CN113150154B

CN113150154B - Anti-human PDL1 monoclonal antibody and application thereof

Info

Publication number: CN113150154B
Application number: CN202110407095.9A
Authority: CN
Inventors: 陈明久; 马志清; 彭则羽
Original assignee: Boaoxin Biotechnology Nanjing Co ltd
Current assignee: Boaoxin Biotechnology Nanjing Co ltd
Priority date: 2021-04-15
Filing date: 2021-04-15
Publication date: 2022-05-10
Anticipated expiration: 2041-04-15
Also published as: CN113150154A

Abstract

The invention belongs to the technical field of biology, relates to an anti-human PDL1 monoclonal antibody and application thereof, and also provides a coding nucleic acid molecule, an expression vector, a host cell and a method for expressing the antibody. The monoclonal antibody of the invention can specifically recognize human PDL1, the binding affinity of the monoclonal antibody and human PDL1 is stronger than that of the existing monoclonal antibody of human PDL1, and the sequence is novel.

Description

Anti-human PDL1 monoclonal antibody and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a high-affinity and functional anti-human PDL1 monoclonal antibody or antibody fragment. The invention also provides a coding nucleic acid molecule of the antibody, an expression vector, a host cell and a method for expressing the antibody. Antibody immunoconjugate conjugates, bispecific molecules, chimeric and antigen receptors, pharmaceutical compositions, and diagnostic and therapeutic methods comprising the antibodies of the invention are also provided.

Background

Programmed death ligand 1(PD-L1), also known as Cluster of differentiation 274(CD274) or B7 homolog 1(B7-H1), is a 40kDa type I transmembrane protein. PDL1 is a surface glycoprotein ligand for PD-1, which is a key immune checkpoint receptor expressed by activated T and B cells and mediates immunosuppression. PDL1 is associated with suppression of immune system responses during chronic infections, pregnancy, allografts, autoimmune diseases and cancer. PDL1(Katsuya Y. et al. (2015); immunologic status of PD-L1 in thymic and thymic carcinoma ". 2015. C. and immunologic Cancer". C. in 154. C. 159; Nakanishi J. et al. (2007); expression of tumor B7-H1 (PD-L1); histological evaluation with tumor and biological Cancer in human Cancer cells such as squamous cell carcinoma of the head and neck, melanoma and brain tumor, thyroid, thymus, esophagus, Lung, breast, gastrointestinal tract, colorectal, liver, pancreas, kidney, adrenal cortex, bladder, urothelium, ovary and skin; Lung Cancer.88 (2015) PDL. C. G. E. H. (2015). C. G. C. D. G. E. G. D. G. E. G. E. G. E. G. D. G. E. G. E. G. No. 3. D. G. D. G. D. G. No. 7. D. g. 3. D. g. D. g. D. g. 3. D. C. D -1expression in an adaptive cardiovascular cancer an expression binary studio ". J Immunother cancer.3: 3; strome SE et al (2003), "B7-H1block additives additive T-cell immunological for squamous cell carcinosoma". Cancer Res.63(19): 6501-; jacobs JF.et al (2009), "Regulation T cells and the PD-L1/PD-1pathway medium reactions in major human vaccines". Neuro Oncol.11(4): 394-402; wilmotte R.et al (2005), "B7-homolog 1expression by human glioma: a new mechanism of immuneevaluation". Neuroreport.16(10): 1081-. PDL1 is rarely expressed in normal tissues, but is inducible at the Tumor site (Dong H.et al (2002) ' Tumor-associated B7-H1 proteins T-cell apoptosis: exogenous mechanisms of animal evaluation. Nat. Med.8(8): 793-503800; Wang.et al (2016) ' PD-L1 expression in human cameras and entities association with clinical outputs ' co Targets The.9: 5023-5039). PDL1 down-regulates T-cell activation and cytokine secretion by binding to PD-1 (Freeman. et al (2000) '"Prolactin: structure, function, and regulation of secretion". Physiol Rev.80(4): 1523-; Latchman. et al (2001)' "PD-L2 a second ligand for PD-1and inhibition T cell activation". Nat Immunol.2(3): 261-). 268). PD-1 activated by PDL1 may provide an immune-tolerant environment for the development and growth of tumors. PDL1 also down-regulates T cell function by interacting with another receptor, B7.1(B7-1, CD 80).

Inhibition of the PDL1/PD-1 interaction can provide potent anti-tumor activity. A variety of antibodies against PDL1 are known (e.g. WO 2013/079174 and WO 2017/118321), and many antibodies that disrupt PD-1 signaling have entered the clinical development stage. These antibodies fall into two main categories: antibodies targeting PD-1 (nivolumab, Bristol-Myers Squibb; pembrolizumab, Merck, Whitehouse Station, NJ; pidilizumab, CureTech, Yavne, Israel) and antibodies targeting PDL1 (MPDL3280A, Genentech, South San Francisco, CA; MEDI4736, MedImmune/AstraZeneca; BMS-936559, Bristol-Myers Squibb; MSB0010718C, EMD Serono, Rockland, MA) (Postow MA. et. 2015. "Immune ckpepper copy". J Clin Oncol.33(17): 1974-82). Targeting PDL1 may result in different biological effects than targeting PD-1. PD-1 antibodies can prevent PD-1 from interacting with its two ligands PDL 1and PDL 2. Although the effect of PD-1 interaction with PDL2 is still unknown, PDL1 antibody does not prevent PD-1 from interacting with PDL 2. However, PDL1 antibody not only prevents the interaction of PDL1 with PD-1, but also with B7-1 (button MJ. et al (2007) 'Programmed depth-1 ligand 1 interactions with the B7-1 molecules to inhibit T cell responses'. Immunity.27(1): 111) 122), which is believed to produce a negative signal to T cells. Blocking PDL1 has shown encouraging early data, and four clinical anti-PDL 1 mabs are currently being tested: atezolizumab and MEDI4736 (both Fc null variants of human IgG1), MSB001078C (IgG1) and BMS-936559(IgG4) (Chester c.et al (2016). "4-1BB agonist: addressing the activator to Cancer immunity". Cancer immunity.65 (10): 1243-8).

