.), taq enzyme (Takara Bio-engineering (Dalian) Co., ltd.).
Test strains: the strains used in the test, such as alternaria alternata, colletotrichum botrytis, chaetomium globosum, schizophyllum commune, coprinus comatus, ectococcus nigra, fusarium tricuspidatum, fusarium avenaceum, trichoderma theobromae, rhizopus oryzae, 5363 flattish Wo Liya carbon Pi Jun and the like, are isolated and stored strains from traditional Chinese medicine modern planting technology research laboratories of traditional Chinese medicine ethnic medicine resource research institute of Guizhou traditional Chinese medicine university.
1. Separation and screening of antagonistic bacteria
The invention relates to a bacterium separation material which is collected from a radix pseudostellariae continuous cropping planting base of Qiancang ecological science and technology agricultural development responsibility company in Guizhou province in China, and leaves and root tubers of radix pseudostellariae with light morbidity in fields with heavy morbidity of the radix pseudostellariae are selected for antagonistic bacterium separation. Collecting fresh radix Pseudostellariae leaves and root tuber, washing with tap water, cutting into 2cm × 2cm pieces with sterilized scissors, placing into mortar, adding 10mL PBS solution into 1g leaf and root tuber tissue, ultrasonic treating for 20min, collecting suspension, and sequentially diluting to 10 times by volume -2 . Obtaining a diluted solution containing bacteria, and taking 10 -2 After three replicates of each treatment, 100. Mu.L of the diluted, bacteria-containing dilutions were plated on PDA plates and incubated at 28 ℃ for 2 days, single colonies with phenotypic differences were picked and streaked onto LB medium (see Table 1 for media formulations) for purification culture. The isolated strain was preliminarily identified as Pseudomonas by analysis.
The screening of antagonistic bacteria adopts a plate confronting culture method. Fusarium, alternaria, fusarium, rhizopus oryzae PDA culture medium (see Table 1 for culture medium formula). Culturing at 25 deg.C for 3 days to prepare fresh mycelium. Punching with 1mL gun head, picking fresh Fusarium, alternaria alternata, fusarium oxysporum and Rhizopus oryzae, and inoculating in the center of PDA plate. Meanwhile, bacterial liquid for 24h is inoculated at four equidistant points 3cm around the strain respectively, inoculated escherichia coli DH5 alpha is used as negative control, and each treatment is repeated three times. All treatments were incubated at 25 ℃ for 3 days and the test strains were tested for their bacteriostatic rate. Through the screening, a strain BBH16-1 (shown in figure 2) with obvious antagonistic action on fusarium, alternaria alternata, botrytis cinerea and rhizopus oryzae is obtained, the bacteriostatic rates of the strain BBH16-1 respectively reach 29.3%, 31.8%, 68.0% and 31.7% (shown in table 2), the bacteriostatic zone is clear, the edges are neat, and the bacteriostatic effect is obvious.
TABLE 1 BBH16-1 Strain culture Medium
2. Antagonistic bacteria mycological identification
2.1 morphological characterization of Pseudomonas BBH16-1 Strain
After the pseudomonas BBH16-1 strain is inoculated to an LB culture medium to be cultured for 48 hours, a yellow-white colony of the colony on the LB culture medium can be seen, the colony is circular, and the edge is neat and transparent.
2.2 molecular biological identification of Pseudomonas BBH16-1 Strain
After culturing the pseudomonas BBH16-1 strain in an LB culture medium for 48h, extracting genomic DNA by adopting a CTAB/NaCl extraction method, and extracting by using phenol-chloroform-isoamyl alcohol (25. V3V4 rDNA was amplified using specific primers and sent to Biotech for sequencing. The length of the sequencing sequence is 408bp, and the sequence number is SEQ ID NO.1.
Sequencing primer DNA sequence:
V3V4 rDNA (forward primer): CTACGGGMSGCAGCAG
V3V4 rDNA (reverse primer): GGACTACHVGGGTWTCTAAT
In the GenBank database in NCBI, the V3V4 rDNA sequence of BBH16-1 strain is searched by BLASTn, and the similarity of the sequence is found to be higher in Pseudomonas in order to further determine the genetic characteristics of the strain, 10 strains with the similarity of more than 97% in the matching result are selected to construct a phylogenetic tree (figure 3).