To date, no satisfactory method has been demonstrated to induce an effective immune response in cancer patients. There is a need in the art to create therapeutic modulators and methods of improved PDL1/PD-1 interaction to overcome the immunosuppressive mechanisms observed in cancer patients.

Disclosure of Invention

In order to overcome the above-mentioned drawbacks, the present invention aims to provide an anti-human PDL1 monoclonal antibody and its use, which has high affinity and functionality, and which is superior to the existing anti-human PDL1 monoclonal antibody.

In order to achieve the above object, the present invention provides an anti-human PDL1 monoclonal antibody, comprising: heavy and light chains;

the heavy chain and the light chain both comprise a variable region, the variable region comprising a complementarity determining region;

the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain are denoted by CDR-H1, CDR-H2 and CDR-H3, respectively;

the complementarity determining regions CDR1, CDR2 and CDR3 of the light chain are represented by CDR-L1, CDR-L2 and CDR-L3, respectively;

the amino acid sequence of the CDR-H1 is SEQ ID NO: 3 is shown in the specification;

the amino acid sequence of the CDR-H2 is SEQ ID NO: 4 is shown in the specification;

the amino acid sequence of the CDR-H3 is SEQ ID NO: 5 is shown in the specification;

the amino acid sequence of CDR-L1 is SEQ ID NO: 6 is shown in the specification;

the amino acid sequence of CDR-L2 is SEQ ID NO: 7 is shown in the specification;

the amino acid sequence of CDR-L3 is SEQ ID NO: shown in fig. 8.

The heavy chain variable region amino acid sequence is SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the light chain variable region is SEQ ID NO: 2, respectively.

A nucleotide molecule encoding said anti-human PDL1 monoclonal antibody;

the sequence of the nucleotide molecule is selected from SEQ ID NO: 9 and SEQ ID NO: 10;

sequence SEQ ID NO: 9 encodes the heavy chain variable region of said antibody;

sequence SEQ ID NO: 10 encodes the light chain variable region of said antibody.

An expression vector containing the nucleotide molecule.

A host cell comprising said expression vector.

A preparation method of an anti-human PDL1 monoclonal antibody comprises the following steps:

step 1: preparing an expression vector containing a nucleotide molecule for expressing the anti-PDL 1 monoclonal antibody;

step 2: transfecting a eukaryotic host cell with the expression vector of step 1;

and step 3: culturing the eukaryotic host cell transfected in step 2;

and 4, step 4: separating and purifying to obtain the antibody.

The invention also relates to antibody immunoconjugate conjugates, bispecific molecules, chimeric antigen receptors or pharmaceutical compositions comprising the aforementioned anti-human PDL1 monoclonal antibody.

Both the heavy and light chains also include a constant region that is a constant region of murine IgG, preferably IgG 2.

The heavy chain and the light chain both comprise constant regions, and the constant regions of the heavy chain are shown as SEQ ID NO: 11 is shown in the figure; the light chain constant region is shown as SEQ ID NO: shown at 12.

Compared with the prior art, the invention has the following advantages:

the monoclonal antibody of the invention can specifically recognize human PDL1, the binding affinity of the monoclonal antibody and human PDL1 is stronger than that of the existing monoclonal antibody of human PDL1, and the sequence is novel.

Drawings

FIG. 1 is a capture ELISA to determine the binding capacity of antibodies to human PDL1 protein;

FIG. 2 is a graph of indirect ELISA assay of antibody cross-reactivity to cynomolgus monkey PDL1 protein;

FIG. 3 is a flow cytometry analysis of antibody binding to cell membrane surface PDL1 protein;

FIG. 4 is a ligand receptor binding blocking ELISA;

FIG. 5 is a reference antibody blocking ELISA;

FIG. 6 is a flow cytometry evaluation of antibodies blocking the binding of PD1 protein to cell membrane surface PDL1 protein;

fig. 7 shows the function evaluation experiment of PDL1 monoclonal antibody.

Detailed Description

The invention will be further illustrated by means of the following examples, without however restricting its scope to these examples.

Firstly, obtaining an antibody:

example 1 mouse monoclonal antibody specific against PDL1 obtained by the fusion hybridoma technique

1.1 animal immunization

Mice were immunized according to methods commonly used in the literature (E Harlow, D.Lane, Antibody: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998). The immunogen is recombinant human PDL1-Fc protein (self-produced by a company, and the inserted amino acid sequence is FTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHTAELVIPELPLAHPPNERTEPKSCDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK). Recombinant human PDL1 his-tagged protein (ACRO, Cat # PD1-H5229) was used as a detection antigen for determination of serum titers and hybridoma screening. Briefly, the appropriate amount of Freund's adjuvant was removed into a 1.5ml EP tube and mixed well with a shaker. Human PDL1-Fc antigen protein solution was prepared with PBS. Mixing adjuvant and protein antigen solution according to required amount, emulsifying antigen by injector to form stable water-in-oil solution, and injecting into animal. According to the result of serum titer measurement, 2 to 3 times of boosting immunization is usually required after the first immunization to achieve good immune effect. And (3) selecting an immune mouse with high serum titer for intraperitoneal injection, and performing cell fusion after final immunization.