The identification of the classification status of the strains according to the present invention is described in the manual of microbiology classification of classical: for example, george M.Garrity, bergey's Manual of Systematic Bacteriology, vol.VIII,1974 edition. According to the morphological characteristics and the comparison result of the V3V4 rDNA gene sequence, the strain separated by the invention is identified to be a strain of Pseudomonas (Pseudomonas sp.BBH16-1) through heterogeneous classification, the applicant names the separated strain as Pseudomonas BBH16-1, the strain is delivered to China Center for Type Culture Collection (CCTCC) of Wuhan university, the preservation number is CCTCC NO: m2020971.
4. Pseudomonas BBH16-1 broad-spectrum bacteriostasis test
The inhibition effect of BBH16-1 strain on different pathogenic fungi is detected by the confronting culture method in a culture dish. The result shows that the strain not only has the inhibition effect on Fusarium, but also can obviously inhibit the growth of 11 pathogenic bacteria in Alternaria alternata, staphylococcus fulvorum rickilina, chaetomium globosum, schizophyllum commune, coprinus xanthrichardrix, epicoccum nigrum, fusarium trisicum tricinctum, fusarium avenaceum avenaceae, fusarium theobroma lapioides theobromae, rhizopus oryzae ryzae, micropina Wo Liya carbon Pi Jun whalya microplasma (Table 1).
TABLE 2 broad-spectrum bacteriostasis of Pseudomonas BBH16-1 Strain
Test for reducing colonization of pathogenic bacteria fusarium in radix pseudostellariae root tuber by BBH16-1 strain fermentation liquor
The experiment of reducing the abundance of pathogenic bacteria in the pseudostellaria heterophylla planting soil by the BBH16-1 strain is carried out in a research building laboratory of the university of traditional Chinese medicine in Guizhou, according to the formula of vermiculite: preparing culture medium from nutrient soil (3:1), sterilizing at 121 deg.C for 30min, and packaging into 10 cm-diameter culture bowls. The total test was divided into 4 treatments, each 10mL of BBH16-1 strain fermentation broth (OD concentration) 600nm = 1), 10mL fusarium spore liquid (concentration is 1 × 10) 4 CFU/mL), 20mL BBH16-1 strain fermentation broth (concentration is OD) 600nm = 1) and fusarium (concentration 1 × 10) 4 CFU/mL) equal volume of mixed liquor, sterile water. The radix pseudostellariae was then planted in pots, 1 plant per pot, and 6 plants were treated each. After the radix pseudostellariae root tuber is planted for 15 days at 25 ℃, collecting radix pseudostellariae root tuber samples, and quantitatively detecting the content of the tri5 gene by qPCR so as to determine the relative abundance of pathogenic bacteria fusarium which colonize in the radix pseudostellariae root tuber. The results showed that BBH16-1 bacteriumThe plant fermentation liquid can effectively reduce the colonization ability of pathogenic bacteria in radix pseudostellariae root tuber, and the relative abundance of the fusarium colonized on the radix pseudostellariae root tuber in the fusarium spore liquid treatment group is obviously higher than that of a BBH16-1 fermentation liquid and fusarium spore liquid mixed liquid, a BBH16-1 fermentation liquid and a sterile water treatment group (Table 3).
Table 3 inhibitory effect results of BBH16-1 on abundance of pathogenic bacteria in pseudostellaria heterophylla planting soil
Field plot experiment of BBH16-1 strain fermentation liquor on prevention and control of diseases of radix pseudostellariae
The field test of the disease control of the radix pseudostellariae is carried out in the planting fields of radix pseudostellariae continuous cropping of Guizhou province Qiankang ecological science and technology agricultural development responsibility company and Guizhou province Jincao Hai medicinal material development limited company. The planting material is Shitai No.1, and a checkerboard method is adopted for carrying out a district spraying test in a grouping design. The field test is divided into 3 treatments, namely BBH16-1 strain fermentation liquor, carbendazim powder (commercial bactericide, the content of active ingredients is 70 percent) and clear water, wherein each treatment is designed to be 4 in number, and the area of each cell is 2m 2 (1X 2 m). The treatment mode is that BBH16-1 strain fermentation liquor is sprayed by a spraying method, carbendazim dissolved by sterile water and clear water are respectively sprayed and aired on different treated soil, the spraying amount of the fermentation liquor per mu is 10L, and the carbendazim is 50g per mu according to the package specification. The processing sequence is as follows: when the radix pseudostellariae is planted in 12 months, the radix pseudostellariae planting soil is sprayed and dried according to the method; and (4) carrying out spray-drying treatment for 1 time every 15 days from the end of 2 months to the beginning of 6 months in the next year and in half a month after the seedlings of the radix pseudostellariae emerge. Wherein, the disease indexes of damping off, leaf spot and root rot are respectively investigated at the beginning of 3 months, at the beginning of 4 months and at the excavation period. And (4) measuring the yield and the quality of the radix pseudostellariae after harvesting.
The result shows that the BBH16-1 strain fermentation liquor can effectively inhibit the occurrence of the diseases of the radix pseudostellariae (figure 4). After the BBH16-1 strain fermentation liquor is subjected to spray treatment, the disease indexes of the radix pseudostellariae are remarkably reduced compared with those of a clear water control group at 2 test points of Huangping county and Schenken county, the prevention and treatment effects are respectively 33.4% and 47.3%, and the disease indexes are superior to those of a commercial bactericide carbendazim (26.5%) at the test point of Schenken county. The BBH16-1 strain fermentation liquor can inhibit the disease attack of the radix pseudostellariae, the yield of the fermentation liquor is also obviously increased, the yield increase rates of 2 test points in the Scombin county and the Huangping county are respectively 20.7% and 35.7%, and the fermentation liquor is superior to that of a carbendazim treatment group (table 4).
TABLE 4 BBH16-1 Strain field plot test results for prevention and treatment of pseudostellaria root diseases
7. Attached watch
>SEQ ID NO.1
TGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTG GGAGGAAGGGCAGTTGCCTAATACGTAACTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTA CTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAA CCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACC TGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGAAA
Sequence listing
<110> Guizhou university of traditional Chinese medicine
<120> pseudostellaria root disease prevention and control pseudostellaria root pseudomonas, separation, screening and identification method and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 408
<212> DNA
<213> Parler Long Nishi Pseudomonas BBH16-1 strain V3V4 rDNA Sequence (Artificial Sequence)
<400> 1
tgatccagcc atgccgcgtg tgtgaagaag gtcttcggat tgtaaagcac tttaagttgg 60
gaggaagggc agttgcctaa tacgtaactg ttttgacgtt accgacagaa taagcaccgg 120
ctaactctgt gccagcagcc gcggtaatac agagggtgca agcgttaatc ggaattactg 180
ggcgtaaagc gcgcgtaggt ggtttgttaa gttggatgtg aaatccccgg gctcaacctg 240
ggaactgcat tcaaaactga ctgactagag tatggtagag ggtggtggaa tttcctgtgt 300
agcggtgaaa tgcgtagata taggaaggaa caccagtggc gaaggcgacc acctggactg 360
atactgacac tgaggtgcga aagcgtgggg agcaaacagg attagaaa
408
<210> 2
<211> 16
<212> DNA
<213> Forward primer Sequence for amplifying V3V4 rDNA Sequence (Artificial Sequence)
<400> 2
ctacgggmsg cagcag
16
<210> 3
<211> 20
<212> DNA
<213> reverse primer Sequence for amplifying V3V4 rDNA Sequence (Artificial Sequence)
<400> 3
ggactachvg ggtwtctaat 20
Claims (2)
1. The pseudomonas for preventing and treating the diseases of the pseudostellaria root is pseudomonas BBH16-1, is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: m2020971.