1.2 hybridoma fusion and screening

Prior to cell fusion, mouse myeloma cells (SP2/0-Ag14, ATCC, Cat # CRL-1581) were cultured in logarithmic growth phase. Immunized mice were sacrificed and spleens were harvested in sterile environment and splenocytes B cells and SP2/0 myeloma cells were chemically fused using PEG according to literature procedures (E Harlow, D.Lane, Antibody: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998); Kohler G, and Milstein C, "Continuous cultures of fused cell secreted antibodies of predefined specificity," Nature,256: 495-. After the fusion, the cells are plated in 96-well cell culture plates, and the growth of the viable hybridoma cells can be observed under a microscope after 7 to 10 days. Two weeks after cell plating, each well culture supernatant was collected and hybridoma screening was performed using human PDL1-Fc protein antigen by ELISA method. Briefly, 60. mu.l of goat anti-mouse IgG F (ab')₂Specific fragments (Jackson Immunoresearch Laboratories, Inc., Cat # 115-. After washing the plate 1 time with 0.05% Tween 20 in PBS (i.e., 1 XPBST), 200. mu.l/well of 5% skim milk powder in PBST was added and blocked at 37 ℃ for 2 h. The plate was washed again and added to 60. mu.l/well hybridomaThe clear plates were incubated at 37 ℃ for 40min and then washed 4 times. Add 100. mu.l/well of biotin-labeled human PDL1 Fc protein solution (1:1000 diluted in 1XPBST with 2.5% skim milk powder), incubate 40min at 37 ℃ and wash the plate 4 times, pat dry. Then add 1: horse radish peroxidase-labeled streptavidin (Jackson ImmunoResearch Laboratories, Inc., Cat # 016. sup. 030. sup. 084) diluted in 5% skim milk powder in PBST was washed 4 times after incubation at 37 ℃ for 40min and patted dry. 100. mu.l/well of TMB (Innoreagents, Cat # TMB-S-002) chromogenic substrate was added, developed at room temperature for 5-15min, then stopped with 1M sulfuric acid solution, and absorbance was measured at 450nm for each well. The ELISA binding positive hybridoma well cells were picked out, transferred to a 24-well plate, and cultured. And performing a second round of secondary screening by an ELISA method, screening out a hybridoma which specifically recognizes the PDL1 antigen (the result is shown in Table 1, wherein D7D4A4B6 is the hybridoma obtained by the invention and expresses the anti-human PDL1 monoclonal antibody prepared by the invention), and subcloning by a limiting dilution method to obtain the target monoclonal cell strain. Then expressing the produced mouse monoclonal antibody in small quantity, and carrying out the next functional evaluation analysis on the purified antibody.

TABLE 1 fused hybridoma supernatant detection ELISA data

II, an in vitro analysis method:

example 2 in vitro assay for determining the functional Activity of the PDL1 monoclonal antibody

2.1 determination of the binding Capture ELISA-based antibody binding Capacity

Formulation of goat anti-mouse IgG F (ab') with 1xPBS₂A specific secondary antibody (Jackson ImmunoResearch Laboratories, Inc., Cat # 115-. After coating was completed, the plate was washed 1 time with PBS solution containing 0.05% Tween 20 (i.e., 1 XPBST), and 200. mu.l/well of 1XPBST solution containing 5% skim milk powder was added and blocked at 37 ℃ for 2 h. The plate was washed again and 100. mu.l/well of diluted antibody solution and PDL1 were addedafter-Benchmark (i.e.Tecntriq antibody, available from Roche), the plate was incubated at 37 ℃ for 40min and then washed 4 times. A biotin-labeled human PDL1 Fc protein solution (diluted 1:10000 in 1xPBST containing 2.5% skim milk powder) was added at 100. mu.l/well, incubated at 37 ℃ for 40min, and then the plate was washed 4 times. A1: 10000 dilution of horseradish peroxidase-labeled streptavidin (Jackson ImmunoResearch Laboratories, Inc., Cat # 016-. 100. mu.l/well of an ELISA chromogenic substrate TMB (Innoreagents, Cat # TMB-S-002) was added, and the mixture was developed at room temperature for 3 to 10min, then the development was stopped with a 1M sulfuric acid solution, and the absorbance at 450nm was measured for each well. Data processing was performed using GraphPad Prism software, the results are shown in fig. 1. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention can recognize human PDL1 antigen, and the binding activity is equivalent to PDL 1-Benchmark.

2.2 Indirect ELISA for determination of the Cross-reactivity of antibodies with cynomolgus PDL1 antigen

Cynomolgus monkey PDL1 antigen (Sino Biological Inc, Cat #90251-C08H) was prepared at a final concentration of 2. mu.g/ml using a1 Xcarbonate/bicarbonate buffer, and 100. mu.l/well was applied to a 96-well plate and coated at 37 ℃ for 2 hours. After coating was completed, the plate was washed 4 times with PBS solution containing 0.05% Tween 20 (i.e., 1 XPBST), and 200. mu.l/well of 1XPBST solution containing 5% skim milk powder was added and blocked at 37 ℃ for 2 h. The plate was washed again, and after adding a gradient of 100. mu.l/well to dilute the antibody solution, the plate was incubated at 37 ℃ for 40min and then washed 4 times. Add 1: a5000 dilution of horseradish peroxidase-labeled goat anti-mouse Fc γ specific fragment (Jackson ImmunoResearch Laboratories, Inc., Cat # 115-. 100. mu.l/well of an ELISA chromogenic substrate TMB (Innoreagents, Cat # TMB-S-002) was added, and the mixture was developed at room temperature for 3 to 10min, then the development was stopped with a 1M sulfuric acid solution, and the absorbance at 450nm was measured for each well. Data processing was performed using GraphPad Prism software, and the results are shown in fig. 2. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention has cross reaction with cynomolgus monkey PDL1 antigen, and the binding activity is better than that of PDL 1-Benchmark.

2.3 flow cytometry evaluation of the binding Capacity of antibodies to bind to cell Membrane surface PDL1 antigen

The GS-C2/PDL1 cell line (Genscript) in which human PDL1 protein was overexpressed on the membrane surface in the logarithmic growth phase was collected, and the cells were resuspended in FACS buffer (PBS solution containing 2% fetal bovine serum) after washing the cells 2 times with PBS. Adjust density to 1x10⁵The cells/well were plated in 96-well U-plates, centrifuged at 300g for 5min, the supernatant was decanted, and after addition of PDL1 antibody solution diluted in 10% FBS DMEM gradient and control antibody, the cells were incubated at 4 ℃ for 40 min. Centrifuge at 300g for 5min and decant the supernatant. The cells were washed 2 times with FACS buffer and 100. mu.L/well R-Phoryerythrin AffiniP F (ab')₂Fragment Goat Anti-Mouse IgG (H + L) (Jackson Immunoresearch, Cat # 115-. The cells were washed 2 more times with FACS buffer. Then 100. mu.L of PBS was added to each well for resuspension, and cells were blown down and examined on the machine. The mean fluorescence intensity MFI value per well of cells was determined using a BD Canto II model flow cytometer. Data processing using GraphPad Prism software gave antibody-bound cell ECs₅₀The concentration values (i.e., the corresponding antibody concentration values at which 50% of the maximum fluorescence binding signal of the antibody was reached) are shown in FIG. 3. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention can specifically bind to human PDL1 protein on the surface of cell membrane, and the binding activity is equivalent to PDL 1-Benchmark.

2.4PDL1 antibody blocking Activity assay

2.4.1 ligand receptor binding blocking ELISA

The blocking ability of the PDL1 antibody to PD1/PDL1 binding was assessed by a competition ELISA method. Briefly, human PDL1 Fc antigen was prepared at a final concentration of 2. mu.g/ml using a1 Xcarbonate/bicarbonate buffer, applied to a 96-well plate at 100. mu.l/well, and coated at 37 ℃ for 2 h. After coating was completed, the plate was washed 1 time with PBS solution containing 0.05% Tween 20 (i.e., 1 XPBST), and 200. mu.l/well of 1XPBST solution containing 5% skim milk powder was added and blocked at 37 ℃ for 2 h. The plate was washed again, and after adding a 100. mu.l/well gradient diluted antibody solution, the plate was incubated at 37 ℃ for 40min and then washed 4 times. Add 1: biotin-labelled human PDL1 Fc antigen at 4000 dilutions was incubated at 37 ℃ for 40min, plates were washed 4 times and patted dry. Then 100 u l/hole is added with 1:10000 diluted in 1x PBST solution of horse radish peroxidase labeled streptavidin, 37 degrees C were incubated for 40min, plate washing 4 times, dried. TMB was added to the reaction mixture to develop color and 1M sulfuric acid was added to terminate the reaction, and the absorbance at 450nm was measured. Data processing using GraphPad Prism software gave IC50 concentration values for antibodies blocking PD1/PDL1 binding, and the results are shown in fig. 4. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention can specifically block the binding of PD 1and PDL1, and the blocking capability is equivalent to that of PDL 1-Benchmark.

2.4.2 reference antibody blocking ELISA

The blocking ability of the PDL1 antibody to block reference antibody/PDL 1 antigen binding was assessed by a competition ELISA method. Briefly, a reference antibody (PDL1-Benchmark) was prepared at a final concentration of 1. mu.g/ml in 1XPBS, applied to a 96-well plate at 100. mu.l/well, and coated overnight at 4 ℃. The following day, wash the plate 1 time with PBS solution containing 0.05% Tween 20 (i.e., 1 XPBST), add 200. mu.l/well of 5% skim milk powder in PBST, block at 37 ℃ for 2h, and wash the plate 4 times again. PDL1 antibody or control antibody is diluted in a gradient in human PDL1 Fc protein solution containing biotin markers, and is pre-incubated for 40min at room temperature after preparation. The incubated antibody and PDL1 Fc biotin solution was then added to the reference antibody coated plate at 100. mu.l/well, incubated at 37 ℃ for 40min, and the plate was washed 4 times again. Then 100 μ l/well is added with horse radish peroxidase labeled streptavidin diluted 1:10000 in 1x PBST solution containing 5% skimmed milk powder, incubated for 40min at 37 ℃, plate washed 4 times, and patted dry. TMB was added to the reaction mixture to develop color and 1M sulfuric acid was added to terminate the reaction, and the absorbance at 450nm was measured. Data processing using GraphPad Prism software gave IC of antibodies blocking binding of reference antibody to PDL1₅₀The concentration values are shown in FIG. 5. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention can specifically block PDL1 protein from binding to the reference antibody PDL1-Benchmark, and the blocking ability is equivalent to that of PDL1-Benchmark, which indicates that the D7D4A4B6 monoclonal antibody of the invention binds to the antigen with the epitope similar to that of PDL 1-Benchmark.

2.4.3 flow cytometry evaluation of antibodies blocking the binding of PD1 protein to cell membrane surface PDL1 protein

Collecting in logarithmic growth phaseGS-C2/PDL1 cell line (Genscript) overexpressing human PDL1 protein on the membrane surface was washed 2 times with PBS, and then the cells were resuspended in FACS buffer (2% fetal bovine serum in PBS). Adjust density to 1x10⁵The cells/well were plated in a 96-well U-plate, centrifuged at 300g for 5min, the supernatant was decanted, and PDL1 antigen and control antibody diluted in FACS buffer were added at 100. mu.l/well to a cell plate of GS-C2/PDL1 overexpressing human PDL1 protein on the membrane surface. Incubate at 4 ℃ for 40min, centrifuge at 300g for 5min, and decant the supernatant. The cells were washed 2 more times with FACS buffer and 100. mu.L/well biotin-labeled human PD1 Fc (1:1500 diluted in FACS buffer) was added. After incubation at 4 ℃ for 40min, 300g were centrifuged for 5min and the supernatant decanted. The cells were washed 2 times with FACS buffer, 100. mu.L of SA-PE (Jackson Immunoresearch, Cat # 016. sup. 110-one 084, 1: 500 dilution) was added to each well, incubated at 4 ℃ for 40min, centrifuged at 300g for 5min, and the supernatant was decanted. The cells were washed 2 more times with FACS buffer. Then 100. mu.L of PBS was added to each well for resuspension, and cells were blown down and examined on the machine. The mean fluorescence intensity MFI value per well of cells was determined using a BD Canto II model flow cytometer. Data processing using GraphPad Prism software gave IC50 concentration values for antibodies blocking PD1/PDL1 binding, and the results are shown in fig. 6. As can be seen from the figure, the D7D4A4B6 monoclonal antibody can specifically block human PD1 protein from binding to human PDL 1ligand on the surface of a cell membrane, and the blocking capability of the monoclonal antibody is equivalent to that of PDL1-Benchmark, which indicates that D7D4A4B6 is a functional antibody which is equivalent to a reference antibody and has PD1/PDL1 blocking activity.

2.5PDL1 monoclonal antibody function evaluation experiment

GS-C2/PDL1 cell line (Genscript, antigen presenting cells) in logarithmic growth phase was collected and after washing the cells with DPBS (Hyclone, Cat # SH30028.02), the cells were resuspended in complete growth medium (F-12K medium containing 10% fetal bovine serum, purchased from Gibco). Density was adjusted to 20. mu.l/well (about 1X 10)⁴Individual cells) were plated on 384-well assay plates at 37 ℃ with 5% CO₂The incubator was used for overnight culture. The following day, a GS-J2/PD1 cell line (Genscript, effector cells) in logarithmic growth phase was prepared, centrifuged at 200g for 5min, and the supernatant was decanted. Cells were resuspended in assay buffer (purchased from Gibco, RPMI 1640 medium containing 1% fetal bovine serum). Regulating fineCell density of 7.5x10⁵Cells/ml. PDL1 cell supernatant was discarded, and 20. mu.l PDL1 antibody or control antibody (2-fold concentration assay buffer diluted in a gradient) and 20. mu. lPD1 cells (7.5X 10) were added⁵Cells/ml), 37 ℃, 5% CO₂The incubator is used for 6 h. After the incubation was completed, the 384 well cell culture plate was removed to room temperature. After 5-10min, 30. mu.l luciferase lysate reagent was added to each well. Standing at room temperature for 5min, and detecting bioluminescence intensity by using PHERAStarPlus instrument. Data processing was performed using GraphPad Prism software, and the results are shown in fig. 7. As can be seen from the figure, the D7D4A4B6 monoclonal antibody of the invention was able to reverse the decrease in luciferase expression induced by the PD-1-PD-L1 interaction in GS-J2/PD-1 cells, with an effect comparable to that of PDL 1-Benchmark.

Example 3 DNA cloning and sequencing, variable region sequencing of anti-PDL 1 mouse monoclonal antibody

Total RNA was extracted from the cultured mouse monoclonal Cell strain using FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Cat # RC 101). The procedure is briefly described below, with centrifugation collecting 1.5X10⁶The cells were transferred to a 1.5ml centrifuge tube and the supernatant was blotted dry. To the cell pellet was added 500. mu.l Buffer RL 1and vortexed. The treated cells were transferred to gDNA-Filter Columns (which had been placed in the collection tube), centrifuged at 13,000g for 2min at room temperature, and the supernatant in the collection tube was retained. Add 1.6 volumes of Buffer RL2 and mix gently. The mixture was transferred to RNAPure Columns, centrifuged at 13,000g for 1min at room temperature, and the waste liquid was discarded. To RNAcure Columns was added 500. mu.l Buffer RW1, and 13,000g was centrifuged at room temperature for 1min, and the waste liquid was discarded. Add 700. mu.l Buffer RW2, centrifuge at 13,000g for 1min at room temperature, discard the waste. Mu.l of Buffer RW2 was added thereto, and the mixture was centrifuged at 13,000g for 1min at room temperature, and the waste solution was discarded. Centrifugation at 13,000g for 2min was performed to completely remove Buffer RW2 remaining in RNAcure Columns. The column was transferred to a new RNase-free Collection Tubes 1.5ml centrifuge tube, and 50. mu.l of RNase-free ddH2O was suspended and dropped into the center of the column. The mixture was left at room temperature for 2min, and centrifuged at 13,000g at room temperature for 1min to elute RNA.

Next, the cDNA kit for reverse transcription from Takara (Cat #6210A) was used to convert the total RNA to cDNA. The experimental system was prepared as follows, 5. mu.l total RNA + 0.5. mu.l Oligo (dT)Primer+0.5μl Random 6mers+1.0μl dNTP Mixture+3.0μl RNase-free ddH₂O (total 10. mu.l). The mixture was pre-denatured at 65 ℃ for 5min and then placed on ice for 2 min. Further add 4. mu.l 5 XPrimeScript II Buffer + 0.5. mu.l RNase Inhibitor + 1.0. mu.l PrimeScript II RTase + 4.5. mu.l RNase-free ddH₂O (20 mul system in total), mixing, running the mixture at 40 ℃ for 50min by using a PCR instrument, and then running the mixture at 70 ℃ for 10min to complete the cDNA synthesis.

The cDNA was further added with Poly G at the 3' end, and the reaction system was prepared as follows: 5 μ l cDNA +33.5 μ l ddH₂O + 5. mu.l of 10x TdT Buffer + 5. mu.l of CoCl +1. mu.l of dGTP + 0.5. mu.l of Terminal TransPerase (total 50. mu.l system), mixed well, run at 37 ℃ for 30min using a PCR instrument, then shift to 70 ℃ for 10min, and the Poly G tailing addition is completed.

Further, gene amplification of the antibody variable region was carried out using the tailed cDNA as a template. For the sequence of the heavy chain variable region of the amplified antibody, a kit of nuozokerite (Cat # P525-03) is selected, and a PCR reaction system is prepared: mu.l 2X Phanta Max Master Mix (Dye Plus) + 2.0. mu.l BSJ-Pri3 AntiseneP-mIgG 1 (nucleotide sequence GCATCCCAGGGTCACCATGGAGTTAGTT) + 2.0. mu.l BSJ-Pri1Universal C1 (nucleotide sequence AAGCAGTGGTATCAACGCAGAGTCATCCCCCCCCCCCCCCCC) + 1.25. mu.l cDNA Plus Poly G tail + 19.75. mu.l ddH₂O (total 50. mu.l system). For the amplification of the antibody light chain variable region sequence, a PCR reaction system was prepared using Takara's kit (Cat # R010A): 10 μ L of 5 × PrimeSTAR Buffer +0.5 μ L of PrimeSTAR +1.25 μ L of BSJ-Pri1Universal C1 (nucleotide sequence AAGCAGTGGTATCAACGCAGAGTCATCCCCCCCCCCCCCCCC) +1.25 μ L of BSJ-Pri19 (nucleotide sequence GCACACGACTGAGGCACCTCCAGATGTT) +4 μ L of abrrant-L-R2 (nucleotide sequence TCTGGCTATAGTTATATGCACTGGAACCAACAGAAACCAGGACAGC) +4 μ L of dNTP +1.25 μ L of cDNA spiked with Poly G tail +27.75 μ L of ddH₂O (total 50. mu.l system).

The temperature cycles for PCR amplification of the variable regions of the antibody heavy chains were as follows:

98℃*5min+(98℃*10s+62℃*10s+72℃*1min)*2Cycle+

(98℃*10s+60℃*10s+72℃*1min)*4Cycles+

(98℃*10s+58℃*10s+72℃*1min)*10Cycles+

(98℃*10s+56℃*10s+72℃*1min)*20Cycles+

72℃*10min+4℃*∞

the temperature cycles for PCR amplification of antibody light chain variable regions are as follows:

98℃*5min+(98℃*10s+64℃*10s+72℃*1min)*2Cycle+

(98℃*10s+62℃*10s+72℃*1min)*6Cycles+

(98℃*10s+60℃*10s+72℃*1min)*12Cycles+

(98℃*10s+58℃*10s+72℃*1min)*16Cycles+

72℃*10min+4℃*∞

the PCR products were analyzed by 1% agarose gel electrophoresis, bands of DNA segments of corresponding sizes (about 500bp for VH, about 500bp for Vkappa light chain) were excised, and DNA extraction was performed using the gel DNA recovery kit from TIANGEN (Cat # DP 209-03). Briefly described as follows: the gel was weighed, an equal volume of solution PN was added, followed by incubation at 50 ℃ for 10min until the gel was completely dissolved. The resulting solution was transferred to a CA2 adsorption column (adsorption column placed in collection tube), left at room temperature for at least 2min, centrifuged at 12,000rpm at room temperature for 30sec, and the waste liquid was discarded. 600. mu.l of the rinsing solution PW was added to the column, and then centrifuged at 12,000rpm at room temperature for 30sec, to discard the waste liquid. Then, 600. mu.l of the rinsing solution PW was added to the column again, and the column was left to stand for 5min, centrifuged at 12,000rpm for 30sec at room temperature, and the waste liquid was discarded. And centrifuged again at 12,000rpm at room temperature for 2min to remove the liquid residue from the column, and left at room temperature for at least 2min to completely dry the residual liquid. The column was placed in a clean centrifuge tube, 35. mu.l of elution buffer EB was added and left at room temperature for at least 2 min. The prepared DNA sample was obtained by centrifugation at 12,000rpm for 2 min. The sequences of the variable regions of the antibodies obtained by sequencing the purified PCR products are shown in Table 2, the full-length amino acid sequence of the mouse monoclonal antibody PDL1 is shown in Table 3, and the nucleotide sequence of the mouse monoclonal antibody PDL1 is shown in Table 4.

TABLE 2 amino acid sequences of the variable regions and CDR regions of the PDL1 mouse monoclonal antibody

Table 3 full-length amino acid sequences of PDL1 mouse monoclonal antibodies are as follows:

table 4PDL1 mouse monoclonal antibody encoding DNA sequences are as follows:

in conclusion, the monoclonal antibody A1E7F8G7 capable of specifically recognizing human PDL1 has stronger binding affinity with human PDL1, has novel sequence, can specifically block the binding of human PD 1and human PDL1, and is a novel monoclonal functional antibody against human PDL 1.

While the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.

Sequence listing

<110> Boaoxin Biotechnology (Nanjing) Ltd

<120> anti-human PDL1 monoclonal antibody and use thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 120

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Leu Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Gln Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Thr Met His Trp Val Lys Gln Ser His Gly Lys Gly Leu Glu Trp Ile

35 40 45

Gly Gly Phe Asn Pro Asn Tyr Gly Thr Thr Ser Tyr Asn Glu Lys Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Val Arg Gly His Gly Phe Tyr Ala Tyr Val Met Asp Tyr Trp Gly Gln

100 105 110

Gly Thr Ser Val Thr Val Ser Ser

115 120

<210> 2

<211> 107

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Asp Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Thr Pro Gly

1 5 10 15

Asp Arg Val Ser Leu Ser Cys Arg Ala Ser Gln Arg Ile Ser Ala Tyr

20 25 30

Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser Pro Arg Leu Leu Ile

35 40 45

Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Ser Asp Phe Ile Leu Ser Ile Asn Ser Val Glu Pro

65 70 75 80

Glu Asp Val Gly Val Tyr Tyr Cys Gln Asn Gly His Ser Phe Pro Pro

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 3

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Asp Tyr Thr Met His

1 5

<210> 4

<211> 17

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gly Phe Asn Pro Asn Tyr Gly Thr Thr Ser Tyr Asn Glu Lys Phe Lys

1 5 10 15

Asp

<210> 5

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Gly His Gly Phe Tyr Ala Tyr Val Met Asp Tyr

1 5 10

<210> 6

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Arg Ala Ser Gln Arg Ile Ser Ala Tyr Leu His

1 5 10

<210> 7

<211> 7

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Tyr Ala Ser Gln Ser Ile Ser

1 5

<210> 8

<211> 9

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Gln Asn Gly His Ser Phe Pro Pro Thr

1 5

<210> 9

<211> 360

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaggtccagc tgcaacagtc tggacctgag ctgctgaagc ctggggcttc agtgaagata 60

tcctgccagg cttctggata cacattcact gactacacca tgcactgggt gaagcagagc 120

catggaaagg gccttgagtg gattggaggt tttaatccta actatggtac tactagctac 180

aacgagaagt tcaaggacaa ggccacattg actgtagaca agtcctcaag cacagcctac 240

atggagctcc gcagcctgac atctgaggat tctgcagtct attactgtgt aagaggacat 300

ggtttctacg cctatgttat ggactactgg ggtcaaggaa cctcagtcac cgtctcctca 360

<210> 10

<211> 321

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gacattgtga tgactcagtc tccagccacc ctgtctgtga ctccaggaga tagagtctct 60

ctttcctgca gggccagcca gagaattagc gcctatctac actggtatca acaaaaatca 120

catgagtctc caaggcttct catcaaatat gcttcccaat ccatctctgg gatcccctcc 180

aggttcagtg gcagtggatc agggtcagat ttcattctca gtatcaacag tgtggaacct 240

gaagatgtcg gagtgtatta ctgtcaaaat ggtcacagct ttcctccgac gttcggtgga 300

ggcaccaagc tggaaatcaa a 321

<210> 11

<211> 336

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly

1 5 10 15

Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Ser Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Ser Val His Thr Phe Pro Ala Leu Leu Gln Ser Gly Leu Tyr Thr Met

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Gln Thr Val

65 70 75 80

Thr Cys Ser Val Ala His Pro Ala Ser Ser Thr Thr Val Asp Lys Lys

85 90 95

Leu Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro Cys Pro Pro Cys

100 105 110

Lys Glu Cys His Lys Cys Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser

115 120 125

Val Phe Ile Phe Pro Pro Asn Ile Lys Asp Val Leu Met Ile Ser Leu

130 135 140

Thr Pro Lys Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro

145 150 155 160

Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala

165 170 175

Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr Ile Arg Val Val

180 185 190

Ser Thr Leu Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe

195 200 205

Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ser Pro Ile Glu Arg Thr

210 215 220

Ile Ser Lys Ile Lys Gly Leu Val Arg Ala Pro Gln Val Tyr Ile Leu

225 230 235 240

Pro Pro Pro Ala Glu Gln Leu Ser Arg Lys Asp Val Ser Leu Thr Cys

245 250 255

Leu Val Val Gly Phe Asn Pro Gly Asp Ile Ser Val Glu Trp Thr Ser

260 265 270

Asn Gly His Thr Glu Glu Asn Tyr Lys Asp Thr Ala Pro Val Leu Asp

275 280 285

Ser Asp Gly Ser Tyr Phe Ile Tyr Ser Lys Leu Asn Met Lys Thr Ser

290 295 300

Lys Trp Glu Lys Thr Asp Ser Phe Ser Cys Asn Val Arg His Glu Gly

305 310 315 320

Leu Lys Asn Tyr Tyr Leu Lys Lys Thr Ile Ser Arg Ser Pro Gly Lys

325 330 335

<210> 12

<211> 107

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

1 5 10 15

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

20 25 30

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

35 40 45

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

50 55 60

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

65 70 75 80

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

85 90 95

Pro Ile Val Lys Ser Phe Asn Arg Gly Glu Cys

100 105

<210> 13

<211> 1011

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gccaaaacaa cacccccatc agtctatcca ctggcccctg ggtgtggaga tacaactggt 60

tcctccgtga ctctgggatg cctggtcaag ggctacttcc ctgagtcagt gactgtgact 120

tggaactctg gatccctgtc cagcagtgtg cacaccttcc cagctctcct gcagtctgga 180

ctctacacta tgagcagctc agtgactgtc ccctccagca cctggccaag tcagaccgtc 240

acctgcagcg ttgctcaccc agccagcagc accacggtgg acaaaaaact tgagcccagc 300

gggcccattt caacaatcaa cccctgtcct ccatgcaagg agtgtcacaa atgcccagct 360

cctaacctcg agggtggacc atccgtcttc atcttccctc caaatatcaa ggatgtactc 420

atgatctccc tgacacccaa ggtcacgtgt gtggtggtgg atgtgagcga ggatgaccca 480

gacgtccaga tcagctggtt tgtgaacaac gtggaagtac acacagctca gacacaaacc 540

catagagagg attacaacag tactatccgg gtggtcagca ccctccccat ccagcaccag 600

gactggatga gtggcaagga gttcaaatgc aaggtcaaca acaaagacct cccatcaccc 660

atcgagagaa ccatctcaaa aattaaaggg ctagtcagag ctccacaagt atacatcttg 720

ccgccaccag cagagcagtt gtccaggaaa gatgtcagtc tcacttgcct ggtcgtgggc 780

ttcaaccctg gagacatcag tgtggagtgg accagcaatg ggcatacaga ggagaactac 840

aaggacaccg caccagtcct ggactctgac ggttcttact tcatatatag caagctcaat 900

atgaaaacaa gcaagtggga gaaaacagat tccttctcat gcaacgtgag acacgagggt 960

ctgaaaaatt actacctgaa gaagaccatc tcccggtctc cgggtaaatg a 1011

<210> 14

<211> 321

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgggctgatg ctgcaccaac tgtatccatc ttcccaccat ccagtgagca gttaacatct 60

ggaggtgcct cagtcgtgtg cttcttgaac aacttctacc ccaaagacat caatgtcaag 120

tggaagattg atggcagtga acgacaaaat ggcgtcctga acagttggac tgatcaggac 180

agcaaagaca gcacctacag catgagcagc accctcacgt tgactaagga cgagtatgaa 240

cgacataaca gctatacctg tgaggccact cacaagacat caacttcacc cattgtcaag 300

agcttcaaca ggggagagtg t 321

Claims

1. An anti-human PDL1 monoclonal antibody, wherein the antibody comprises a heavy chain and a light chain;

the heavy and light chains each comprise a variable region comprising a complementarity determining region;

the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain are represented by CDR-H1, CDR-H2 and CDR-H3, respectively;

the amino acid sequence of the CDR-H1 is shown as SEQ ID NO: 3 is shown in the specification;

the amino acid sequence of the CDR-H2 is shown as SEQ ID NO: 4 is shown in the specification;

the amino acid sequence of the CDR-H3 is shown as SEQ ID NO: 5 is shown in the specification;

the amino acid sequence of the CDR-L1 is shown in SEQ ID NO: 6 is shown in the specification;

the amino acid sequence of the CDR-L2 is shown in SEQ ID NO: 7 is shown in the specification;

the amino acid sequence of the CDR-L3 is shown in SEQ ID NO: shown in fig. 8.

2. The anti-human PDL1 monoclonal antibody according to claim 1, wherein the heavy chain variable region amino acid sequence is set forth in SEQ ID NO: 1 is shown in the specification; the variable region amino acid sequence of the light chain is shown as SEQ ID NO: 2, respectively.

3. The anti-human PDL1 monoclonal antibody according to claim 1, wherein the heavy chain and the light chain each comprise a constant region, and the heavy chain constant region is as set forth in SEQ ID NO: 11 is shown in the figure; the light chain constant region is shown as SEQ ID NO: shown at 12.

4. A nucleotide molecule encoding the anti-human PDL1 monoclonal antibody according to any one of claims 1-3.

5. The nucleotide molecule of claim 4, wherein the sequence of the nucleotide molecule comprises SEQ ID NO: 9 and SEQ ID NO: 10;

sequence SEQ ID NO: 9 encodes the heavy chain variable region of said antibody;

6. An expression vector comprising the nucleotide molecule of claim 4 or 5.

7. A host cell comprising the expression vector of claim 6.

8. The method for producing an anti-human PDL1 monoclonal antibody according to any one of claims 1-3, comprising the steps of:

preparing an expression vector containing a nucleotide molecule for expressing the anti-human PDL1 monoclonal antibody according to any one of claims 1-3;

transfecting eukaryotic host cells by using the obtained expression vector and culturing;

separating and purifying to obtain the anti-human PDL1 monoclonal antibody.

9. An antibody immunoconjugate, bispecific molecule, chimeric antigen receptor or pharmaceutical composition comprising an anti-human PDL1 monoclonal antibody of claim 1.