2. The application of pseudostellaria root disease-controlling pseudostellaria root as claimed in claim 1, characterized by that the pseudomonad BBH16-1 strain is used for preparing alternaria alternata (Alternaria alternata) (A. Alternata (L.))Alternaria alternata) Staphylococcus Fukei (Hill. Ex.), (Botryotinia fuckeliana) Chaetomium globosum (Chaetomium globosum) Schizophyllum commune (II) and (II)Chizophyllum commune）、Coprinellus xanthothrix、Epicoccum nigrumThree wiresFusarium (F.), (Fusarium tricinctum) Cocoa nib chromospore bacteria (A), (B)Lasiodiplodia theobromae) Rhizopus oryzae (A. Oryzae) ((A. Oryzae))Rhizopus oryzae) Micro-flat Wo Liya charcoal Pi Jun (Whalleya microplaca) The use of antagonists.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110204065.8A CN113151044B (en) | 2021-02-24 | 2021-02-24 | Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110204065.8A CN113151044B (en) | 2021-02-24 | 2021-02-24 | Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113151044A CN113151044A (en) | 2021-07-23 |
| CN113151044B true CN113151044B (en) | 2023-04-07 |
Family
ID=76883857
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110204065.8A Active CN113151044B (en) | 2021-02-24 | 2021-02-24 | Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151044B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114231442B (en) * | 2021-11-27 | 2022-12-02 | 湖北省生物农药工程研究中心 | Parlerian Long Nishi pseudomonas and application thereof in prevention and treatment of oomycete pathogenic bacteria soil-borne diseases |
| CN115152924B (en) * | 2022-08-29 | 2023-08-15 | 贵州中医药大学 | Method for inhibiting aspergillus flavus pollution and toxin pollution thereof and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779342A (en) * | 2016-03-28 | 2016-07-20 | 福建农林大学 | Antagonistic bacterial strain of special-form fusarium moniliforme of radix pseudostellariae and application of antagonistic bacterial strain |
| CN112175869A (en) * | 2020-09-29 | 2021-01-05 | 烟台市林业科学研究所 | Pseudomonas and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW201334696A (en) * | 2012-02-28 | 2013-09-01 | Marrone Bio Innovations Inc | Control of phytopathogenic microorganisms with Pseudomonas sp. and substances and compositions derived therefrom |
-
2021
- 2021-02-24 CN CN202110204065.8A patent/CN113151044B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779342A (en) * | 2016-03-28 | 2016-07-20 | 福建农林大学 | Antagonistic bacterial strain of special-form fusarium moniliforme of radix pseudostellariae and application of antagonistic bacterial strain |
| CN112175869A (en) * | 2020-09-29 | 2021-01-05 | 烟台市林业科学研究所 | Pseudomonas and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113151044A (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103789234B (en) | A kind of bacillus amyloliquefaciens and application thereof | |
| KR101624628B1 (en) | Novel bacillus vallismortis bs07m with promoting effect of plant growth and improving effect of cold-tolerance, and microbial agent containing the same | |
| CN105907680B (en) | A kind of bacillus subtilis J-5 and its bacteria agent and application | |
| CN108148794B (en) | Bacillus subtilis DYr3.3 with broad-spectrum antibacterial activity, and preparation method and application thereof | |
| CN108148793B (en) | Paenibacillus polymyxa DYr4.4 with broad-spectrum antibacterial activity and preparation method and application thereof | |
| CN113005056B (en) | Bacillus belgii HY19 and application thereof | |
| CN113969247B (en) | Bacterium for inhibiting tobacco disease pathogenic bacteria and application thereof | |
| CN111040976B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN113151044B (en) | Pseudomonas for preventing and treating diseases of radix pseudostellariae and separation, screening and identification method and application | |
| CN112322560B (en) | Bacillus belgii and application thereof in prevention and control of pear diseases | |
| CN111172060A (en) | Bacillus with banana vascular wilt prevention and treatment function and preparation method and application thereof | |
| CN111778173B (en) | Bacillus subtilis Pro1A2, microbial inoculum and preparation method thereof, and application of bacillus subtilis Pro1A2 in cultivation of melons | |
| CN108220211B (en) | Acinetobacter oleophilic NMB17 and application thereof in plant disease control | |
| CN112980721B (en) | Bacillus belgii and biocontrol preparation and application thereof | |
| CN117165494A (en) | Kiwi fruit canker biocontrol strain Wq-1 and application thereof | |
| CN111280183B (en) | Apple anthracnose leaf blight biocontrol microbial inoculum and preparation method and application thereof | |
| KR20080045346A (en) | Bacillus subtilis m27 and biological control of sclerotinia rot by using the same | |
| CN110373344B (en) | Streptomyces carpio and application thereof | |
| CN112048457A (en) | Bacillus 31309 and application thereof in preventing and treating sclerotinia rot of colza | |
| CN115960777B (en) | Bacillus pseudomycoides and application thereof in prevention and treatment of vegetable epidemic disease | |
| CN109055265B (en) | Biocontrol bacterium and application thereof in prevention and control of gummy stem blight of crops | |
| CN116536207A (en) | Bacillus atrophaeus WLKYSY-4, biological microbial inoculum and application thereof | |
| CN114467975B (en) | Application of staphylococcus equi in prevention and treatment of fruit and vegetable diseases | |
| CN112375688B (en) | Beauveria bassiana and application thereof in biological prevention and control of corn northern leaf blight | |
| CN114806892A (en) | Trichoderma atroviride strain and application thereof in preventing and treating panax notoginseng root rot |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |