CN113144200A

CN113144200A - Application of SETD4 protein inhibitor in preparation of medicine for activating dormant tumor cells

Info

Publication number: CN113144200A
Application number: CN202110576965.5A
Authority: CN
Inventors: 杨卫军; 杨尧顺
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-01-15
Filing date: 2021-05-26
Publication date: 2021-07-23
Anticipated expiration: 2041-05-26
Also published as: CN115025223A; CN113144200B; CN114903975A; CN115025223B; CN115154586A; WO2022247453A1

Abstract

The invention discloses an application of an SETD4 protein inhibitor in preparation of a medicine for activating dormant tumor cells, wherein the SETD4 protein inhibitor comprises DEK protein, and the DEK protein has a conserved region shown in SEQ ID No. 25. The invention provides an SETD4 protein inhibitor, in particular to application of DEK protein in activating dormant tumor cells, eliminating tumor cells and curing tumors, DEK genes are directionally transferred into the dormant tumor cells or DEK protein is delivered in different stages of cancer patients, the dormant tumor cells can be activated to lose the resistance to tumor treatment, and in vitro experiments prove that the clearance rate of the quiescent cells of clinical breast cancer patients is 100%. The dormant tumor cells are thoroughly eliminated by combining with standard radiotherapy and chemotherapy treatment, so that the cure treatment of various cancers of human is realized, and the recurrence of tumors is avoided.

Description

Application of SETD4 protein inhibitor in preparation of medicine for activating dormant tumor cells

(I) technical field

The invention relates to an application of an SETD4 protein inhibitor in preparation of a medicine for activating dormant tumor cells, in particular to an application of DEK protein in combination with clinical tumor resection, radiotherapy and chemotherapy, targeting and immunotherapy to activate and eliminate the dormant tumor cells, so that tumor healing is realized, and various cancers are cured clinically.

(II) background of the invention

Cancer is still one of the major diseases of human health today. The number of new cancer patients is more than ten million people all the year round, and the number of cancer deaths is more than 670 ten thousand people. The existing cancer treatment methods mainly comprise surgical operation, radiotherapy, chemotherapy, targeted therapy and immunotherapy. While these treatments are able to eliminate and kill most tumor cells, they are unable to eliminate a small population of dormant tumor cells within the tumor. Although the number of dormant tumor cells in a tumor is small, the dormant tumor cells have the characteristics of extremely strong resistance to various clinical treatments, and generally have extremely strong capacity of forming tumors in vivo and tumor spheres in vitro. Activated dormant tumor cells promote tumor progression and metastasis, and are a major factor in the formation of malignant tumors. The dormant tumor cells can survive clinical radiotherapy and chemotherapy, targeting therapy and immunotherapy, and can be quickly activated and generate a large number of tumor cells after treatment, so that postoperative tumor relapse and metastasis of tumor patients are induced. Therefore, how to kill and eliminate dormant tumor cells is an insurmountable bottleneck problem in clinical tumor healing.

Research reports that the family protein (SETD) containing the SET structural domain has the activity of histone arginine methyltransferase and plays an important role in regulating the chromatin structure and regulating the transcriptional expression of genes in the cell proliferation process. Through more than ten years of research, a unique research model for the dormancy and activation of artemia embryonic stem cells is established. Using this model, we screened and obtained SETD4 protein regulated by cell dormancy, and elucidated the molecular mechanism of SETD4 promoting heterochromatin formation by catalyzing histone H4K20me3, thereby epigenetically regulating the process of artemia dormant embryo formation (document 1). On the basis, the SETD4 is found to epigenetically regulate the dormancy of breast tumor cells by the same mechanism, an evolutionary conservative mechanism for regulating stem cell dormancy by SETD4 is disclosed, and the SETD4 dormant tumor cells are found to be present in various clinical tumor patients such as liver cancer, lung cancer, pancreatic cancer, ovarian cancer, uterine cancer and the like, so that the number of the SETD4 dormant tumor cells of the late-stage tumor patients is remarkably increased compared with those of the early-stage patients (document 2). Therefore, the SETD4 protein can be used for marking dormant tumor cells and provides an important target for eliminating the dormant tumor cells. The method is a research report for molecularly marking dormant tumor cells in various tumors for the first time, and is a research report for discovering the epigenetic mechanism of tumor cell dormancy through histone modification (H4K20me3) for the first time.

Previous studies have shown that DEK, as a nuclear factor protein, can bind to chromatin and participate in the regulation of cell proliferation, differentiation, apoptosis, senescence, DNA damage repair and maintenance of stem cell characteristics. In addition, the protein is expressed in various tumor cells in high quantity and is related to the recurrence and metastasis of tumors. The DEK protein is synthesized and secreted by tumor cells and taken up by other cells, and thus is a protein having intracellular and intercellular activities. Furthermore, DEK proteins can be released from cells and into their target cells in a form free and contained in exosomes. We found that DEK is highly expressed during activation of resting embryos of artemia through research of artemia animal models, and found that DEK plays an important role in activation of resting cells by reducing expression of SETD4 protein and reducing H4K20me3 (document 3). In the invention, the DEK protein is expressed in high quantity in activated dormant tumor stem cells and tumor cells, the activation of the dormant tumor cells can be obviously inhibited by inhibiting the expression of the DEK protein, and the activation of the dormant tumor cells can be promoted by adding exogenous DEK protein. And the activated dormant tumor cells lose the capacity of resisting radiotherapy and chemotherapy, and the dormant tumor cells can be eliminated by using the radiotherapy and chemotherapy and the DEK protein for simultaneous treatment, so that the tumor is completely cured.

Literature

1.Li Dai,Sen Ye,Hua-Wei Li,Dian-Fu Chen,Hong-Liang Wang,Sheng-Nan Jia,Cheng Lin,Jin-Shu Yang,Fan Yang,Hiromichi Nagasawa and Wei-Jun Yang*.SETD4 regulates cell quiescence and catalyzes the trimethylation of H4K20 during diapause formation of Artemia.Molecular and Cellular Biology 37(7).pii,e00453-16(2017).

2.Sen Ye,Yan-Fu Ding,Wen-Huan Jia,Xiao-Li Liu,Jing-Yi Feng,Qian Zhu,Sun-Li Cai,Yao-Shun Yang,Qian-Yun Lu,Xue-Ting Huang,Jin-Shu Yang,Sheng-Nan Jia,Guo-Ping Ding,Yue-Hong Wang,Jiao-Jiao Zhou,Yi-Ding Chen and Wei-Jun Yang*.SET domain-containing protein 4epigenetically controls breast cancer stem cell quiescence.Cancer Research 79(18),4729–4743(2019).

3.Wen-Huan Jia,An-Qi Li,Jing-Yi Feng,Yan-Fu Ding,Sen Ye,Jin-Shu Yang and Wei-Jun Yang*.DEK terminates diapause by activation of quiescent cells in the crustacean Artemia.Biochemical Journal 476(12),1753–1769(2019).

Disclosure of the invention

The invention aims to provide application of an SETD4 protein inhibitor in preparation of a medicine for activating dormant tumor cells, and particularly relates to application of an exogenous DEK protein in preparation of a medicine for activating dormant tumor cells to enable the dormant tumor cells to lose resistance to radiotherapy and chemotherapy. The simultaneous treatment of clinical operation, radiotherapy and chemotherapy, targeting and immunotherapy and DEK protein can eliminate dormant tumor cells, thereby realizing the complete cure of the tumor.

The technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides an application of an SETD4 protein inhibitor in preparing a medicine for activating dormant tumor cells.

The SETD4 protein inhibitor comprises DEK protein, wherein the DEK protein has a conserved sequence shown in SEQ ID NO. 25.

Furthermore, the DEK protein has the similarity of more than 95% of the amino acid sequence of the NLS structural domain shown in SEQ ID NO. 2.

Further, the DEK protein has more than 95% of similarity of the amino acid sequence of the SAP structure domain shown in SEQ ID NO. 3.

Further, the DEK protein has more than 95% similarity of the amino acid sequence of the pseudo-SAP domain shown in SEQ ID NO. 4.

Further, the DEK protein has one or two of a pseudo-SAP domain shown in SEQ ID NO.4 or an SAP domain shown in SEQ ID NO.3, and simultaneously has an NLS domain shown in SEQ ID NO. 2.

Furthermore, the DEK protein has more than 95% of similarity of an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO. 22.

Furthermore, the DEK protein is selected from human DEK protein, has an amino acid sequence shown in SEQ ID NO.1, and has a coding gene sequence shown in SEQ ID NO. 5.

Furthermore, the DEK protein is selected from murine DEK protein, has an amino acid sequence shown in SEQ ID NO.22, and has a coding gene sequence shown in SEQ ID NO. 21.

The dormant tumor cells or tumors comprise head and neck tumors, breast tumors, digestive system tumors, genitourinary system tumors, bone and soft tissue tumors, lymphatic and blood system tumors and other tumors; wherein the head and neck tumors include brain cancer, eye cancer, ear tumor, jaw tumor, neck tumor, nasal cavity cancer, sinus cancer, nasopharyngeal cancer, gum cancer, tongue cancer, soft and hard palate cancer, maxilla cancer, mouth floor cancer, oropharyngeal cancer, lip cancer, maxillary sinus cancer, cancer of facial skin mucosa, laryngeal cancer, salivary gland tumor, thyroid cancer, meningioma, ependymoma, pituitary tumor, epithelial neuroblastoma, neuroectodermal tumor, and accessory ganglionic tumor; breast tumors include lung cancer, esophageal cancer, breast cancer, mediastinal tumors, and thymus; digestive system tumors including gastric cancer, carcinoma of large intestine, hepatocarcinoma, pancreatic cancer, bile duct cancer, and carcinoma of small intestine; genitourinary system tumors include renal cancer, prostate cancer, bladder cancer, testicular malignancy, penile cancer, cervical cancer, uterine cancer, ovarian cancer, fallopian tube cancer, and vaginal cancer; bone and soft tissue tumors include Ewing's sarcoma, adipose tumor, Kaposi's sarcoma, smooth muscle tumor, rhabdomyosarcoma, vascular tumor, synovial sarcoma, fibrosarcoma and bone cancer; tumors of the lymphatic and blood systems including malignant lymphoma, multiple myeloma, leukemia; other tumors include cardiac tumors, mesothelial tumors, fibroblast tumors, trophoblastic tumors, and melanoma.

In a second aspect, the present invention provides a SETD4 protein inhibitor delivery protein for activating dormant tumor cells, the delivery protein comprising a delivery DEK protein, the delivery DEK protein being a medically acceptable carrier containing the DEK protein, the carrier comprising exosomes, liposomes or nanomaterials. The definition and the applicable scope of the DEK protein, the dormant tumor cell or the tumor in the second aspect are the same as those in the first aspect.

Further, the exosome is a vesicle with a double-layer membrane structure and a size of 30-150nm secreted by a cell, when the vector is an exosome, the DEK protein is delivered by separating an exosome containing the DEK protein from a tumor cell line culture solution, or a DEK protein coding gene is connected into various gene expression vectors, and the DEK protein is over-expressed in various cell lines (recommended tumor cells) and the exosome containing the DEK protein is produced.

Further, the exosome containing the DEK protein obtained by accessing the DEK protein coding gene into a gene expression vector is prepared by one of the following methods: (1) plasmids overexpressing the DEK protein were constructed and transfected into various cell lines to make exosomes: inserting the DEK gene into EcoRI and Xba I sites of a pEGFP-C1 plasmid, and screening to obtain a recombinant plasmid pEGFP-C1-DEK; transferring the recombinant plasmid into a cell line by using a liposome transfer assistant lipo8000 (Biyunyan, cargo number: C0533), collecting a cell culture solution after over-expressing DEK protein, and separating and purifying an exosome solution A containing the DEK protein from the culture solution; (2) constructing lentivirus over expressing DEK protein and infecting the lentivirus into various cell lines to construct cell strains expressing the DEK protein for preparing exosomes: inserting DEK genes into EcoRI and Xba I sites of a lentivirus expression vector of pLent-N-GFP respectively, and screening to obtain a recombinant lentivirus expression vector pLent-N-GFP-DEK; transfecting 293T cells with the recombinant lentivirus expression vector pLent-N-GFP-DEK and a lentivirus packaging plasmid mixture together, collecting cell culture supernatant which is virus liquid after 72 hours of transfection, concentrating and purifying to obtain lentiviruses with over-expressed DEK proteins; infecting a cell line with a lentivirus overexpressing a DEK protein and constructing a cell strain overexpressing the DEK protein; collecting the cell culture fluid of the cell strain over-expressing the DEK protein, and separating and purifying an exosome solution B containing the DEK protein from the culture fluid. The exosome solution A containing the DEK protein or the exosome solution B containing the DEK protein is actually an exosome solution containing the DEK protein, and is named for distinguishing exosomes obtained by different methods, and the letter has no meaning per se.

Furthermore, there are various methods for separating exosomes from tumor cell line culture solution, and the exosomes are prepared by an exosome extraction reagent method, wherein the method comprises the following steps: adding an exosome separating reagent (brand: Thermo Fisher, product number: 4478359) into a tumor cell line culture solution, reversing the mixture from top to bottom for 3 times, uniformly mixing, incubating at 4 ℃ overnight, centrifuging the mixture at 10000rpm and 4 ℃ for 60 minutes the next day, removing supernatant, and re-suspending the precipitate at the bottom of a centrifuge tube by PBS (phosphate buffer solution), thus obtaining the crude exosome containing DEK protein.

Further, the cell lines of both the methods (1) and (2) are preferably 4T1, EMT6, MCF 7.

Further, the methods (1) and (2) of separating and purifying the DEK protein-containing exosome solution from the culture broth are both: and (3) separating the exosome from the cell culture solution by using an exosome extraction reagent to obtain exosomes, and sorting the exosomes containing DEK protein and having GFP positive and particle size range of 50-200nm by using a flow sorter.

Further, the Lentiviral Packaging plasmid mixture described in method (2) was derived from a Lentiviral Packaging use Kit (Lentiviral Packaging Kit, purchased from san-Okagae, cat # 41102ES10) consisting of pMDL, VSVG and pRSV-Rev in a mass ratio of 5:3: 2.

Further, the liposome is a microcapsule formed by a phospholipid bilayer artificial membrane in an aqueous solution, and when the carrier is the liposome, the DEK protein-containing liposome is prepared by a thin film hydration method: dissolving dipalmitoyl phosphatidylcholine (DPPC), cholesterol and distearoyl phosphatidyl acetamide-methoxy polyethylene glycol (2000DSPE-mPEG2000) in chloroform, carrying out reduced pressure rotary evaporation to obtain a uniform film, completely volatilizing residual chloroform in vacuum overnight, adding a PBS solution containing DEK protein, carrying out ice bath, carrying out 25KHz ultrasonic treatment for 20min to make a liposome membrane fall off, oscillating on an oscillator for 5min to fully hydrate to form turbid liquid, transferring the turbid liquid into an EP (ultraviolet) tube, and carrying out ultrasonic treatment for 30min at the power of 135W by using a probe to obtain a transparent uniform blue liposome suspension; ultrafiltering with 10kD ultrafiltering tube at 12000g rotation speed at 4 deg.C, taking out and blowing once every five minutes, supplementing PBS to remove free protein, and collecting retentate to obtain DEK protein-containing liposome suspension; the concentration of the PBS solution of the DEK protein is preferably 2 mg/ml; the mass ratio of the dipalmitoylphosphatidylcholine to the cholesterol is 1:0.1, the mass ratio of the dipalmitoylphosphatidylcholine to the distearoyl phosphatidyl acetamide-methoxy polyethylene glycol is 1:0.1, and the volume dosage of the chloroform is 0.1mL/mg calculated by the mass of the dipalmitoylphosphatidylcholine; the mass ratio of DEK protein in the PBS solution of dipalmitoyl phosphatidylcholine to DEK protein is 1: 0.2.

Further, the nano material is solid colloidal particles which can be used as a carrier for conducting or conveying drugs and are composed of natural or artificially synthesized macromolecules, wherein the size of the solid colloidal particles is 10-1000nm, and when the carrier is a nano material, the nano material containing DEK protein is prepared by adopting an improved solvent volatilization method: transferring a PBS (poly (butylene succinate)) solution of DEK protein into a dichloromethane solution of polylactic acid-glycolic acid copolymer (PLGA), carrying out ultrasonic treatment at 25KHz for 1 minute to form colostrum, transferring the colostrum into a polyvinyl alcohol (PVA) aqueous solution with the volume concentration of 1%, carrying out ultrasonic treatment at 25KHz for 5 minutes again to form multiple emulsion, stirring for 4 hours, after an organic solvent is volatilized, centrifuging at 18000r/min to collect precipitates, and carrying out freeze drying on the precipitates at-55 ℃ for 24 hours to obtain PLGA nanoparticles containing the DEK protein; preferably, the mass ratio of the DEK protein to the polylactic acid-glycolic acid copolymer is 1:0.1, the concentration of the DEK protein in PBS is 25 mg/L; the concentration of the dichloromethane solution of PLGA is 20mg/mL, and the volume dosage of the PVA aqueous solution is 1mL/mg based on the mass of DEK protein in the PBS solution of the DEK protein.

In a third aspect, the present invention provides the use of an inhibitor of the SETD4 protein in the preparation of an agent for activating dormant tumor cells, said agent comprising the DEK protein. The activation is to deliver an SETD4 protein inhibitor to the dormant tumor cells to achieve the purpose of activating the dormant tumor cells. The reagent can be used for clinical treatment and basic scientific research of tumors.

The agent for activating dormant tumor cells also comprises an SETD4 protein inhibitor and a medicament for eliminating tumor cells. The SETD4 protein inhibitor comprises DEK protein; the drug for eliminating tumor cells recommends paclitaxel or 5-fluorouracil. The method for eliminating the tumor cells achieves the purpose of eliminating the dormant tumor cells by combining the SETD4 protein inhibitor with conventional methods such as radiotherapy and chemotherapy, and particularly delivers the SETD4 protein inhibitor (particularly DEK protein, preferably through exosome, liposome and nano material) to the tumor cells while performing conventional treatments such as radiotherapy and chemotherapy, so as to achieve the purpose of activating and eliminating the dormant tumor cells and achieve the clinical tumor healing without metastasis and recurrence. The definition and the applicable scope of the DEK protein, the dormant tumor cell or the tumor in the third aspect are the same as those in the first aspect. Delivery of the SETD4 protein inhibitor to dormant tumor cells the delivery protein of the second aspect is employed.

In a fourth aspect, the invention provides an application of an SETD4 protein inhibitor in preparing an anti-tumor medicament, wherein the anti-tumor medicament comprises the SETD4 protein inhibitor and a medicament for removing tumor cells, and the SETD4 protein inhibitor comprises DEK protein; the drug for eliminating tumor cells recommends paclitaxel or 5-fluorouracil. The application is that the SETD4 protein inhibitor (especially DEK protein in the form of exosome, liposome and nano-carrier) is delivered to the tumor through intraperitoneal injection, intravenous injection or tumor body direct injection while performing clinical operation, radiotherapy and chemotherapy, targeted or immunotherapy, and simultaneously the purpose of removing the tumor is achieved by combining with the drug for removing the tumor cells. The definition and the applicable scope of the DEK protein, the dormant tumor cell or the tumor in the fourth aspect are the same as those in the first aspect. Delivery of the SETD4 protein inhibitor to dormant tumor cells the delivery protein of the second aspect is employed.

In a fifth aspect, the present invention provides a method for treating tumors by using an inhibitor of SETD4 protein, said method comprising: in tumor patients at various periods, the SETD4 protein inhibitor is delivered to tumors by intravenous injection, intraperitoneal injection or intrabody injection of the SETD4 protein inhibitor, so that dormant tumor cells are activated, and the dormant tumor cells are killed and thoroughly eliminated under the action of clinical operation, radiotherapy and chemotherapy, targeting or immunotherapy, and the clinical tumor healing without metastasis and recurrence is realized; the SETD4 protein inhibitor (especially DEK protein) enters a cell nucleus, is combined on a promoter of an SETD4 gene, closes the expression of SETD4, reduces the formation of heterochromatin, opens the expression of most genes, activates dormant tumor cells, and kills the activated dormant tumor cells by conventional methods such as radiotherapy, chemotherapy and the like; the inhibitor of SETD4 protein comprises a DEK protein injected in the form of a delivered DEK protein, which is an exosome, liposome or nanomaterial comprising the DEK protein, as described in the second aspect. The definition and the applicable scope of the DEK protein, the dormant tumor cell or the tumor in the fifth aspect are the same as those in the first aspect.

The invention screens and obtains the dormant tumor cells capable of resisting the treatment of radiotherapy and chemotherapy in human and mouse breast cancers through the radiotherapy and chemotherapy, and simultaneously discovers a functional protein capable of activating the dormant tumor cells and a gene thereof, wherein the total length of the DNA of the gene is 1128bp (SEQ ID NO.5), and the translation codes a protein (SEQ ID NO.1) consisting of 375 amino acids, namely DEK protein. The exogenous DEK protein (including an exosome containing the DEK protein secreted by the tumor cells) can enter and activate dormant tumor cells to lose the capacity of resisting radiotherapy and chemotherapy, and the dormant tumor cells after activation are eliminated by conventional methods such as radiotherapy and chemotherapy. The invention can activate and remove tumor resting cells in vivo tumors by simultaneously treating chemoradiotherapy and an exosome containing DEK protein in tumor-bearing mice, thereby realizing complete cure of the tumor-bearing mice, and definitely can remove the resting tumor cells by simultaneously treating the conventional methods such as chemoradiotherapy and the like and the exosome containing DEK protein or the exosome containing DEK protein (figure 7), and the tumor of the mice is not relapsed or metastatic after treatment in the experiment.

The mechanism of the DEK protein for activating the dormant tumor cells is as follows: the DEK protein is delivered to tumor tissues in vivo, can enter dormant tumor cells, is combined with promoters of genes such as SETD4, MYC and TP53, and the like to down-regulate the expression of SETD4 and p53 proteins and up-regulate the expression of MYC proteins. By reducing the level of H4K20me3, the level of heterochromatin structure is reduced, the level of euchromatin structure is increased, so that the pathways of intracellular signal transduction, gene expression, cell cycle and cell metabolism, cell transcription and translation, cell respiration, cell metabolism, DNA repair and the like related to cell proliferation and division are up-regulated, and the pathways of cell diapause, chromosome silencing, gene silencing, hypoxia metabolism, p53 signal pathway, epithelial mesenchymal transition and the like are down-regulated, so that dormant tumor cells are activated, and the dormant tumor cells are killed and eliminated under the condition of radiotherapy and chemotherapy, thereby realizing the clinical tumor healing without metastasis and relapse.

Compared with the existing method for clinically treating the tumor, the invention has the following beneficial effects: because the dormant tumor cells in the tumor have the capacity of resisting various clinical tumor treatments including radiotherapy, chemotherapy, targeting, immunotherapy and the like, and are the main reasons of tumor deterioration, metastasis and prognosis tumor recurrence, the invention provides an SETD4 protein inhibitor, in particular to the application of DEK protein in activating the dormant tumor cells, eliminating the tumor cells and curing the tumor.

The invention delivers the exogenous DEK protein to the dormant tumor cells, the exogenous DEK protein can be combined with chromatin, the heterochromatin is reduced, and the structure of euchromatin is increased, thereby causing a series of gene transcription and expression, further inducing the tumor cells to be converted from the dormant state to the activated state (the molecular mechanism is shown in figure 1), so that the tumor cells lose the resistance to various clinical treatments, and simultaneously combining the existing treatment methods such as radiotherapy, chemotherapy and the like to achieve the purposes of clearing the in vivo dormant tumor cells and clinically realizing the relapse-free cancer healing. The invention can directionally transfer DEK genes or deliver DEK proteins into resting tumor cells or tissues at different periods of cancer patients, can activate the resting tumor cells to lose the resistance to tumor treatment, and can thoroughly eliminate the resting tumor cells by combining standard radiotherapy and chemotherapy treatment. The clearance rate of the SETD4 protein inhibitor to 4T1 resting cells, EMT6 resting cells and MCF7 resting cells is 100%, and the clearance rate of the resting cells of clinical breast cancer patients is 100% through in vitro experiments. The method can be used for treating early tumors, and when the tumors are too small to be treated by operation, dormant tumor cells can be activated and thoroughly eliminated by the combined use of DEK exosomes and chemotherapy, so that the recurrence of the tumors is avoided, and the cure treatment of various cancers of human is realized. The method of the present invention can also be used in patients who have had a tumor surgically removed in situ but also have metastatic tumor cells present systemically, by the combined use of DEK exosomes and chemotherapy, to activate and eliminate dormant tumor cells that have metastasized elsewhere.

The invention relates to the first study and report about activation of dormant tumor cells by SETD4 protein inhibitor, and the first treatment of treating cancer by using DEK protein and standard clinical treatment, and no recurrence and metastasis. The invention has great application value in clinical treatment of curing various human cancers.

(IV) description of the drawings

FIG. 1 is a graph of the pattern of activation of dormant tumor cells by exosomes containing exogenous DEK proteins, killing them in conjunction with chemoradiotherapy.

FIG. 2 is a photograph of 4T1, EMT6 and MCF7 cells in adherent culture. Scale, 50 μm.

Fig. 3 is a light microscope photograph of 4T1, EMT6 and MCF7 tumors. Scale, 4 mm.

FIG. 4 is a photomicrograph of cells digested from 4T1, EMT6, and MCF7 tumors. Scale, 50 μm.

FIG. 5 is a photomicrograph of cells resistant to chemotherapy in 4T1, EMT6, and MCF7 tumors. Scale, 50 μm.

FIG. 6 is a immunoblot of SETD4, H3S10ph and PCNA of tumor cells resistant to chemoradiotherapy in 4T1, EMT6 and MCF7 tumors, with internal references GAPDH and H3, respectively.

FIG. 7 is the immunofluorescence results of ALDH1, CD44 and CD24 of quiescent tumor cells in 4T1, EMT6 and MCF7 tumors. Scale, 50 μm. DAPI indicates staining of the nuclei. Merge represents the overlay of four fluorescence channels.

Fig. 8 is a graph of the particle size distribution of 4T1, EMT6, and MCF7 cell-derived crude exosomes.

FIG. 9 is a transmission electron micrograph of 4T1, EMT6, and MCF7 cell-derived crude exosomes. Scale, 100 nm. Arrows indicate exosomes.

Fig. 10 is the immunoblot results of DEK, CD9, CD81 and CD63 of 4T1, EMT6 and MCF7 cell-derived crude exosomes.

FIG. 11 is a graphical representation of the immunoblot results and their quantitative statistics for DEK, H3S10ph, PCNA and SETD4 after addition of PBS and crude exosomes to 4T1, EMT6 and MCF7 dormant tumor cells, with internal references H3 and GAPDH, respectively.

FIG. 12 is the immunofluorescence results for ALDH1, CD44 and CD24 of activated quiescent tumor cells in 4T1, EMT6 and MCF 7. Scale, 50 μm. DAPI indicates staining of the nuclei. Merge represents the overlay of four fluorescence channels.

FIG. 13 is a photomicrograph and statistics of single cell in vitro balling of activated dormant tumor cells in 4T1, EMT6, and MCF 7. Scale, 2 mm. Red arrows indicate tumor spheres.

Fig. 14 is a photomicrograph and statistics of in vivo in situ tumorigenesis of 100, 10 or 1 activated dormant tumor cells in 4T1, EMT6 and MCF7, with 5 parallel controls set. Scale, 1 cm.

FIG. 15 is the immunofluorescence results of ALDH1, Ki67, SETD4 and DEK in solid tumor sections of 4T1, EMT6 and MCF7 quiescent tumor cells. a is the result of immunofluorescence for detecting ALDH1, Ki67 and SETD 4. b is the immunofluorescence results for detecting ALDH1, Ki67 and DEK. Scale, 10 μm. DAPI indicates staining of the nuclei. Merge represents the overlay of four fluorescence channels. Arrows indicate tumor cells positive for ALDH1 and negative for Ki 67.

FIG. 16 is the immunofluorescence results of ALDH1, Ki67, SETD4 and DEK in solid tumor sections with 4T1, EMT6 and MCF7 activating tumor cells. a is the result of immunofluorescence for detecting ALDH1, Ki67 and SETD 4. b is the immunofluorescence results for detecting ALDH1, Ki67 and DEK. Scale, 10 μm. DAPI indicates staining of the nuclei. Merge represents the overlay of four fluorescence channels. Arrows indicate tumor cells positive for ALDH1 and positive for Ki 67.

FIG. 17 is an immunoblot of SETD4 and DEK before and after activation of 4T1, EMT6 and MCF7 quiescent tumor cells (a) and their quantitative statistical plots (b, c), with internal references GAPDH and H3, respectively.

FIG. 18 is pFastBac^TMMap of HT A plasmid.

FIG. 19 shows human DEK protein (hDEK-GFP), murine DEK protein (mDEK-GFP), and human domain NLS mutant DEK protein (hDEK)^ΔNLSGFP) and murine Domain NLS mutant DEK protein (mDEK)^ΔNLSGFP). Arrows indicate the position of the protein. M represents a protein molecular weight standard.

FIG. 20 shows the addition of PBS and DEK to dormant tumor cells of 4T1, EMT6, and MCF7^ΔNLSImmunoblotting results and quantitative statistical plots for DEK-GFP, DEK, H3S10ph, PCNA and SETD4 after GFP or DEK-GFP, with internal references H3 and GAPDH, respectively.

FIG. 21 shows the addition of PBS and DEK to dormant tumor cells of 4T1, EMT6, and MCF7^ΔNLSImmunofluorescence results of GFP and cCasp3 of cells after GFP or DEK-GFP and statistical plots thereof, Scale, 50 μm. DAPI indicates staining of the nuclei.

FIG. 22 shows the addition of PBS and DEK to dormant tumor cells of 4T1, EMT6, and MCF7^ΔNLSTrypan blue staining of cells after GFP or DEK-GFP proteins and a statistical map of their mortality. Scale, 50 μm.

FIG. 23 is a map of pLent-U6-RFP-Puro plasmid.

FIG. 24 is an immunoblot and in vitro spheronization assay after DEK intervention in activated 4T1, EMT6 and MCF7 quiescent tumor cells. a is the immunoblot results and their quantitative statistical plots for DEK, H3S10ph, PCNA and SETD4, with references H3 and GAPDH, respectively. b is a photo of a light microscope for an in vitro balling test and a statistical chart of balling rate, a ruler and 400 mu m.

FIG. 25 shows the addition of PBS, DEK after one week of interference with DEK in activated 4T1, EMT6, and MCF7 quiescent tumor cells^ΔNLSImmunoblotting results and quantitative statistical plots of DEK-GFP, DEK, H3S10ph, PCNA and SETD4 of cells after GFP or DEK-GFP, with references H3 and GAPDH, respectively.

FIG. 26 shows the addition of PBS, DEK after one week of interference with DEK in activated 4T1, EMT6, and MCF7 quiescent tumor cells^ΔNLSPhotomicrographs and a statistical plot of the balling-up rate in vitro after GFP or DEK-GFP, scale, 400 μm.

FIG. 27 shows the addition of PBS and DEK to dormant tumor cells of 4T1(a), EMT6(b), and MCF7(c)^ΔNLSTransmission electron micrographs of cells after GFP or DEK-GFP and statistical plots of the relative levels of heterochromatin in the nuclei. Scale, 1 μm.

FIG. 28 shows the addition of PBS and DEK to dormant tumor cells of 4T1, EMT6, and MCF7^ΔNLSImmunoblotting results and their quantitative statistical plots for H4K20me1, H4K20me2, H4K20me3, HP 1-alpha, H3K9ac, H3K9me3 and H3K27me3 after GFP or DEK-GFP, with internal references H4 and H3, respectively.

FIG. 29 is a chromosome profile of DEK binding site peaks in activated MCF7 quiescent tumor cells analyzed by the binding site assay (ChIP-Seq).

FIG. 30 is a graph of ChIP-Seq analysis of the distribution of peaks of DEK binding sites in gene regions in MCF7 quiescent tumor cells after activation.

FIG. 31 is a gene ontology enrichment analysis of genes for ChIP-Seq analysis the peak of DEK binding site in activated MCF7 dormant tumor cells.

FIG. 32 is a graph of the visualization of the binding signals of DEK on SETD4, TP53 and MYC gene regions in activated MCF7 dormant tumor cells by ChIP-Seq analysis.

FIG. 33 shows the overall signal profile of the open genes in MCF7 dormant tumor cells before and after ATAC-Seq analysis activation. a is the distribution curve of reads against the TSS region, and b is the heat map of reads against the TSS region.

FIG. 34 shows the results of gene ontology enrichment analysis of genes whose patency was increased in MCF7 quiescent tumor cells before and after activation by ATAC-Seq analysis.

FIG. 35 is a visualization of ATAC-Seq signals on SETD4, TP53 and MYC gene regions from MCF7 dormant tumor cells before and after activation of ATAC-Seq analysis.

FIG. 36 shows the results of RNA-Seq analysis of gene differences between MCF7 quiescent tumor cells before and after activation. a is the clustering heat map of the difference genes, and b is the volcano map of the difference genes. padj denotes the corrected p-value.

FIG. 37 is a gene ontology enrichment assay of upregulated genes in MCF7 quiescent tumor cells before and after activation of RNA-Seq assay.

FIG. 38 is a gene ontology enrichment analysis of down-regulated genes in MCF7 dormant tumor cells before and after activation of RNA-Seq analysis.

FIG. 39 is a GSEA analysis of differential genes in MCF7 quiescent tumor cells before and after activation of RNA-Seq analysis. a is a set of genes that are up-regulated in the activated cells, and b is a set of genes that are down-regulated in the activated cells.

Fig. 40 is the GSEA analysis results of MYC targeted gene set and p53 targeted gene set. a is GSEA map, b is expression quantity heat map of significant difference gene in gene set.

FIG. 41 is a graph of 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS and DEK^ΔNLSImmunoblotting results and quantitative statistical plots for p53, p21, PUMA and MYC after GFP or DEK-GFP, with the internal reference β -actin.

FIG. 42 is the immunofluorescence results of cCasp3 and statistical results thereof after addition of PBS and crude exosomes to 4T1, EMT6 and MCF7 dormant tumor cells, scale, 50 μm.

FIG. 43 is a statistical plot of Trypan blue staining and mortality following the addition of PBS and crude exosomes to 4T1, EMT6 and MCF7 dormant tumor cells. Scale, 50 μm.

FIG. 44 is a graphical representation of immunoblot results and their quantitative statistics for H4K20me1, H4K20me2, H4K20me3, HP1- α, H3K9ac, H3K9me3, and H3K27me3 after addition of PBS and crude exosomes to 4T1, EMT6, and MCF7 dormant tumor cells with internal references H4 and H3, respectively.

FIG. 45 is a statistical chart showing the immunoblotting and quantitation of p53, p21, PUMA and MYC after adding PBS and crude exosomes to 4T1, EMT6 and MCF7 dormant tumor cells, with the internal reference being β -actin.

FIG. 46 is a map of the pEGFP-C1 plasmid.

FIG. 47 is a map of the pLent-N-GFP plasmid.

FIG. 48 shows DEK-GFP or DEK-containing cells derived from 4T1, EMT6, and MCF7^ΔNLS-particle size distribution curve of exosomes of GFP protein.

FIG. 49 DEK-GFP or DEK-containing cell sources of 4T1, EMT6, and MCF7^ΔNLSTransmission electron microscopy of sorted exosomes of GFP protein. Scale, 100 nm. Arrows indicate exosomes.

FIG. 50 shows DEK-GFP or DEK-containing cells derived from 4T1, EMT6, and MCF7^ΔNLSImmunoblotting results for DEK-GFP, DEK, CD9, CD81 and CD63 of sorting exosomes of GFP proteins.

FIG. 51 shows DEK-GFP or DEK in 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS^ΔNLSImmunoblotting results and their quantitative statistical plots for DEK-GFP, DEK, H3S10ph, PCNA and SETD4 after sorting exosomes for GFP proteins, with internal references H3 and GAPDH, respectively.

FIG. 52 shows DEK-GFP or DEK in 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS^ΔNLSImmunofluorescence results of cCasp3 after sorting exosomes of GFP protein and statistical results thereof, scale, 50 μm.

FIG. 53 shows DEK-GFP or DEK in 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS^ΔNLSTrypan blue staining of GFP protein after sorting exosomes and its mortality statistical plot. Scale, 50 μm.

FIG. 54 shows DEK-GFP or DEK in 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS^ΔNLSH4K20me1, H4K20me2, H4K20me3, HP 1-alpha, H3K9ac, H3K9me3 and H3K27 after sorting exosomes of GFP proteinsme3, and its quantitative statistical map, with references H4 and H3, respectively.

FIG. 55 shows DEK-GFP or DEK in 4T1, EMT6, and MCF7 dormant tumor cells supplemented with PBS^ΔNLSImmunoblot results and quantitative statistical plots of p53, p21, PUMA and MYC after sorting exosomes of GFP protein, internal reference β -actin.

FIG. 56 is a flow analysis result and statistical chart of the ratio detection of GFP positive exosomes contained in mouse plasma after intraperitoneal injection of sorting exosomes containing exogenous DEK-GFP proteins in mice.

FIG. 57 shows intraperitoneal injection of mice with DEK-GFP or DEK^ΔNLSImmunofluorescence results of GFP in tumor sections after sorting exosomes of GFP protein. Scale, 50 μm. DAPI indicates nuclear staining.

FIG. 58 is a graph showing immunofluorescence results and ratiometric statistics for SETD4 in tumor sections 24 hours after intraperitoneal injection of sorted exosomes containing DEK-GFP protein in mice. Scale, 50 μm. DAPI indicates nuclear staining.

FIG. 59 shows 4T1 tumor-bearing mice in radiotherapy group, radiotherapy and injection containing DEK^ΔNLSSorting exosome groups of GFP proteins and SETD4 immunofluorescence results and their ratio statistics of tumor sections in radiotherapy and injection of exosome groups containing DEK-GFP protein. Scale, 50 μm. DAPI indicates nuclear staining.

FIG. 60 shows the injection of DEK in the chemoradiotherapy group and the chemoradiotherapy of EMT6 tumor-bearing mice^ΔNLS-SETD4 immunofluorescence results and their ratio statistics of tumor sections in sorted exosome groups of GFP proteins and chemoradiotherapy and injection of sorted exosome groups containing DEK-GFP proteins. Scale, 50 μm. DAPI indicates nuclear staining.

FIG. 61 is a tumor size curve and a radiation therapy and sorting exosome injection protocol for 4T1 tumor-bearing mice.

FIG. 62 is a graph of lung metastases in 4T1 tumor-bearing mice after receiving a combination of radiation therapy and sorting exosomes. a is the result of hematoxylin eosin staining of lung tissue sections (scale, 1mm), b is a statistical chart of the number of lung metastases; in the figures, 1, 2, 3 and 4 denote enlarged regions.

FIG. 63 is a survival curve for 4T1 tumor-bearing mice after receiving a combination of radiation therapy and sorting exosomes.

FIG. 64 is a tumor size curve and a chemotherapeutic and chemo-therapeutic sorting exosome injection protocol for EMT6 tumor-bearing mice.

FIG. 65 is a tumor size curve and chemotherapy and sorting exosome injection protocol for MCF7 tumor-bearing mice.

FIG. 66 shows the proportion of SETD4 cells in breast cancer sections of clinical patients versus the stage of TNM. a is the sample information of the clinical patient and b is the proportion of SETD4 cells in breast cancer slices of patients in clinical stages I, II and III.

FIG. 67 is data of dormant tumor cells obtained from clinical breast cancer patient samples and killed using MCF7 sorting exosomes containing DEK-GFP protein in combination with chemotherapy. a is the dormant tumor cells resisting the radiotherapy and the chemotherapy obtained from the clinical breast cancer patient sample, and the scale is 50 mu m. b is activation by adding MCF7 containing DEK-GFP protein exosomes to dormant tumor cells, DAPI indicates nuclear staining, scale, 50 μm. c is killing of dormant tumor cells by addition of MCF7 containing DEK-GFP protein exosomes, scale 50 μm.

Figure 68 is data for activation and clearance of dormant tumor cells by DEK in combination with chemotherapy in various human tumor cells. a is the activation and elimination of dormant tumor cells by DEK binding chemotherapy in lung cancer H226 cells, scale, 50 μm. b is activation and elimination of dormant tumor cells by DEK binding chemotherapy in gastric cancer MKN45 cells, scale, 50 μm. c is activation and elimination of dormant tumor cells by DEK binding chemotherapy in prostate cancer PC-3 cells, scale, 50 μm. d is activation and elimination of dormant tumor cells by DEK-binding chemotherapy in cervical cancer HeLa cells, scale, 50 μm.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the percentage concentrations in the examples of the present invention are volume concentrations unless otherwise specified.

The Phosphate Buffer Solution (PBS) used in the invention has the following formula: sodium chloride at a final concentration of 137mM, potassium chloride at a final concentration of 2.7mM, disodium hydrogen phosphate dodecahydrate at a final concentration of 10mM, and potassium dihydrogen phosphate at a final concentration of 1.76mM, in water, the pH was adjusted to 7.4.

Primary and corresponding secondary antibodies used in immunoblot assays of the examples of the invention:

TABLE 1 Primary and secondary antibodies to proteins

Example 1 obtaining of mouse graft tumor

1. Cell lines

MCF7 cell line, human breast cancer cells, molecularly characterized as luminal A, purchased from China academy of sciences type culture Collection cell Bank with TCHU74, cell culture Medium EMEM Medium (Eagle's minimum Essential Medium, Corning, Cat: 10-009-cv) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.

The 4T1 cell line, a typical triple negative breast cancer cell, characterized by breast cancer similar to clinical stage IV, was purchased from American Type Culture Collection (ATCC) under the catalog number CRL-2539, and the cell culture Medium was DMEM Medium (Dulbecco's Modification of Eagle's Medium, Corning, catalog number R10-013-cv) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.

EMT6 cell line, mouse breast cancer cells, purchased from American Type Culture Collection (ATCC) under the accession number CRL-2755, and cell culture medium Waymouth's Medium (Gibco under the accession number 31220072) supplemented with fetal bovine serum at a volume concentration of 15% and penicillin-streptomycin of 1%.

After removing 1 tube of each of the frozen tubes of the fifth generation of 4T1, EMT6 and MCF7 cells from the liquid nitrogen tank, after 3 minutes of water bath at 37 ℃, centrifuging at 1000rpm for 5 minutes at 25 ℃, removing the supernatant, adding 1mL of the above-mentioned medium to resuspend the mixture, and inoculating the resuspension solution into a cell culture dish with a diameter of 10cm containing 9mL of the medium. The cell culture dish was incubated at 37 ℃ with 5% CO₂See fig. 2 for a photomicrograph of adherent cells in a humid environment.

2. Acquisition of mouse graft tumor

MCF7 cells 6-8 weeks old female Nod/Scid mice (purchased from Shanghai Si Laike laboratory animals, Inc.) were selected as the inoculation subjects. 1000 ten thousand MCF7 cells were added with 1mL of Phosphate Buffered Saline (PBS) containing 2500U/mL trypsin and 0.02% ethylenediaminetetraacetic acid (EDTA), incubated at 25 ℃ for 40 seconds, neutralized by adding 0.5mL of fetal bovine serum, the cells on the walls were blown down, centrifuged at 1000rpm at 25 ℃ for 5 minutes, and the supernatant was removed. The bottom 0.5g of the cell pellet was resuspended in 1mL of a mixture of EMEM medium (Corning, Cat: 10-009-cv) and matrigel (Corning BioCoat, Cat: 354234) at a volume ratio of 1:1 to obtain 1mL of a suspension containing 1000 ten thousand MCF7 cells. The MCF7 cell suspension was injected in situ into the mammary fat pad under the axilla of Nod/Scid female mice using a 1mL micro-syringe, each Nod/Scid mouse inoculated with 100 ten thousand MCF7 cells.

4T1 cells 6-8 weeks old BALB/c female mice (Beijing Wittingle laboratory animal technology Co., Ltd.) were selected as the inoculation subjects. 1000 ten thousand 4T1 cells were added with 1mL PBS containing 2500U/mL trypsin and 0.02% EDTA, incubated at 25 ℃ for 40 seconds, neutralized by adding 0.5mL fetal calf serum, the cells on the walls were blown down, centrifuged at 1000rpm at 25 ℃ for 5 minutes, and the supernatant was removed. The bottom 0.5g of the cell pellet was resuspended in 1mL of DMEM medium to obtain 1mL of a suspension containing 1000 million 4T1 cells. The 4T1 cell suspension was injected in situ into the mammary fat pad under the axilla of BALB/c females using a 1mL micro-syringe, each BALB/c female vaccinated with 100 ten thousand 4T1 cells.

The EMT6 cells were inoculated by BALB/c female mice (Experimental animals technology, Inc., Viton, Beijing) 6-8 weeks old. 400 ten thousand EMT6 cells were added with 0.5mL PBS containing 2500U/mL trypsin and 0.02% EDTA, incubated at 25 ℃ for 40 seconds, neutralized by adding 0.25mL fetal calf serum, the cells on the walls were blown down, centrifuged at 1000rpm at 25 ℃ for 5 minutes, and the supernatant was removed. The bottom 0.2g of the cell pellet was taken and resuspended in 2mL of Waymouth's medium to obtain 2mL of a suspension containing 400 million EMT6 cells. The EMT6 cell suspension was injected in situ into the mammary fat pad under the axilla of BALB/c females using a 1mL microsyringe, each BALB/c female was inoculated with 20 ten thousand EMT6 cells.

All mice were housed in sterile ringsIn the field, water and mouse food are continuously supplied, the padding is replaced in time, and the mouse is raised until the tumor volume reaches 500mm³Left and right, mice were euthanized for subsequent solid tumor procurement. The mouse experiment is all passed through the ethical examination of animal experiments, and experimenters obey welfare ethical principles of experimental animals when carrying out the experiment.

Example 2 acquisition and characterization of quiescent tumor cells resistant to chemoradiotherapy

1. Obtaining dormant tumor cells resisting radiotherapy and chemotherapy from solid tumor

Three tumor-bearing mice from example 1 were euthanized and solid tumors were surgically removed and the photomicrograph is shown in FIG. 3. The tumor is physically cut into small pieces by scissors, then the small pieces are further cut into powder, 1.5g of the tumor powder is put into 30mL of digestive juice (containing 1250U/mL of trypsin, 0.01 percent of EDTA and 2000U/mL of collagenase IV in a DMEM medium), the mixture is bathed in water at 37 ℃ for 20 minutes, and the mixture is manually shaken every 5 minutes. The digested cell sap was filtered through a 40 μm nylon membrane, and the filtrate, i.e., cells digested from solid tumors, was obtained as shown in FIG. 4.

The cells digested from the solid tumor were seeded at a density of 80 ten thousand per well in an ultra-low adsorption six-well plate (brand: Corning, cat. No.: 3471). 3mL of DMEM/F12 medium (Corning, Cat.: 10-092-cv) containing 10% serum replacement (Thermo Fisher Scientific Cat #10828028), paclitaxel at a final concentration of 100nM and 5-fluorouracil at a final concentration of 1mM was added to each well, incubated at 37 ℃ for 1 month, the medium was changed every 3 days, and 30Gy X-rays were irradiated once a week for a total of 2 times (two times every 7 days) for the first two weeks, each for 10 minutes. After one month, tumor cells resistant to radiotherapy and chemotherapy, i.e., quiescent tumor cells (DCCs), were selected using a dead cell removal kit (Miltenyi Biotec, Cat. No. 130-090-101), and quiescent tumor cells 4T1-DCCs, EMT6-DCCs, MCF7-DCCs, respectively, were obtained, and the photomicrograph is shown in FIG. 5.

2. Characterization of dormant tumor cells

(1) Detection of PCNA, H3S10ph and SETD4 by immunoblotting experiments

The 3 dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 were separated from the culture medium, 0.2mL of cell lysate (50mM Tris-HCl (pH 7.4), 150mM NaCl, 1% ethylphenylpolyethylene glycol (NP-40), 0.1% Sodium Dodecyl Sulfate (SDS)) was added to 400 ten thousand each of the cells, the cells were left on ice for 10 minutes, centrifuged at 12000rpm for 10 minutes at 4 ℃, the supernatant was transferred to a new centrifuge tube, 0.05mL of protein loading buffer (250mM Tris-hydrochloride, pH 6.8, 0.1g/mL sodium dodecyl sulfate, 0.005g/mL bromophenol blue, 50% glycerol and 0.05 g/mL. beta. -mercaptoethanol, the solvent was water), centrifuged in a boiling water bath for 10 minutes, at 12000rpm for 10 minutes at 25 ℃, the supernatant was obtained as a protein sample, transfer to a new centrifuge tube for subsequent loading. mu.L of the protein sample was subjected to polyacrylamide gel electrophoresis, and the protein in the gel was transferred onto a PVDF membrane (polyvinylidene fluoride membrane) (membrane transfer solution: 25mM tris, pH 8.3, 192mM glycine and 10% methanol in water). TBS buffer (12.1 g of tris (hydroxymethyl) aminomethane and 17.5g of sodium chloride dissolved in 1500mL of distilled water, hydrochloric acid added dropwise to adjust the pH to 7.4, and distilled water to a constant volume of 2000mL) was washed for 5 minutes for 1 time; blocking with blocking solution (brand: Roche, cat # 11921681001) for 1 hour. Antibodies against Mouse monoclonal anti-PCNA (abcam, cat # ab29), Rabbit monoclonal anti-H3S10ph (Cell signaling technology, cat # 53348) and Mouse monoclonal anti-SETD4Santa Cruz (cat # sc-134221), respectively, 2. mu.g each were added to 2mL of the blocking solution to prepare an anti-dilution solution, and the PVDF membrane was completely immersed in the dilution solution and incubated overnight at 4 ℃. The following day, PVDF membrane with 0.1% Tween TBS washing 4 times, each time for 7 minutes. 16.7. mu.L of the secondary antibody corresponding to Table 1 was added to 50mL of the blocking solution to prepare a secondary antibody dilution, and the PVDF membrane was completely immersed in the secondary antibody dilution and incubated at 25 ℃ for 40 minutes. PVDF membrane with 0.1% Tween TBS washing 4 times, each time 7 minutes. A horseradish catalase Substrate, Clarity Max Western ECL Substrate (BIO-RAD, cat # 1705062), was added to the PVDF membrane, immersed and examined with a developing instrument. Immunoblotting experiments found that all 3 kinds of dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) expressed very low levels of cell division index proteins PCNA and H3S10ph, but high levels of cell resting protein SETD4, and the immunoblotting is shown in FIG. 6.

(2) Immunofluorescence assay ALDH1, CD44 and CD24

The 3 dormant tumor cells obtained in step 1 (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) were fixed with 4% paraformaldehyde, respectively. The fixed cell suspensions were separately dropped onto adherent slides. After the cells were stably attached, the cells were washed 1 time with PBS for 5 minutes. The slides were incubated in PBS containing 0.25% Triton-100 for 10 minutes at 25 ℃ and washed 1 time in PBS for 5 minutes. The slides were then incubated in PBS containing 1.5% donkey serum (blocking solution) for 1 hour at 25 ℃. Rabbit monoclonal anti-ALDH1A1(abcam, cat # ab52492), Rat monoclonal anti-CD44, FITC (eBiosciences, cat # 11-0441-82) and Alexa

647anti-CD24(BioLegend, Cat. No.: 311109) antibodies 2. mu.g each were added to 200. mu.L of blocking solution (Brand: Roche, Cat. No.: 11921681001) to prepare a primary anti-dilution solution, which was dropped onto the cell sample on the slide glass and immersed and incubated overnight at 4 ℃. The next day, PBS was washed 3 times for 5 minutes each. Mu.g of Alexa Fluor 594 fluorescently labeled donkey anti-rabbit (Thermo Fisher scientific, cat # R37119) antibody was added to 200. mu.L of blocking solution (brand: Roche, cat # 11921681001) to prepare a secondary antibody dilution, which was dropped onto the cell sample in the slide of ALDH1, immersed, and incubated at 25 ℃ for 2 hours. 200 μ L of nuclear stained DAPI (Biyunyan, Cat. No.: C1005) was added dropwise to the cell sample on the slide glass, immersed, and incubated at 25 ℃ for 10 minutes. The slides were mounted with 50% glycerol. When the sample is observed by a fluorescence microscope, the cells express high level of ALDH1 and CD44 and low level of CD24 (figure 7), which indicates that the dormant tumor cells obtained by separation are tumor stem cells.

Example 3 preparation and characterization of tumor cell culture fluid-derived crude exosomes

1. Obtaining tumor cell culture fluid

500 million MCF7 cell lines were seeded into 90mm³The culture medium in the cell culture dish (2) was 10mL of EMEM medium supplemented with 1% penicillin-streptomycin (same as example 1). Culturing at 37 deg.C for 24 hr, collecting cell culture solution, centrifuging at 1000rpm and 4 deg.C for 10 min, collecting supernatant, centrifuging at 12000rpm and 4 deg.C for 20min, and collecting supernatant to obtain MCF7 cell culture solution.

500 million 4T1 cell lines were seeded into 90mm³The culture medium in the cell culture dish of (1) was 10mL of DMEM medium supplemented with 1% penicillin-streptomycin (same as in example 1). Culturing at 37 deg.C for 24 hr, collecting cell culture solution, centrifuging at 1000rpm and 4 deg.C for 10 min, collecting supernatant, centrifuging at 12000rpm and 4 deg.C for 20min, and collecting supernatant to obtain 4T1 cell culture solution.

500 million EMT6 cell lines were seeded at 90mm³The culture medium in the cell culture dish of (1) was Waymouth's medium supplemented with 1% penicillin-streptomycin (same as in example 1). Culturing at 37 deg.C for 24 hr, collecting cell culture solution, centrifuging at 1000rpm and 4 deg.C for 10 min, collecting supernatant, centrifuging at 12000rpm and 4 deg.C for 20min, and collecting supernatant to obtain EMT6 cell culture solution.

2. Preparation of crude exosomes

1mL of an exosome-separating agent (brand: Thermo Fisher, cat # 4478359) was added to 20mL of each of the MCF7, 4T1 and MCF7 cell culture solutions obtained in step 1, and the mixture was mixed by inverting the mixture 3 times and incubated overnight at 4 ℃. The next day, the mixture was centrifuged at 10000rpm and 4 ℃ for 60 minutes, the supernatant was removed, 200. mu.L of PBS was used to resuspend the pellet at the bottom of the centrifuge tube (the pellet was the crude exosome), the total amount of protein in the crude exosome suspension was measured using BCA protein quantitative assay kit (brand: manufacturer, cat # C503021), and PBS was used to prepare a crude exosome solution with a protein concentration of 20. mu.g/mL for subsequent use.

3. Identification of crude exosomes

(1) Coarse exosome particle size distribution

The 20. mu.g/mL of the crude exosome solution obtained in step 2 was examined using a Particle size analyzer (model: ZetaView, manufacturer: Particle Metrix), and it was found that the Particle sizes of the crude exosomes were all in the range of 50-300nm and the Particle size of the main body was all around 150nm (FIG. 8).

(2) Morphological characteristics of crude exosomes

mu.L of the 20. mu.g/mL crude exosome solution obtained in step 2 was dropped onto a copper mesh and covered the copper mesh surface (diameter 3.05mm, pore size 90 μm, thickness 18 μm, 200 mesh), incubated at 25 ℃ for 10 seconds, and excess crude exosomes were blotted off with filter paper. And (3) dropwise adding 2 mu L of aqueous solution containing 2% uranyl acetate onto a copper mesh, incubating at 25 ℃ for 10 seconds, and absorbing excess uranyl acetate by using filter paper. After the copper mesh was dried at 40 ℃ for 5 minutes, it was placed in a transmission electron microscope (model: JEM-1200EX, manufacturer: NEC), and the voltage was adjusted to 120kV, and a saucer-like vesicle having a double-layer membrane structure was observed, which conformed to the morphological characteristics of exosomes (FIG. 9).

(3) Immunoblotting to detect DEK, CD9, CD81 and CD63 in crude exosomes

Rabbit monoclonal anti-DEK (Proteintech, Cat. No.: 16448-1-AP), Rabbit monoclonal anti-CD9(Abcam, Cat. No.: ab92726), Rabbit monoclonal anti-CD81 were used

(Abcam, cat # ab109201) and Mouse monoclonal anti-CD63(Abcam, cat # ab59479) immunoblot analysis of the 20. mu.g/mL crude exosome solution obtained in step 2 with the indicator molecules CD9, CD81 and CD63 common to DEK and exosomes was performed (method same as in step 2 of example 2), and it was found that the crude exosomes expressed high levels of DEK protein and CD9, CD81 and CD63 proteins (FIG. 10). The above results verified the size, morphology and molecular characteristics of the crude exosomes one by one and indicated that the crude exosomes contain DEK proteins.

Example 4 activation of dormant tumor cells by crude exosomes from tumor cell culture fluid

1. Crude exosomes activate dormant tumor cells

Each 100 ten thousand of the 3 dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 of example 2 were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, and 25. mu.L of PBS (as a control) and 25. mu.L of the crude exosome solution of 20. mu.g/mL prepared in step 2 of example 3 were added to the cells to give a final concentration of 50ng/mL in the medium, respectively; after culturing at 37 ℃ for 20 hours, the cells were collected and immunoblot analysis was carried out using antibodies to Rabbit polyclonal anti-DEK (Proteintetech, Cat.: 16448-1-AP), Mouse monoclonal anti-PCNA (abcam, Cat.: ab29), Rabbit monoclonal anti-H3S10ph (Cell signaling technology, Cat.: 53348) and Mouse monoclonal anti-SETD4(Santa Cruz, Cat.: sc-134221) using H3 and GAPDH as references (method same as example 2, step 2), and found that the levels of DEK, PCNA and H3S10ph were increased and the level of SETD4 was decreased (FIG. 11). The research result shows that the external addition of crude exosome can activate dormant tumor cells. The collected cells were designated as activated dormant tumor cells (A-DCCs), and activated dormant tumor cells 4T1A-DCCs, EMT6A-DCCs, and MCF7A-DCCs were obtained, respectively.

2. Immunofluorescence detection of activated quiescent tumor cells ALDH1, CD44 and CD24

Immunofluorescence analysis of ALDH1, CD44 and CD24 was performed on the activated dormant tumor cells obtained above (same as step 2 of example 2), and it was also found that ALDH1 and CD44 were expressed at high levels and CD24 was expressed at low levels (fig. 12).

Example 5 activated dormant tumor cells have the ability to spherodize in vitro and to nodulate in vivo

1. In vitro tumor sphere formation ability assay

The activated dormant tumor cells obtained in example 4 (4T1A-DCCs, EMT6A-DCCs, MCF7A-DCCs) were seeded at a density of 1 cell/well in an ultra-low adsorption 96-well plate (brand: Corning, cat # 3469a) by a flow cytometric sorting machine. After 200. mu.L of DMEM/F12 medium containing 10% serum replacement was added to each well and cultured at 37 ℃ for three consecutive weeks, the cells were found to exhibit an extremely high capacity for in vitro tumor sphere formation (FIG. 13).

2. Ability to form tumors in mice

100, 10 and 1 of the activated dormant tumor cells (4T1A-DCCs, EMT6A-DCCs and MCF7A-DCCs) obtained in example 4 were diluted in 100. mu.L of a mixture of DMEM medium and matrigel (Corning BioCoat, Cat. No.: 354234) at a volume ratio of 1:1, to obtain cell fluids with different cell contents. 100 μ L of each cell sap was injected in situ into the mammary fat pad under the axilla of 6-8 week old Nod/Scid female mice (5 injections for each cell content of EMT6 and 4T1, 5 injections for 100 injections, 4 injections for 10 injections, 2 injections for 1 injection in MCF 7), the mice were housed in a sterile environment, water and mouse food were supplied continuously, and the padding was changed in time. The mice were euthanized when the feeding time was within half a year and the tumor diameter reached the ethical upper limit, and the tumor sites were surgically removed and photographed (fig. 14), and it was found that the cells exhibited a very strong tumorigenic capacity in the mice.

Example 6 identification of dormant and activated dormant tumor cells within solid tumors

1. Dormant tumor cells

100 ten thousand of 4T1-DCCs and 100 ten thousand of EMT6-DCCs cells obtained in example 2 were inoculated in situ into fat pads of 8-week female BALB/c mice, respectively, and 100 ten thousand of MCF7-DCCs cells were inoculated in situ into fat pads of 8-week Nod/Scid female mice. When the tumor volume reaches 500mm³On the left and right, mice were euthanized and tumors of 4T1-DCCs, EMT6-DCCs, and MCF7-DCCs were surgically removed. The tumors are respectively put into 4 percent paraformaldehyde for overnight at 4 ℃, soaked into 30 percent sucrose aqueous solution at 4 ℃ for dehydration for 48 hours, the soaked tumors are fished out, put into a mold made of 10x10x5mm open cuboid plastic materials, filled with OCT embedding medium (SAKURA, catalog number: 4583), the mold is put on dry ice for standing for 5 minutes, and the embedding block is taken out and stored at-80 ℃. The embedded blocks were cut into 10 μm tumor sections with a cryomicrotome. Tumor sections were washed 1 time with PBS for 5 min. The cells were incubated in PBS containing 0.25% Triton-100 at 25 ℃ for 10 minutes. Incubate 1 hour at 25 ℃ in PBS containing 1.5% donkey serum. Mouse monoclonal anti-ALDH1a1(BD Pharmingen, cat #: 611195), Rat monoclonal anti-Ki67(eBioscience, cat #: 14-5698-82) and Rabbit polyclonal anti-SETD4(Sigma-Aldrich, Cat No.: HPA024073) and Mouse monoclonal anti-ALDH1a1(BD Pharmingen, cat No.: 611195), Rat monoclonal anti-Ki67(eBioscience, cat #: 14-5698-82) and Rabbit polyclonal anti-DEK (Proteintech, cat #: 16448-1-AP) antibody, Alexa Fluor 488 fluorescently labeled donkey anti-mouse immunoglobulin (Thermo Fisher scientific, cat # A21202) for ALDH1, Alexa Fluor 594 fluorescently labeled goat anti-rat immunoglobulin (Thermo Fisher scientific, cat # A11007) for Ki67, and Alexa Fluor647 fluorescently labeled donkey anti-rabbit immunoglobulin (Thermo Fisher scientific).c, cat # A31573) corresponds to SETD4 and DEK samples and is observed with a fluorescence microscope. As a result, high expression of SETD4 and low expression of DEK were found in tumor cells positive for ALDH1 and negative for Ki67 (fig. 15), indicating low expression of DEK in this resting tumor cell type.

2. Activation of tumor cells

The 4T1-DCCs, EMT6-DCCs and MCF7-DCCs in step 1 were replaced with the 4T1A-DCCs, EMT6A-DCCs and MCF7A-DCCs obtained in example 4, respectively, and the other operations were the same.

In ALDH1 positive and Ki67 positive tumor cells, SETD4 was low expressed and DEK was high expressed (fig. 16), indicating that DEK was highly expressed in this type of activated tumor cells.

Example 7, DEK protein of activated dormant tumor cells is increased remarkably, and SETD4 protein is decreased remarkably

Immunoblot analysis (same as example 2) of dormant tumor cells (obtained in step 1 of example 2) and activated dormant tumor cells (obtained in example 4) using Rabbit polyclonal anti-DEK (Proteintetech, Cat. No.: 16448-1-AP) antibody and Mouse monoclonal anti-SETD4(Santa Cruz, Cat. No.: sc-134221) antibody was performed using the method of step 2 of example 2, and it was found that activated dormant tumor cells express DEK protein at a high amount but SETD4 expression is significantly reduced compared to dormant tumor cells (FIG. 17). Research results show that DEK protein plays an important role in activating dormant tumor cells.

Example 8 preparation of exogenous DEK protein and Domain NLS mutant DEK protein

1. Preparation of baculovirus expressing exogenous DEK protein and domain mutant DEK protein

Primer F3(CCGGAATTCATGGTGAGCA) and primer R3 were used

(CGCTCTAGATCAAGAAATTAG) carrying out PCR amplification on SEQ ID NO.6 and SEQ ID NO.8 to obtain a human hEGFP-DEK sequence and a human hEGFP-DEK containing enzyme cutting sites^ΔNLSAnd (4) sequencing. For the above sequence and pFastBac^TMHT A plasmid was subjected to both digestion with EcoRI and XbaI and ligation.

Similarly, primer F4(AGAATTCATGGTGAGCAAGGGCGA) and primer R4 (GCTCT) were usedAGATCAAGAAATTAGCTCTTTTACAGTTGT) carrying out PCR amplification on the SEQ ID NO.10 and the SEQ ID NO.12 to obtain a mouse hEGFP-DEK sequence and a mouse hEGFP-DEK containing enzyme cutting sites^ΔNLSAnd (4) sequencing. For the above sequence and pFastBac^TMHT A plasmid was subjected to both digestion with EcoRI and XbaI and ligation.

Respectively combining human hEGFP-DEK gene (nucleotide sequence: SEQ ID NO.6, amino acid sequence: SEQ ID NO.7) and human hEGFP-DEK^ΔNLS(nuclear localization sequence NLS deletion) gene (nucleotide sequence: SEQ ID NO.8, amino acid sequence: SEQ ID NO.9), murine mEGFP-DEK gene (nucleotide sequence: SEQ ID NO.10, amino acid sequence: SEQ ID NO.11), murine mEGFP-DEK^ΔNLS(Nuclear localization sequence NLS deletion) Gene (nucleotide sequence: SEQ ID NO.12, amino acid sequence: SEQ ID NO.13) ligated into pFastBac^TMThe enzyme sites for EcoRI and Xba I (FIG. 18) of the HT A plasmid (purchased from Thermo Fisher, cat. No.: 10712024).

pFastBac to which the above-mentioned gene is ligated^TMThe HT A plasmid was transformed into E.coli DH10Bac competent cells (purchased from Gibco, cat # 10361012) in a water bath at 42 ℃ for 45 seconds. To the transformed E.coli, 1mL of LB medium (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, solvent water, pH 7.4) was added, and the mixture was shaken at 37 ℃ and 220rpm for 4 hours. After centrifugation at 1000rpm for 5 minutes, the supernatant was removed and 100. mu.L of LB medium was added for resuspension. mu.L of the resuspension solution was applied to LB solid medium (15 g/L agar was added to LB medium) containing 30. mu.L/mL kanamycin, 15. mu.L/mL gentamicin, 12. mu.L/mL tetracycline, 40. mu.L (20mg/mL) of X-gal (5-bromo-4-chloro-3-indole-. beta. -D-galactopyranoside, solvent dimethylformamide), 4. mu.L (200mg/mL) of IPTG (isopropyl-. beta. -D-thiogalactoside, solvent super-distilled water), and cultured in the dark at 37 ℃ for 48 hours, and the white single colony was inoculated into 2mL of LB medium and shaken at 220rpm at 37 ℃ overnight. The next day, plasmid extraction was performed using a kit (purchased from Invitrogen, cat # K210002) to obtain a recombinant baculovirus plasmid (Bacmid). Recombinant Bacmid was transfected into Sf9 cells (ATCC source, cat # CRL-1711) using Cellfectin transfection reagent (Gibco, cat # 10362100). Cells after transfection were seeded in SCulturing in f-900 culture medium (Gibco, cat # 10902179) at 27 deg.C for 72 hr, collecting cell culture solution, centrifuging at 10000xg for 20min, collecting supernatant as virus solution, and respectively obtaining vector carrying human hDEK-GFP gene, murine mDEK-GFP gene, and human hDEK^△NLSGFP Gene, murine mDEK^△NLSRecombinant baculoviruses of the GFP gene.

2. Expression and purification of exogenous DEK protein and domain mutant DEK protein

Sf9 cells were seeded into 100mL of Sf-900 medium (Gibco, cat # 10902179) at a density of 50 ten thousand/mL, cultured at 27 ℃ for 72 hours, and 10mL of Sf-900 cells were added to the medium to give a titer of 10⁸pfu/mL of the above recombinant baculovirus (carrying human DEK-GFP, murine DEK-GFP or human DEK)^ΔNLSGFP, murine DEK^ΔNLSGFP gene, total 4 gene sequences), incubated at 27 ℃ for 5 days, centrifuged at 1200rpm for 10 minutes, the supernatant removed, and the cell pellet resuspended in lysis buffer (50mM sodium dihydrogen phosphate and 300mM sodium chloride in double distilled water at pH 8.0). The resuspended solution was sonicated (39 watts, 10 seconds sonication, 50 seconds dwell, 3 minutes sonication duration). Centrifuging the solution after ultrasonic treatment at 12000rpm and 4 ℃ for 20 minutes, and taking the supernatant to obtain the protein solution. Purifying the protein solution with His-tagged protein purification kit (Biyunyan, Cat: P2226), dissolving the purified protein in PBS, and preparing into 20 μ g/mL protein solution, i.e. PBS solution of exogenous DEK protein (mDEK-GFP, hDEK-GFP) and PBS solution of NLS mutant DEK protein (hDEK-GFP)^ΔNLS-GFP、mDEK^ΔNLS-GFP). Coomassie blue staining revealed the protein was higher in purity and the protein size was correct (FIG. 19).

Example 9 addition of exogenous DEK protein activates dormant tumor cells

Each of 100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) was inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, and 25. mu.L of PBS, 25. mu.L of PBS solution containing 20. mu.g/mL of exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of PBS solution containing 20. mu.g/mL of NLS mutant DEK protein were added to each cell, so that the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50 ng/mL. Among them, 4T1-DCCs and EMT6-DCCsSeparately adding mDEK-GFP and mDEK^ΔNLSAdding hDEK-GFP and hDEK into the GFP, MCF7-DCCs respectively^ΔNLSGFP, and harvesting the cells after 20 hours of incubation at 37 ℃. Immunoblot analysis was performed on a portion of the cells using antibodies to Rabbit polyclonal anti-DEK (Proteintech, cat # 16448-1-AP), Mouse monoclonal anti-PCNA (abcam, cat # ab29), Rabbit monoclonal anti-H3S10ph (Cell signaling technology, cat # 53348) and Mouse monoclonal anti-SETD4(Santa Cruz, cat # sc-134221) (see Table 1 for secondary antibodies as in example 2) and found to increase the levels of DEK, PCNA and H3S10ph and decrease the level of SETD4 (FIG. 20). Research results show that the exogenous DEK protein can activate dormant tumor cells, the dormant tumor cells are marked as exogenous DEK protein activated dormant tumor cells, and exogenous DEK protein activated 4T1A-DCCs, EMT6A-DCCs and MCF7A-DCCs are obtained respectively.

Example 10 exogenous DEK protein addition in combination with chemotherapy can eliminate dormant tumor cells

1. Effect of DEK protein binding chemotherapy on cCasp3 Signaling of quiescent tumor cells

Each 100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs and MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS was added to each cell, 25. mu.L of PBS solution of 20. mu.g/mL of exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of PBS solution of 20. mu.g/mL of NLS mutant DEK protein were added to each cell, so that the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50ng/mL, respectively, and mDEK-GFP and mDEK-were added to each of the 4T1-DCCs and EMT6-DCCs^ΔNLSAddition of hDEK-GFP and hDEK to GFP, MCF7-DCCs, respectively^ΔNLS-GFP. After culturing at 37 ℃ for 20 hours, the cells were harvested and an immunofluorescence assay was carried out using a cleaved antibody against Rabbit monoclonal anti-cleared Caspase-3(abcam, cat # ab32042) (the procedure is the same as in step 2 of example 2, and the secondary antibody was replaced with Alexa Fluor 594 fluorescently labeled donkey anti-Rabbit, Thermo Fisher, cat # R37119). The samples were observed by fluorescence microscopy and the signal of cCasp3 was found to be abundant, and the cells were found to be abundant in apoptosis (FIG. 21).

2. Effect of DEK protein binding to chemotherapy treatment on dormant tumor cells at different times

Each 100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs and MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS was added to each cell, 25. mu.L of PBS solution of 20. mu.g/mL of exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of PBS solution of 20. mu.g/mL of NLS mutant DEK protein were added to each cell, so that the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50ng/mL, respectively, and mDEK-GFP and mDEK-were added to each of the 4T1-DCCs and EMT6-DCCs^ΔNLSAddition of hDEK-GFP and hDEK to GFP, MCF7-DCCs, respectively^ΔNLS-GFP. After culturing at 37 ℃ for 0 hour, 5 hours, 20 hours, 25 hours, and 30 hours, cell samples were collected, and trypan blue staining was performed to detect dead cells, and it was found that all of the dormant tumor cells originally resistant to chemotherapy were gradually dead (FIG. 22).

The above results indicate that the addition of exogenous DEK protein can eliminate dormant tumor cells in combination with chemotherapy.

Example 11 interference of DEK in activated dormant tumor cells to bring the cells back to rest

1. Preparation of Small hairpin RNA (shRNA) lentiviruses expressing Targeted DEK

(1) Sequence of

Interference sequence targeting human DEK 1: GGATAGTTCAGATGATGAAC, SEQ ID NO.14, noted shDEK # H1;

interference sequence targeting human DEK 2: GTGATGAAGATGAAAAGAAA, SEQ ID NO.15, shDEK # H2;

interference sequence targeting murine DEK 1: GTGAAGAAATTACTGGCTGAT, SEQ ID NO.16, noted shDEK # M1;

interference sequence targeting murine DEK 2: CGAACTCGTGAAGAGGATCTT, SEQ ID NO.17, designated shDEK # M2;

scrambled interference sequence: ATGTTAACAGCTGTACTGGTG, SEQ ID NO.18, noted shCTRL.

(2) Recombinant lentiviral expression vectors

5 segments of target DEK shRNA sequences are respectively inserted into BamHI sites and Mlu I sites of a pLent-U6-RFP-Puro lentivirus expression vector (Virgilla, cat # LT88024, figure 23) to respectively obtain a recombinant lentivirus expression vector containing human DEK1(SEQ ID NO.14), a recombinant lentivirus expression vector containing human DEK2(SEQ ID NO.15), a recombinant lentivirus expression vector containing murine DEK1(SEQ ID NO.16), a recombinant lentivirus expression vector containing murine DEK2(SEQ ID NO.17) and a recombinant lentivirus expression vector containing a disordered sequence (SEQ ID NO. 18).

(3) DEK-targeting shRNA lentivirus

The above recombinant lentiviral expression vector containing human DEK1(SEQ ID NO.14) and a lentiviral packaging plasmid mixture (pMDL, VSVG, pRSV-Rev, in a mass ratio of 5:3:2, purchased from Shanghai assist holy organism, cat # 41102ES10) were co-transfected into 293T cells (ATCC, cat # ACS-4500) specifically: a clean sterile centrifuge tube is taken, 750 mu L of DMEM culture solution without antibiotics and serum is added, 4.5 mu g of lentivirus packaging plasmid mixture and 1.5 mu g of recombinant lentivirus expression vector containing humanized DEK1(SEQ ID NO.14) are respectively added, the mixture is gently blown and beaten by a gun and evenly mixed, 24 mu L of liposome transfection reagent Lipo8000(Beyotime, catalog number: C0533) is added, and the mixture of the transfection reagent and the plasmid is obtained by gently blowing and beaten by the gun and evenly mixed. 750 μ L of a mixture of transfection reagent and plasmid was added dropwise to 293T cells and incubated at 37 ℃ for 72 hours. And collecting cell culture supernatant after 72 hours of transfection to obtain virus solution. 6 SW28 centrifuge tubes were removed and approximately 32ml of virus solution was added to each SW28 centrifuge tube. Taking 610 ml pipettes, respectively sucking 4ml of 20% sucrose aqueous solution by mass, inserting the pipettes all the way to the bottom of each SW28 centrifuge tube, and slowly beating out 4ml of sucrose aqueous solution. The weight of each tube was adjusted with PBS so that the weight difference between the corresponding SW28 tubes did not exceed 0.1 g. All 6 SW28 centrifuge tubes were placed in sequence in a Beckman SW28 ultracentrifuge rotor and centrifuged at 25000rpm for 2 hours at 4 ℃. The SW28 tube was carefully removed from the rotor. The supernatant was decanted and the SW28 centrifuge tubes were inverted on paper towels and left for 10 minutes to allow the remaining supernatant to drain. The remaining droplets were aspirated off. 1ml of calcium and magnesium free PBS was added to each tube to resuspend the pellet at the bottom of the tube. SW28 centrifuge tubes were inserted into 50ml conical bottom centrifuge tubes, covered, and dissolved at 4 ℃ for 2 hours with gentle shaking every 20 minutes. Centrifugation at 500rpm at 4 DEG CFor 1 minute, the solution was concentrated at the bottom of the tube. Resuspend the pellet with a 200 μ l pipette gently to avoid foaming. The liquid in all tubes was collected in a new centrifuge tube, i.e. 6ml of concentrated and purified virus liquid, which was designated as lentivirus shDEK # H1 (i.e. human DEK interference sequence 1). Determination of viral titer was performed using a kit (GeneCopoeia, cat # LT005) and the viral titer was 10⁸pfu/mL。

The recombinant lentiviral expression vector containing the human DEK1(SEQ ID NO.14) is respectively replaced by a recombinant lentiviral expression vector containing the human DEK2(SEQ ID NO.15), a recombinant lentiviral expression vector containing the murine DEK1(SEQ ID NO.16), a recombinant lentiviral expression vector containing the murine DEK2(SEQ ID NO.17) and a recombinant lentiviral expression vector containing a scrambled sequence (SEQ ID NO.18), and other operations are the same. Finally, shRNA lentivirus shDEK # H1 and shDEK # H2 (human DEK interference sequence 2, 6ml, virus titer 10) targeting DEK are respectively obtained⁸pfu/mL), shDEK # M1 (murine DEK interference sequence 2, 6mL, virus titer 10⁸pfu/mL), shDEK # M2 (murine DEK interference sequence 2, 6mL, virus titer 10⁸pfu/mL), shCTRL (interference control 6mL, virus titer 10⁸pfu/mL)。

2. Interference with DEK in activated dormant tumor cells to bring the cells back to rest

(1) Interference with DEK to bring dormant tumor cells back to rest

The 3 activated dormant tumor cells (4T1A-DCCs, EMT6A-DCCs and MCF7A-DCCs) obtained in example 4 were inoculated into a low patch 6-well plate at a density of 10 ten thousand cells/well in a 3mL DMEM/Ham's F-12 medium, and after 2 hours of culture at 37 ℃, polybrene (polybrene) was added to each well at a final concentration of 6. mu.g/mL; 10. mu.L of 10 cells were added to each of the 4T1A-DCCs and EMT6A-DCCs culture wells⁸pfu/mL of shDEK # M1, shDEK # M2, shCTR lentiviruses prepared in step 1, without lentivirus addition as untreated. 10. mu.L of 10 cells were added to each well of MCF7A-DCCs⁸pfu/mL of shDEK # H1, shDEK # H2, shCTRL lentivirus prepared in step 1, while no lentivirus was added as untreated. Culturing at 37 deg.C for 24 hr, replacing with new culture medium, culturing for 72 hr, and collecting cells (marked as dryCells after DEK), immunoblotting experiments were performed with rabbitpolyclonal anti-DEK, rabbitmonoclonal anti-H3S10ph, Mouse monoclonal anti-PCNA and Mouse monoclonal anti-SETD4 antibodies (same procedure as in example 2, step 2, see table 1 for secondary antibodies), and it was found that Ki67, PCNA and H3S10ph decreased and SETD4 increased (a in fig. 24).

(2) Inhibition of the tumorigenicity of dormant tumor cells following interference with DEK

1 million cells after interference of DEK in the above step (1) were inoculated into 3mL of DMEM/Ham's F-12 medium containing 10% serum replacement and cultured at 37 ℃ for one week, and the ability to form tumor spheres was found to be inhibited (b in FIG. 24).

The above results indicate that interference with DEK in activated dormant tumor cells re-enters the cells into a resting state. 3. Addition of exogenous DEK to dormant tumor cells caused by DEK interference can reactivate the dormant tumor cells

(1) 4T1A-DCCs cells after lentivirus shDEK # M1 and shCTRL interference DEK in step 2 were seeded at a density of 4000 cells/well in 5mL of DMEM/Ham's F-12 medium containing 10% serum replacement, respectively. 4T1A-DCCs after interference of the DEK in shDEK # M1 were supplemented with 12.5. mu.L of PBS, 12.5. mu.L of 20. mu.g/mL of a PBS solution of mDEK-GFP prepared in step 2 of example 8, and 12.5. mu.L of 20. mu.g/mL of mDEK prepared in step 2 of example 8^ΔNLSPBS solution of GFP, mDEK-GFP and mDEK^ΔNLSThe final concentration of GFP in the medium was 50 ng/mL; 4T1A-DCCs cells after shCTRL interference with DEK did not add PBS or protein. After culturing at 37 ℃ for 20 hours, cells were collected (as murine interference sequence 1+ mDEK-GFP, murine interference sequence 1+ mDEK)^△NLSGFP, murine interference sequence 1+ PBS, shCTRL), immunoblotting experiments with DEK-GFP, DEK, H3S10ph, PCNA and SETD4 antibodies were performed (same procedure as in example 2, step 2, primary and secondary antibodies see table 1). EMT6A-DCCs (mDEK-GFP and mDEK) cells after interference of DEK on shDEK # M2 and shCTRL in lentivirus step 2 under the same conditions^ΔNLSGFP), shDEK # H2 and MCF7A-DCCs cells after shCTRL interference with DEK (hDEK-GFP and hDEK)^ΔNLSGFP) was performed.

Levels of PCNA and H3S10ph were found to rise back and levels of SETD4 were found to fall back (fig. 25).

(2) 1 million pieces of shDEK interfering cells (i.e., 4T1A-DCCs and EMT6A-DCCs cells of murine interference sequence 1+ mDEK-GFP, MCF7A-DCCs cells of human interference sequence 1+ mDEK-GFP) rejoined with DEK protein in the above step (1) were inoculated into 3mL of DMEM/Ham's F-12 medium containing 10% serum substitute, cultured at 37 ℃ for one week, and the photo-scope photograph of the in vitro balling test and the statistical chart of the balling rate revealed that the ability to form tumor balls was restored (FIG. 26).

The above results indicate that addition of exogenous DEK to dormant tumor cells resulting from DEK interference can reactivate the dormant tumor cells.

Example 12 Regulation mechanism of activation of dormant tumor cells by exogenous DEK protein

1. Exogenous DEK protein causes the decrease of heterochromatin and the increase of euchromatin

(1) 100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs and MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS, 25. mu.L of 20. mu.g/mL PBS solution of the exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of 20. mu.g/mL PBS solution of the NLS mutant DEK protein were added to each of the 3 dormant tumor cells, and the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50ng/mL, respectively, and mDEK-GFP and mDEK-respectively added to each of the 4T1-DCCs and EMT6-DCCs^ΔNLSAddition of hDEK-GFP and hDEK to GFP, MCF7-DCCs, respectively^ΔNLS-GFP. After culturing at 37 ℃ for 20 hours, the cells were collected. The cells were fixed overnight at 4 ℃ by adding them to a 2.5% aqueous solution of glutaraldehyde. The next day, the fixative was decanted and the samples were rinsed three times with PBS for 15 minutes each. The samples were incubated with 1% osmate in water at 25 ℃ for 1-2 h. Osmate waste was removed and the samples were rinsed three times with PBS for 15 minutes each. The samples were incubated with a gradient of ethanol aqueous solutions (30%, 50%, 70%, 80%, 90% and 95%) for 15 minutes each at 25 ℃. The samples were incubated for 20 minutes at 25 ℃ with 100% ethanol. The samples were incubated with pure acetone for 20 minutes at 25 ℃. Spurr embedding medium (polymerized from ethylene oxide cyclohexene, diglycidyl ether of polypropylene glycol, nonyl succinic anhydride, and dimethylethanolamine, available from SPI-CHEM Co.) and a mixture of pure acetone (V/V ═ 1/1) were incubated at 25 deg.CFor 1 hour. The samples were incubated with a mixture of Spurr embedding medium and acetone (V/V-3/1) for 3 hours at 25 ℃. Pure Spurr embedding medium incubated the samples overnight at 25 ℃. The next day, the sample was taken out, placed in an open rectangular parallelepiped plastic embedding mold (SAKURA, cat # 4566) of 10 × 5mm, filled with a new Spurr embedding medium, and placed in an oven at 70 ℃ overnight. The next day, an embedded sample was obtained. The samples were sectioned in a LEICA EM UC7 microtome to obtain 70nm sections. And (3) dropwise adding a lead citrate solution (21.33g of lead nitrate and 1.76g of sodium citrate are added into 30mL of double distilled water, forcibly oscillating for 30 minutes until the solution is milky turbid, adding 8mL of 1mol/L sodium hydroxide aqueous solution to enable the solution to become clear and transparent, adding the double distilled water to reach a constant volume of 50mL), immersing, dyeing for 10 minutes at 25 ℃, and absorbing the redundant dyeing solution by using filter paper. And (3) dropwise adding a 50% ethanol saturated solution of uranyl acetate (2g of uranyl acetate is added into 100mL of 50% ethanol, fully stirring for 10 minutes, standing for 1 day, taking supernatant for use), immersing, dyeing for 10 minutes at 25 ℃, and absorbing redundant dyeing liquid by using filter paper. The stained sections were observed by transmission electron microscopy. It was found that there was no significant change in the nuclear heterochromatin levels after addition of PBS or exogenous NLS mutant DEK proteins to the dormant tumor cells, whereas the nuclear heterochromatin levels were significantly reduced after addition of exogenous DEK proteins to the dormant tumor cells (fig. 27).

(2) 100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs and MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS, 25. mu.L of 20. mu.g/mL PBS solution of the exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of 20. mu.g/mL PBS solution of the NLS mutant DEK protein were added to each of the 3 dormant tumor cells, and the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50ng/mL, respectively, and mDEK-GFP and mDEK-respectively added to each of the 4T1-DCCs and EMT6-DCCs^ΔNLSAddition of hDEK-GFP and hDEK to GFP, MCF7-DCCs, respectively^ΔNLS-GFP. After culturing at 37 ℃ for 20 hours, the cells were collected. The Mouse monoclonal anti-H4K20me1(Santa Cruz, Cat. No.: sc-134221), Rabbit polyclonal anti-H4K20me2(abcam, Cat. No.: Abam) were used: ab9052), Rabbit polyclonal anti-H4K20me3(abcam, cat #: ab9053), Rabbit polyclonal anti-HP1 α (Cell Signaling Technology, catalog No.: 2616) rabbit polyclonal anti-H3K9ac (abcam, cat #: ab10812), Rabbit monoclonal anti-H3K9me3(abcam, cat #: ab176916) and Mouse monoclonal anti-H3K27me3(abcam, cat No.: ab6002) in the above cells (same procedure as in step 2 of example 2, H4K20me1 and H3K27me3 were conjugated to horseradish peroxidase donkey anti-mouse secondary antibody, and H4K20me2, H4K20me3, H3K9ac, HP1 α and H3K9me3 were conjugated to horseradish peroxidase donkey anti-rabbit secondary antibody). It was found that, compared with the dormant tumor cells to which PBS or exogenous NLS mutant DEK protein was added, the levels of the molecular indicators H4K20me3 of constitutive heterochromatin and the heterochromatin-forming key protein HP1- α were significantly decreased, the level of the molecular indicator H3K9ac of euchromatin was significantly increased, and the levels of the molecular indicators H3K9me3 and H3K27me3 of facultative heterochromatin were not significantly changed after the exogenous DEK protein was added to the dormant tumor cells (fig. 28).

2. Gene detection of binding sites of DEK proteins on chromatin

(1) High throughput sequencing of chromatin immunoprecipitation assay (ChIP-seq): the cells of the exogenous DEK protein-activated MCF7A-DCCs of example 9 were collected, and a chromatin immunoprecipitation test (ChIP-Seq) of DEK protein was performed using the Kit EZ ChIP Kit (Millipore, cat # 17-371) and DEK (Proteitech, cat # 16448-1-AP) antibodies. 1mL of 4% paraformaldehyde (in PBS) was added to 1g of cells and incubated at 25 ℃ for 10 minutes. 1mL of 1M glycine (in PBS) was added and incubated at 25 ℃ for 10 minutes. After centrifugation at 1000rpm for 5 minutes, the supernatant was removed, 1.5mL of a lysate (50mM Tris, pH8.1, 1% SDS and 0.1. mu. mol/L protease inhibitor cocktail (Sigma-Aldrich, cat # P8340)) was added to the cell pellet, the pellet was vortexed, and the pelleted pellet was placed on ice for 10 minutes. The suspension was sonicated (39 watts, 10 seconds sonication, 50 second pause, total sonication duration 2 minutes). After centrifugation at 12000rpm for 10 minutes at 4 ℃ and supernatant collection, 60. mu.L of ChIP Blocked Protein G Agarose (Sigma-Aldrich, cat # 16-201D) and 3. mu.g of Rabbit polyclonal anti-DEK antibody were added and incubated overnight at 4 ℃. Centrifuge at 3000rpm for 2 minutes, remove the supernatant, and take the precipitate. TE buffer (10mM Tris-HCI and 1mM EDTA, pH 8.0) was washed 3 times for 5 minutes each. After washing, 200. mu.L of an eluent (10. mu.L of a 20% aqueous SDS solution; 20. mu.L of a 1M aqueous sodium bicarbonate solution and 170. mu.L of double distilled water) was added to the precipitate, and the precipitate was incubated at 25 ℃ for 15 minutes, centrifuged at 3000rpm for 2 minutes, and the supernatant was transferred to a new centrifuge tube. mu.L of 5M aqueous sodium chloride solution was added to the supernatant, and the mixture was incubated in a water bath at 65 ℃ for 5 hours. Add 1. mu.L RNase A and incubate in 37 ℃ water bath for 30 min. Adding 4 μ L of 0.5M EDTA aqueous solution; mu.L of 1M Tris-HCl and 1. mu.L of protease K (Sigma-Aldrich, cat # 20-298) were incubated in a water bath at 45 ℃ for 1 hour. DNA was extracted using a DNA purification kit (Solambio, cat # D1300). The resulting DNA was used to construct a library (including end repair, add A, add adaptor, length screen, PCR amplification) and subjected to high throughput sequencing (this procedure was performed by Beijing Nuo Po Sci technologies, Inc.).

(2) Analysis of sequencing results: peaks of the DEK binding site were distributed on all 23 chromosomes (fig. 29), and peaks of the DEK binding site were mainly concentrated in the promoter region, accounting for 64.35% (of which the intron region accounted for 10.5%, and the intergenic region accounted for 11.81%) (fig. 30). Gene ontology enrichment analysis (GO enrichment analysis) performed on genes corresponding to peaks of DEK binding sites revealed that DEK-bound genes were mainly associated with intracellular signal transduction, ontogeny, and protein binding (fig. 31). Visual analysis of the binding signal of DEK revealed that DEK bound to promoter regions of SETD4, TP53, and MYC genes (fig. 32).

3. Exogenous DEK proteins cause an increase in chromatin opening levels

(1) High throughput sequencing of transposase chromatin region accessible (ATAC-seq): the MCF7-DCCs quiescent tumor cells obtained in step 1 of example 2 and the MCF7A-DCCs cells activated by the exogenous DEK protein obtained in example 9 were collected and subjected to high throughput sequencing (ATAC-Seq) with easy access to the transposase chromatin region. The cell nuclei of the two cell samples are extracted, transposase mix containing transposase and two equimolar linkers Adapter 1 and Adapter 2 is added, and the cells are incubated at 37 ℃ for 30 minutes. And performing primer amplification, fragment length selection and purification on the product, performing machine sequencing after obtaining a library, and completing the operation by the Beijing Nuo Po genesis science and technology GmbH.

(2) Analysis of sequencing results: the overall signal intensity in the dormant tumor cells after activation was significantly higher than that of the dormant tumor cells, indicating that the dormant tumor cells had a large increase in the gene region opened after activation (fig. 33). Genes that were signal up-regulated in activated dormant tumor cells were subjected to gene ontology enrichment analysis (GO enrichment analysis), and found to be mainly associated with biological processes such as intracellular signal transduction, gene expression, cell cycle, metabolic processes, biosynthetic processes, catalytic activity, and kinase activity (fig. 34). The UCSC gene browser visual analysis of ATAC-seq signals of the dormant tumor cells and the dormant tumor cells activated by exogenous DEK protein shows that ATAC signals of SETD4 and TP53 genes in the activated dormant tumor cells are obviously lower than those of the dormant tumor cells, and ATAC signals of MYC genes in the activated dormant tumor cells are obviously higher than those of the dormant tumor cells (figure 35), which shows that the degrees of openness of SETD4 and TP53 genes are reduced and the degrees of openness of MYC genes are increased after the dormant tumor cells are activated by the exogenous DEK protein.

4. Exogenous DEK proteins cause changes in gene expression

(1) High throughput sequencing of transcriptomes (RNA-seq): the MCF7-DCCs quiescent tumor cells obtained in step 1 of example 2 and the MCF7A-DCCs cells activated by the exogenous DEK protein obtained in example 9 were collected and subjected to high-throughput sequencing of transcriptome (RNA-seq). By using

Stranded RNA-Seq Kit (Clontech, cat # 634836), 1mL of TRIzol reagent (Thermo Fisher) was added to 1g of the above-described cells, total RNA was extracted, and mRNA having a polyA tail was enriched by oligo (dT) magnetic beads. Using Illumina

The UltraTM RNA Library Prep Kit is used for construction of transcriptome Library and sequencing on a computer. Aligning the sequence of the sequencing fragment to UCSC human reference genome hg38 by using HISAT2 software, and counting the range from the beginning to the end of each gene according to the position information of the gene alignment on the reference genomeThe number of signals covered in the gene, and the quantitative analysis of the gene expression level. And further carrying out statistical analysis on the data of the gene expression level, and screening the genes with the expression levels being obviously different among different samples.

(2) Analysis of sequencing results: 2119 up-regulated and 3338 down-regulated genes were found in activated quiescent tumor cells (FIG. 36). The obtained differential genes were subjected to gene ontology analysis (GO analysis), and found that in the activated dormant tumor cells, the up-regulated genes were mainly associated with the cell activation process (GO phase conversion to G1 phase, cell proliferation, cell transcription, cell respiration and metabolic process) (fig. 37), and the down-regulated genes were mainly associated with the cell rest (negative regulation of cell cycle, methylation-dependent chromatin silencing, p53 pathway, translation termination, cell death and protein ubiquitination) (fig. 38). Gene set enrichment analysis (GSEA analysis) was performed at the expression level of the genes, and found that in activated quiescent tumor cells, the gene set with up-regulated expression level mainly included DNA replication, G2M checkpoint, mitotic spindle, oxidative phosphorylation, tricarboxylic acid cycle, E2F targeted gene, MYC targeted gene and fatty acid metabolism (fig. 39), and the gene set with down-regulated expression level mainly included hypoxia, inflammatory response, complement, coagulation, epithelial mesenchymal transition, p53 signaling pathway, TNFA signaling pathway, JAK-STAT3 signaling pathway and Kras signaling pathway. There were 25 genes significantly upregulated in the MYC signaling pathway and 30 genes significantly downregulated in the p53 signaling pathway (fig. 40).

5. Addition of exogenous DEK protein caused a downregulation of P53 levels and an upregulation of MYC levels

100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs and MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS, 25. mu.L of 20. mu.g/mL PBS solution of the exogenous DEK protein prepared in step 2 of example 8, and 25. mu.L of 20. mu.g/mL PBS solution of the NLS mutant DEK protein were added to each of the 3 dormant tumor cells, and the final concentrations of the exogenous DEK protein and the NLS mutant DEK protein in the medium were 50ng/mL, respectively, and mDEK-GFP and mDEK-respectively added to each of the 4T1-DCCs and EMT6-DCCs^ΔNLSAddition of hDEK-GFP and hDEK to GFP, MCF7-DCCs, respectively^ΔNLS-GFP. After culturing at 37 ℃ for 20 hours, the cells were collected. Immunoblot analysis was performed on the above cells using antibodies to Mouse monoclonal anti-p53(Santa Cruz, cat # sc-126), Rabbit monoclonal anti-p21(Cell Signaling Technology, cat # 2947), Rabbit polyclonal anti-PUMA (abcam, cat # ab9643) and Mouse monoclonal anti-c-Myc (Santa Cruz, cat # sc-40) (the same procedure as in example 2, step 2, secondary antibody in Table 1). Discovery and addition of DEK to dormant tumor cells and dormant tumor cells^△NLSLevels of p53, p21 and PUMA were significantly decreased and levels of MYC were significantly increased in cells with DEK-GFP protein added to dormant tumor cells for 20 hours compared to 20 hours for GFP protein (figure 41).

Example 13 addition of crude tumor cell culture fluid-derived exosomes in combination with chemotherapy can eliminate dormant tumor cells

1. Detection of cellular cCasp3 Signal by crude exosome in combination with chemotherapy

100 ten thousand of the 3 dormant tumor cells obtained in step 1 of example 2 (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS (as a control) and 25. mu.L of the crude exosome solution prepared in step 2 of example 3 were added to each of the cells to give a final concentration of 50ng/mL in the medium, the cells were collected after culturing at 37 ℃ for 20 hours, and immunofluorescence assay was performed using antibodies to Rabbit monoclonal anti-clear pass-3 (abcam, cat No.: ab32042) (the procedure was the same as in step 2 of example 2, and the secondary antibody was replaced with Alexa Fluor 594 fluorescently-labeled donkey anti-Rabbit, Thermo her, cat No.: R37119). The samples were observed by fluorescence microscopy and the signal of cCasp3 was found to be abundant, and the cells were found to be abundant in apoptosis (FIG. 42).

2. Effect of crude exosome in combination with chemotherapy treatment time on viability of dormant tumor cells

Each 100 ten thousand of the 3 kinds of dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 of example 2 were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS (as a control) and 25. mu.L of the crude exosome solution of 20. mu.g/mL prepared in step 2 of example 3 were added to each cell to give a final concentration of 50ng/mL in the medium, and cell samples were collected after culturing at 37 ℃ for 0 hour, 5 hours, 20 hours, 25 hours, and 30 hours, and dead cells were detected by Trypan blue staining, and it was found that all the dormant tumor cells originally resistant to chemoradiotherapy gradually died (FIG. 43).

The results show that the addition of crude exosomes from tumor cell culture fluid can eliminate dormant tumor cells in combination with chemotherapy.

Example 14 mechanism of controlling the activation of dormant tumor cells by crude exosomes from tumor cell culture fluid

1. Addition of crude exosomes causes down-regulation of heterochromatin levels and up-regulation of euchromatin levels

Each of 100 ten thousand of the 3 dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 of example 2 was inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS (as a control) and 25. mu.L of the PBS solution of 20. mu.g/mL crude exosomes prepared in step 2 of example 3 were added to the medium to give a final concentration of 50ng/mL, and the cells were collected after culturing at 37 ℃ for 20 hours. An immunoassay was carried out using antibodies of Mouse monoclonal anti-H4K20me1(Santa Cruz, catalog number: sc-134221), Rabbit polyclonal anti-H4K20me2 (catalog number: ab9052), Rabbit polyclonal anti-H4K20me3(ABCam, catalog number: ab9053), Rabbit polyclonal anti-HP1 alpha (Cell Signaling Technology, catalog number: 2616), Rabbit polyclonal anti-H3K9ac (ABCam, catalog number: ab10812), Rabbit monoclonal anti-H3K9me3(ABCam, catalog number: ab 916), and Mouse monoclonal anti-H3K27me3(abcam, catalog number: ab6002) in the same manner as the above-described Cell blot (see Table 1, example 2). It was found that, compared to the addition of PBS to the dormant tumor cells, the levels of the molecular index H4K20me3 for constitutive heterochromatin and the key protein HP1- α for heterochromatin formation were significantly decreased, the level of the molecular index H3K9ac for euchromatin was significantly increased, and the levels of the molecular indexes H3K9me3 and H3K27me3 for facultative heterochromatin were not significantly changed after the addition of the coarse exosomes to the dormant tumor cells (fig. 44).

2. Addition of the coarse exosomes caused a down-regulation of the P53 signal pathway and an up-regulation of the MYC signal pathway

Each of 100 ten thousand of the 3 dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 of example 2 was inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, 25. mu.L of PBS (as a control) and 25. mu.L of the crude exosome PBS solution 20. mu.g/mL prepared in step 2 of example 3 were added to the medium to give a final concentration of 50ng/mL, and the cells were collected after culturing at 37 ℃ for 20 hours. Immunoblot analysis was performed on the above cells using antibodies to Mouse monoclonal anti-p53(Santa Cruz, cat # sc-126), Rabbit monoclonal anti-p21(Cell Signaling Technology, cat # 2947), Rabbit polyclonal anti-PUMA (abcam, cat # ab9643) and Mouse monoclonal anti-c-Myc (Santa Cruz, cat # sc-40) (the same procedure as in example 2, step 2, secondary antibody in Table 1). It was found that the levels of p53, p21 and PUMA decreased significantly and the level of MYC increased significantly after addition of crude exosomes to dormant tumor cells compared to PBS to dormant tumor cells (figure 45).

Example 15 preparation of sorting exosomes containing exogenous DEK protein and Domain NLS mutant DEK protein

1. Plasmid for constructing overexpression exogenous DEK protein and domain NLS mutant DEK protein

PCR amplification is carried out on SEQ ID NO.5 and SEQ ID NO.19 by using a primer F1(CCGGAATTCTATGTCCGCCT) and a primer R1(CGCTCTAGATCAAGAAATTAG) to obtain a human DEK gene sequence covering the enzyme cutting site. The above sequence and pEGFP-C1 plasmid were subjected to the double digestion with EcoRI and XbaI and ligation.

Similarly, PCR amplification of SEQ ID NO.21 and SEQ ID NO.23 was performed using primer F2(AGAATTCTATGTCGGCGGCGGCGG) and primer R2(GCTCTAGATCAAGAAATTAGCTCTTTTACAGTTGT) to obtain the murine DEK gene sequence encompassing the cleavage site. The above sequence and pEGFP-C1 plasmid were subjected to the double digestion with EcoRI and XbaI and ligation.

Human hDEK gene (nucleotide sequence: SEQ ID NO.5, amino acid sequence: SEQ ID NO.1) and human hDEK^△NLS(deletion of nuclear localization sequence NLS) (nucleotide sequence: SEQ ID NO.19, amino acid sequence:SEQ ID No.20), murine mDEK gene (nucleotide sequence: SEQ ID NO.21, amino acid sequence: SEQ ID NO.22), murine mDEK^△NLS(nuclear localization sequence NLS deletion) Gene (nucleotide sequence: SEQ ID NO.23, amino acid sequence: SEQ ID NO.24) was inserted into EcoRI and Xba I sites of pEGFP-C1 plasmid (Youbao, cat # VT1118) (FIG. 46), respectively. Obtaining recombinant plasmids pEGFP-C1-hDEK, pEGFP-C1-mDEK and pEGFP-C1-hDEK respectively^△NLSAnd pEGFP-C1-mDEK^△NLSNamely, the plasmid is used for over-expressing exogenous DEK protein and domain NLS mutant DEK protein.

2. Construction of lentivirus over-expressing exogenous DEK protein and domain NLS mutant DEK protein

PCR amplification is carried out on SEQ ID NO.5 and SEQ ID NO.19 by using a primer F1(CCGGAATTCTATGTCCGCCT) and a primer R1(CGCTCTAGATCAAGAAATTAG) to obtain a human DEK gene sequence covering the enzyme cutting site. Then, the above sequence and pLent-N-GFP plasmid were subjected to the double digestion treatment with EcoRI and XbaI and ligation treatment at the same time.

Similarly, PCR amplification of SEQ ID NO.21 and SEQ ID NO.23 was performed using primer F2(AGAATTCTATGTCGGCGGCGGCGG) and primer R2(GCTCTAGATCAAGAAATTAGCTCTTTTACAGTTGT) to obtain the murine DEK gene sequence encompassing the cleavage site. Then, the above sequence and pLent-N-GFP plasmid were subjected to the double digestion treatment with EcoRI and XbaI and ligation treatment at the same time.

The hDEK gene and hDEK in the step 1^△NLSGene, mDEK gene, mDEK^△NLSThe genes were inserted into the EcoRI and XbaI sites of a lentiviral expression vector for pLent-N-GFP (Vibrio, cat # LT88008) (FIG. 47), respectively. Respectively obtaining recombinant lentivirus expression vectors pLent-N-GFP-hDEK, pLent-N-GFP-mDEK and pLent-N-GFP-hDEK^△NLSAnd pLent-N-GFP-mDEK^△NLS. By adopting the method of example 11, 293T cells are transfected by the recombinant lentivirus expression vector and a lentivirus packaging plasmid mixture (pMDL, VSVG, pRSV-Rev, the mass ratio is 5:3:2) together, cell culture supernatant is collected as virus liquid after 72 hours of transfection, the virus liquid is concentrated and purified, and then the measurement of virus titer is carried out, thus obtaining lentiviruses which over-express exogenous DEK protein and structural domain NLS mutant DEK protein, namely lentiviruses hDEK and mDEK,hDEK^△NLSand mDEK^△NLS。

3. Obtaining and identifying sorted exosomes

(1) Preparation of sorting exosomes

1) Overexpression plasmid transfection method:

[ solution ] cells of 4T1-DCCs, EMT6-DCCs, and MCF7-DCCs obtained in example 2 were inoculated into approximately 300 million cells per 10cm cell culture dish, 10mL of DMEM containing 10% serum and 1% antibiotic was added, and the mixture was cultured overnight at 37 ℃. The next day, the original medium was removed and new DMEM medium containing 10% serum and 1% antibiotics was added.

② taking a clean sterile centrifuge tube, adding 750 mu L DMEM culture solution without antibiotics and serum, respectively adding 15 mu g recombinant plasmids (pEGFP-C1-hDEK, pEGFP-C1-mDEK, pEGFP-C1-hDEK) prepared in the step 1^△NLSOr pEGFP-C1-mDEK^△NLS) And gently flicked with a gun and mixed well, and then 24 μ l of lipofectin Lipo8000(Beyotime, catalog No.: c0533) The mixture of transfection reagent and plasmid was obtained by gently blowing and mixing with a gun.

③ 750 mu L of mixture of the transfection reagent and the plasmid is evenly dripped into the cell culture dish (4T1-DCCs and EMT6-DCCs cells are respectively added with pEGFP-C1-mDEK and pEGFP-C1-mDEK)^△NLS(ii) a MCF7-DCCs cells were spiked with pEGFP-C1-hDEK and pEGFP-C1-hDEK^△NLS) And cultured at 37 ℃ for 72 hours. The cell culture solution was collected, and exosomes were isolated from the cell culture solution using an exosome extraction reagent (Invitrogen, catalog No. 4478359) (same method as in step 2 of example 3). Sorting the exosomes by a flow sorter (Beckman moclo Astrios EQ) to obtain sorting exosomes containing exogenous DEK proteins and sorting exosomes containing domain NLS mutant DEK proteins, which are from different tumor cells and have GFP positivity and the particle size range of 50-150nm, wherein the sorting exosomes are MCF7 exosomes containing hDEK-GFP proteins and MCF7 exosomes containing hDEK-GFP proteins^△NLSExosomes of GFP protein, exosomes of 4T1 containing mDEK-GFP protein, exosomes of 4T1 containing mDEK^△NLSExosomes of GFP protein, exosomes of EMT6 containing mDEK-GFP protein, EMT 6-containing mDEK^△NLSExosomes of GFP protein.

2) Overexpression lentivirus transfection method: the cells of 4T1-DCCs, EMT6-DCCs and MCF7-DCCs obtained in example 2 were inoculated into approximately 300 ten thousand cells per 10cm cell culture dish, respectively, and 10mL of DMEM medium containing 10% serum and 1% antibiotic was added and cultured overnight at 37 ℃. The following day, a final concentration of polybrene (polybrene) of 6. mu.g/mL and 10. mu.L of 10 prepared in step 2 were added to each well⁸pfu/mL lentivirus (4T1-DCCs, EMT6-DCCs cells added mDEK and mDEK, respectively^△NLS(ii) a MCF7-DCCs cells addition of hDEK and hDEK^△NLS). After culturing at 37 ℃ for 24 hours, the medium was replaced with a new one, culturing was continued for 72 hours, and the cell culture broth was collected and the exosomes were isolated from the cell culture broth using an exosome-extracting reagent (Invitrogen, catalog No. 4478359) (same method as in step 2 of example 3). Sorting the exosomes by a flow sorter (Beckman moclo Astrios EQ) to obtain sorting exosomes containing exogenous DEK proteins and sorting exosomes containing domain NLS mutant DEK proteins with different sources with GFP positivity and particle size range of 50-150nm, wherein the sorting exosomes are respectively a sorting exosome containing hDEK-GFP protein in MCF7 and a sorting exosome containing hDEK in MCF7^△NLSSorting exosomes of GFP proteins, 4T1 sorting exosome solution containing mDEK-GFP proteins, 4T1 containing mDEK^△NLSSorting exosomes of GFP proteins, sorting exosomes of EMT6 containing mDEK-GFP proteins, EMT 6-containing mDEK^△NLSSorting exosomes for GFP proteins.

The total amount of protein in the sorted exosomes was measured using a BCA protein quantitative assay kit (brand: Biotechnology, cat # C503021), and the sorted exosomes were dissolved in PBS at a concentration of 200. mu.g/mL to prepare a sorted exosome PBS solution for subsequent use.

(2) Identification of sorting exosomes: when the 200. mu.g/mL PBS solution of the sorting exosomes obtained in the transfection method of the overexpression lentiviruses of the step (1) was detected by using a Particle size detection instrument (model: ZetaView, manufacturer: Particle Metrix), the Particle size ranges of the sorting exosomes were all 30-150nm, and the Particle sizes of the main bodies were all around 70nm (FIG. 48). The 200 μ g/mL sorted exosome PBS solution obtained in step (1) was subjected to transmission electron microscope detection (the method is the same as in step 3 of example 3), and a saucer-like vesicle with a double-layer membrane structure was observed, which conforms to the morphological characteristics of exosomes (fig. 49). Immunoblot analysis of DEK, CD9, CD81 and CD63 (method same as example 2, step 2, primary antibody and secondary antibody see Table 1) was carried out on 200. mu.g/mL of the sorted exosome solution obtained in step (1) using antibodies to Rabbit polyclonal anti-DEK (Proteintetech, catalog No.: 16448-1-AP), Rabbit monoclonal anti-CD9(Abcam, catalog No.: ab92726), Rabbit monoclonal anti-CD81(Abcam, catalog No.: ab109201) and Mouse monoclonal anti-CD63(Abcam, catalog No.: ab59479), and it was found that the sorted exosomes express high levels of CD9, CD81 and CD63 proteins

(FIG. 50). The results above demonstrate the size, morphology and molecular characteristics of the sorted exosomes one by one.

Example 16 addition of sorting exosomes containing exogenous DEK proteins activates dormant tumor cells

Each 100 ten thousand of the 3 dormant tumor cells (4T1-DCCs, EMT6-DCCs, MCF7-DCCs) obtained in step 1 of example 2 were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, paclitaxel at a final concentration of 100nM and 5-fluorouracil at a final concentration of 1mM, respectively. 4T1-DCCs cells were supplemented with 2.5. mu.L of LPBS, 2.5. mu.L of 200. mu.g/mL of a 4T1 mDEK-GFP protein-containing sorting exosome PBS solution prepared by the lentivirus overexpression transfection method in step 3 of example 15, and 2.5. mu.L of 200. mu.g/mL of 4T1 mDEK-containing sorting exosomes PBS solution prepared by the lentivirus overexpression transfection method in step 3 of example 15^△NLSSorting exosomes of GFP protein PBS solution, 4T1 containing sorting exosomes of mDEK-GFP protein and 4T1 containing mDEK^△NLSSorting exosomes of GFP protein were all at 50ng/mL in the culture medium. Under the same conditions, the EMT6-DCCs were supplemented with PBS, EMT6 PBS solution of sorted exosomes containing mDEK-GFP protein, EMT 6-mDEK-containing PBS solution^△NLS-sorting exosomes PBS solution of GFP protein; MCF7-DCCs cell addition PBS, MCF7 sorting exosome PBS solution containing hDEK-GFP protein, MCF7 containing hDEK^△NLSSorting exosomes PBS solution of GFP proteins. After culturing at 37 ℃ for 20 hours, the cells were harvested, immunoblot analysis was performed using antibodies to Rabbit polyclonal anti-DEK, Rabbit monoclonal anti-H3S10ph, Mouse monoclonal anti-PCNA and Mouse monoclonal anti-SETD4 (the same method as in step 2 of example 2, see Table 1 for secondary antibodies), and the levels of DEK, PCNA and H3S10ph were found to be increased,the level of SETD4 decreased (fig. 51). Research results show that the addition of sorting exosomes containing exogenous DEK proteins can activate dormant tumor cells.

Example 17 addition of sorting exosomes containing exogenous DEK proteins in conjunction with chemotherapy can eliminate dormant tumor cells

1. Effect of sorting exosomes in combination with chemotherapy on CCasp3 signalling in quiescent tumor cells

The cells were harvested after culturing at 37 ℃ for 20 hours as in example 16, and immunofluorescence assay was performed using a cleaved cysteine protease (cCasp3, abcam, cat # ab32042) antibody (the procedure is as in step 2 of example 2, and the secondary antibody was replaced with Alexa Fluor 594 fluorescently labeled donkey anti-rabbit, Thermo Fisher, cat # R37119). The samples were observed by fluorescence microscopy and the signal of cCasp3 was found to be abundant, and the cells were found to be abundant in apoptosis (FIG. 52).

2. Effect of sorting exosomes in combination with chemotherapy treatment time on dormant tumor cells

In the same manner as in example 16, after culturing at 37 ℃ for 20 hours, samples of cells were collected after culturing at 37 ℃ for 0 hour, 5 hours, 20 hours, 25 hours, and 30 hours, and the dead cells were detected by trypan blue staining, and it was found that all of the dormant tumor cells originally resistant to chemotherapy were gradually dead (FIG. 53).

The above results indicate that the addition of sorting exosomes containing exogenous DEK proteins can eliminate dormant tumor cells in conjunction with chemotherapy.

Example 18 regulatory mechanisms for activation of quiescent tumor cells by sorting exosomes containing exogenous DEK proteins

1. Addition of sorting exosomes causes down-regulation of heterochromatin levels and up-regulation of euchromatin levels

The cells were collected after culturing at 37 ℃ for 20 hours as in example 16. Immunoblot analysis was performed on the above cells using antibodies to H4K20me1, H4K20me2, H4K20me3, HP1- α, H3K9ac, H3K9me3, and H3K27me3 (same procedure as in example 2, step 2, primary antibody, secondary antibody see Table 1). It was found that, compared with the addition of PBS and sorting exosomes containing exogenous domain mutant DEK proteins to dormant tumor cells, the levels of the molecular index H4K20me3 of constitutive heterochromatin and the key protein HP1- α of heterochromatin formation were significantly decreased, the level of the molecular index H3K9ac of euchromatin was significantly increased, and the levels of the molecular indexes H3K9me3 and H3K27me3 of facultative heterochromatin were not significantly changed after the addition of sorting exosomes containing exogenous DEK proteins to dormant tumor cells (fig. 54).

2. Addition of sorting exosomes caused down-regulation of the P53 signal pathway and up-regulation of the MYC signal pathway

The cells were collected after culturing at 37 ℃ for 20 hours as in example 16. Immunoblot analysis was performed on the above cells using antibodies to Mouse monoclonal anti-p53(Santa Cruz, cat # sc-126), Rabbit monoclonal anti-p21(Cell Signaling Technology, cat # 2947), Rabbit polyclonal anti-PUMA (abcam, cat # ab9643) and Mouse monoclonal anti-c-Myc (Santa Cruz, cat # sc-40) (the same procedure as in example 2, step 2, secondary antibody in Table 1). It was found that the levels of p53, p21, and PUMA were significantly decreased and the level of MYC was significantly increased after addition of sorting exosomes comprising exogenous DEK proteins to dormant tumor cells compared to addition of PBS and sorting exosomes comprising exogenous domain mutant DEK proteins to dormant tumor cells (fig. 55).

Example 19 detection of injected sorting exosomes containing exogenous DEK proteins in blood and tumor tissues of tumor-bearing mice

1. The sorted exosome is retained in blood after being injected into a tumor-bearing mouse body in an abdominal cavity

Respectively inoculating 100 ten thousand of 4T1 and 100 ten thousand of EMT6 cells into a fat pad of a female BALB/c mouse at 8 weeks in situ, inoculating 100 ten thousand of MCF7 cells into a fat pad of a female Nod/Scid mouse at 8 weeks in situ until the tumor volume reaches 500mm³On the left and right, the mice were divided into 4T1, EMT6 and MCF7 groups, each of which was 9 mice. The 4T1 group of 6 tumor-bearing mice was injected intraperitoneally with a total protein amount of 20. mu.g per 20g of mouse body weight with 200. mu.g/mL of 4T1 sorted exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15, and 3 tumor-bearing mice were not injected intraperitoneally with the substance as an untreated control. The abdominal cavity of 6 tumor-bearing mice in EMT6 group was injected with 20. mu.g of total protein per 20g of mouse body weight as per step 3 of example 15EMT6 containing mDEK-GFP protein in sorted exosome PBS solution at 200. mu.g/mL prepared by expression lentivirus transfection method, 3 tumor-bearing mice were not injected with substance in the abdominal cavity as untreated control. The peritoneal cavity of 6 tumor-bearing mice in MCF7 group was injected with 20. mu.g total protein per 20g mouse body weight with 200. mu.g/mL sorted exosome PBS solution containing mDEK-GFP protein of MCF7 prepared by the overexpression lentivirus transfection method in step 3 of example 15, and 3 tumor-bearing mice were not injected with material in the peritoneal cavity as untreated controls. Mice were euthanized 24 hours after injection and 7 days after injection, respectively, plasma of the mice was collected, exosomes in the plasma were separated using an exosome extraction kit (Invitrogen, cat # 4484450), 10 μ L of 9 μm sulfuric acid latex beads (dissolved in super-distilled water) at a mass concentration of 4% was added to 100 μ L of exosomes, and the mixture was incubated at 25 ℃ for 10 minutes. Centrifuge at 1000rpm for 5 minutes at 25 ℃, remove the supernatant, and resuspend with 100. mu.L PBS. Place the resuspended fluid into a flow Analyzer to detect GFP⁺The ratio of beads of (a). Injected sorting exosomes containing exogenous DEK proteins were found to be detected in the blood of tumor-bearing mice (fig. 56), indicating that sorting exosomes can be retained in the blood following intraperitoneal injection into tumor-bearing mice.

2. The sorted exosome enters tumor tissue after being injected into the tumor-bearing mouse body in the abdominal cavity

Respectively inoculating 100 ten thousand of 4T1 and 100 ten thousand of EMT6 cells into a fat pad of a female BALB/c mouse at 8 weeks in situ, inoculating 100 ten thousand of MCF7 cells into a fat pad of a female Nod/Scid mouse at 8 weeks in situ until the tumor volume reaches 500mm³On the left and right, the mice were divided into 4T1, EMT6 and MCF7 groups, each group consisting of 6 mice. 4T1 group 3 mice were injected intraperitoneally with a total protein amount of 20. mu.g per 20g of mouse body weight with 200. mu.g/mL of 4T1 sorted exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15, and 3 mice were injected with a total protein amount of 20. mu.g per 20g of mouse body weight with 200. mu.g/mL of 4T1 containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15^△NLSSorting exosomes PBS solution of GFP proteins. EMT6 group 3 tumor-bearing mice were intraperitoneally injected with a total protein amount of 20. mu.g per 20g mouse body weight with 200. mu.g/mL EMT6 fraction containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15With the exosome PBS solution selected, 3 mice were injected with a total protein amount of 20. mu.g per 20g of mouse body weight with 200. mu.g/mL EMT6 containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15^△NLSSorting exosomes PBS solution of GFP proteins. MCF7 group 3 tumor-bearing mice were injected intraperitoneally with a total protein amount of 20. mu.g per 20g of mouse body weight with a 200. mu.g/mL MCF7 sorted exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15, and 3 mice were injected with a total protein amount of 20. mu.g per 20g of mouse body weight with a 200. mu.g/mL MCF7 containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15^△NLSSorting exosomes PBS solution of GFP proteins.

After 24 hours of injection, the mice were euthanized, tumors of 4T1, EMT6 and MCF7 were surgically removed, the tumors were placed in 4% paraformaldehyde at 4 ℃ overnight, immersed in a sucrose aqueous solution of 30% mass concentration for dehydration for 48 hours, the immersed tumors were fished out, placed in a 10X5mm mold made of open rectangular parallelepiped plastic material, filled with OCT embedding medium (SAKURA, Cat. No.: 4583), the mold was placed on dry ice and left to stand for 5 minutes, and the embedded blocks were removed and stored at-80 ℃. The embedded blocks were cut into 10 μm tumor sections with a cryomicrotome. Immunofluorescence experiments were carried out with Rabbit polyclonal anti-SETD4(Sigma-Aldrich, cat. No.: HPA024073) antibody on tumor sections (procedure as in example 2). A large amount of GFP signal was found in tumor tissues (fig. 57), indicating that sorted exosomes containing the foreign protein DEK or domain mutated DEK protein entered tumor tissues after injection into tumor-bearing mice.

Example 20 injection of sorted exosomes containing exogenous DEK protein activates dormant tumor cells in tumor-bearing mice

Respectively inoculating 100 ten thousand of 4T1 and 100 ten thousand of EMT6 cells into a fat pad of a female BALB/c mouse at 8 weeks in situ, inoculating 100 ten thousand of MCF7 cells into a fat pad of a female Nod/Scid mouse at 8 weeks in situ until the tumor volume reaches 500mm³On the left and right, the mice were divided into 4T1 group, EMT6 group and MCF7 group, and each group had 6 mice. 4T1 group 3 tumor-bearing mice were injected with no substance in the abdominal cavity as an untreated control, and 3 tumor-bearing mice were injected with 20g total protein in 20 μ g abdominal cavity200 μ g/mL4T1 sorting exosome PBS solution containing mDEK-GFP protein, prepared by the overexpression lentivirus transfection method in step 3 of example 15, was injected. The abdominal cavity of 3 tumor-bearing mice in EMT6 group was not injected with material as an untreated control, and the abdominal cavity of 3 tumor-bearing mice was injected with 200. mu.g/mL of the sorted exosome PBS solution containing mDEK-GFP protein of EMT6 prepared by the overexpression lentivirus transfection method in step 3 of example 15 in an amount of 20. mu.g total protein by 20g mouse weight. MCF7 group 3 tumor-bearing mice were injected intraperitoneally with no substance as an untreated control, and 3 tumor-bearing mice were injected intraperitoneally with 200. mu.g/mL MCF7 sorted exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15 in an amount of 20. mu.g total protein per mouse body weight. After 24 hours of injection, the mice were euthanized, tumors of 4T1, EMT6 and MCF7 were surgically removed, the tumors were placed in 4% paraformaldehyde at 4 ℃ overnight, immersed in a sucrose aqueous solution of 30% mass concentration for dehydration for 48 hours, the immersed tumors were fished out, placed in a 10X5mm mold made of open rectangular parallelepiped plastic material, filled with OCT embedding medium (SAKURA, Cat. No.: 4583), the mold was placed on dry ice and left to stand for 5 minutes, and the embedded blocks were removed and stored at-80 ℃. The embedded blocks were cut into 10 μm tumor sections with a cryomicrotome. Immunofluorescence experiments were carried out with Rabbit polyclonal anti-SETD4(Sigma-Aldrich, cat. No.: HPA024073) antibody on tumor sections (procedure as in example 2). It was found that the ratio of SETD4 cells to total cells was significantly reduced after intraperitoneal injection of sorted exosomes containing exogenous DEK protein compared to the untreated group (fig. 58), indicating that injection of sorted exosomes containing exogenous DEK protein was able to 100% activate quiescent tumor cells in tumor-bearing mice.

Example 21 injection of sorted exosomes containing exogenous DEK protein in conjunction with chemoradiotherapy can eliminate dormant tumor cells in tumor-bearing mice

1. Effect of exosome in combination with radiotherapy on dormant tumor cells

100 ten thousand 4T1 cells were inoculated into the axillary mammary fat pad of a female BALB/c mouse at 6-8 weeks and divided into a radiotherapy + PBS group, a radiotherapy +4T1 sorting exosome group containing mDEK-GFP protein, a radiotherapy +4T1 sorting exosome group containing mDEK^△NLSSorting exosome groups of GFP proteins, 3 per group. On day 6 after inoculation andon the 9 th day, PBS is injected into the abdominal cavity of each tumor-bearing mouse in the radiotherapy and PBS group, and the injection amount of the PBS is 100 mu L; radiotherapy +4T1 sorting exosome group containing mDEK-GFP protein A200. mu.g/mL 4T1 sorting exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g of total protein per 20g of mouse body weight; radiotherapy +4T1 mDEK containing^△NLSSorting exosomes of GFP proteins 200. mu.g/mL of 4T1 containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g total protein per 20g mouse body weight^△NLSSorting exosomes PBS solution of GFP proteins. 20Gy X-ray irradiation was performed for 3 minutes and 45 seconds within the axilla range on the 7 th, 10 th and 13 th days after the inoculation, respectively. On day 21 after inoculation, the experimental mice were euthanized, the tumor was surgically removed, the tumor was placed in 4% paraformaldehyde overnight at 4 ℃, soaked in a sucrose aqueous solution with a mass concentration of 30% for dehydration for 48 hours, the soaked tumor was fished out, placed in a 10x10x5mm open rectangular parallelepiped plastic mold, filled with OCT embedding medium (SAKURA, catalog No.: 4583), the mold was placed on dry ice for 5 minutes, and the embedded blocks were removed and stored at-80 ℃. The embedded blocks were cut into 10 μm tumor sections with a cryomicrotome. Immunofluorescence analysis of Rabbit polyclonal anti-SETD4(Sigma-Aldrich, Cat: HPA024073) antibody was performed in tumor sections (same procedure as in example 2) and was found to contain mDEK compared to radiotherapy + PBS and radiotherapy +4T1^△NLSThe exosome group of GFP proteins, radiotherapy +4T1 exosome group containing mDEK-GFP proteins, only the presence of very few SETD4 positive cells was found (fig. 59). The result shows that the sorting exosome containing the exogenous DEK protein can eliminate dormant tumor cells in 4T1 tumor-bearing mice by 100 percent by injection in combination with radiotherapy.

2. Effect of exosome in combination with chemoradiotherapy on dormant tumor cells

Inoculating 20 ten thousand EMT6 cells into axillary mammary fat pad of BALB/c female mouse at 6-8 weeks, and dividing into radiotherapy and chemotherapy + PBS group, radiotherapy and chemotherapy + EMT6 sorting exosome group containing mDEK-GFP protein, radiotherapy and chemotherapy + EMT 6-containing mDEK^△NLSSorting exosome groups of GFP proteins, 3 per group. On

days

6, 9 and 12 after inoculation, each of the chemoradiotherapy + PBS groupsInjecting PBS into the abdominal cavity of the tumor-bearing mouse, wherein the injection amount of the PBS is 100 mu L; chemoradiotherapy + EMT6 sorting exosomes group containing mDEK-GFP protein the 200. mu.g/mL of sorting exosomes PBS solution containing mDEK-GFP protein of EMT6 prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g of total protein per 20g of mouse body weight; radiotherapy and chemotherapy + EMT 6-containing mDEK^△NLSSorting exosomes of GFP proteins 200. mu.g/mL EMT 6-containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g total protein per 20g mouse body weight^△NLSSorting exosomes PBS solution of GFP proteins. 20Gy X-ray irradiation was performed for 3 minutes and 45 seconds in the axilla range on the 7 th, 10 th and 13 th days after the inoculation, and paclitaxel was intraperitoneally injected at 1 dose of 3mg/kg mouse body weight on the 6 th, 12 th and 18 th days after the inoculation. On day 21 after inoculation, the experimental mice were euthanized, the tumor was surgically removed, the tumor was placed in 4% paraformaldehyde overnight at 4 ℃, soaked in a sucrose aqueous solution with a mass concentration of 30% for dehydration for 48 hours, the soaked tumor was fished out, placed in a 10x10x5mm open rectangular parallelepiped plastic mold, filled with OCT embedding medium (SAKURA, catalog No.: 4583), the mold was placed on dry ice for 5 minutes, and the embedded blocks were removed and stored at-80 ℃. The embedded blocks were cut into 10 μm tumor sections with a cryomicrotome. Immunofluorescence analysis of SETD4 antibody (Sigma-Aldrich, Cat: HPA024073) was performed on tumor sections (method as in example 2) and was found to be comparable to the chemoradiotherapy + PBS group and chemoradiotherapy + EMT 6-containing mDEK^△NLSThe exosome group of GFP proteins, chemoradiotherapy + EMT6 exosome group containing mDEK-GFP proteins, was found to have only a very small number of SETD4 positive cells (fig. 60). The result shows that the sorting exosome containing the exogenous DEK protein can eliminate the dormant tumor cells in the EMT6 tumor-bearing mice by 100 percent in combination with radiotherapy and chemotherapy.

Example 22 injection of sorting exosomes containing exogenous DEK protein in combination with radiotherapy and chemotherapy can cure breast cancer 1, and radiotherapy in combination with sorting exosomes cure 4T1 transplanted tumor mice

100 ten thousand 4T1 cells were inoculated into the axillary mammary fat pad of a female BALB/c mouse at 6-8 weeks, and divided into an untreated group, a radiotherapy + PBS group, a radiotherapy +4T1 group containing mDEKSorting exosome group of GFP proteins, radiotherapy +4T1 containing mDEK^△NLSSorting exosome groups of GFP proteins, 11 per group. On

days

6 and 9 post inoculation, untreated groups were not injected with material; in the radiotherapy and PBS group, PBS is injected into the abdominal cavity of each tumor-bearing mouse, and the injection amount of the PBS is 100 mu L; radiotherapy +4T1 sorting exosome group containing mDEK-GFP protein A200. mu.g/mL 4T1 sorting exosome PBS solution containing mDEK-GFP protein prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g of total protein per 20g of mouse body weight; radiotherapy +4T1 mDEK containing^△NLSSorting exosomes of GFP proteins 200. mu.g/mL of 4T1 containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g total protein per 20g mouse body weight^△NLSSorting exosomes PBS solution of GFP proteins. 20Gy X-ray irradiation was performed for 3 minutes and 45 seconds within the axilla range on the 7 th, 10 th and 13 th days after the inoculation, respectively. Measuring the length and width of the tumor weekly after cell inoculation, calculating the tumor volume by using a formula (length multiplied by width/2), drawing a growth curve of the tumor, and finding that the tumor diameter reaches the ethical upper limit 4 weeks after the cell inoculation of a treatment-free group, and the fluid diameter reaches about 400mm 8 weeks after a simple radiotherapy group and a sorting exosome group which is subjected to radiotherapy and is injected with the DEK protein containing the exogenous structural domain mutation³Whereas no tumor was found in the group of sorted exosomes irradiated with radiotherapy and injected with exogenous DEK protein (fig. 61).

At 8 weeks after inoculation of the cells, lung tissue samples were surgically removed from all experimental mice after euthanasia, and cryosections were fixed after encapsulation. Sections were washed 1 time in PBS for 5 min; staining with hematoxylin staining solution for 10 minutes; washing away the redundant dyeing liquid in tap water for 1 minute; washing with distilled water for 1 time and 2 minutes; staining with eosin staining solution for 2 minutes; the slides were mounted with 50% glycerol. The stained slide was observed under a microscope and found to contain mDEK compared to radiotherapy + PBS group, radiotherapy +4T1^△NLSSorted exosome group of GFP proteins, no metastasis of the tumor could be found in sorted exosome group containing mDEK-GFP protein from radiotherapy +4T1 (fig. 62).

Survival curve analysis was performed on all the experimental mice, and it was found that 35 days, more than the untreated group,Radiation therapy + PBS group for 56 days and radiation therapy +4T1 containing mDEK^△NLS57 days of the exosome group for GFP protein, median survival of mice was extended to 100 days in the radiotherapy +4T1 exosome group containing mDEK-GFP protein (FIG. 63). The result shows that 4T1 tumor can be completely cured by using sorting exosome containing exogenous DEK protein and radiotherapy, the recurrence and metastasis of the tumor are eliminated, the survival of the mouse is improved, and the tumor of the mouse does not relapse and does not metastasize within 1 year after the treatment. 2. Mouse for curing EMT6 transplanted tumor by combining radiotherapy and chemotherapy with sorting exosomes

20 ten thousand EMT6 cells were inoculated into the axillary mammary fat pad of a female BALB/c mouse at 6-8 weeks, and divided into an untreated group, a chemoradiotherapy + PBS group, a chemoradiotherapy + EMT6 sorted exosome group containing mDEK-GFP protein, a chemoradiotherapy + EMT 6-containing mDEK-GFP protein^△NLSSorting exosome groups of GFP proteins, 7 per group. On

days

6, 9 and 12 after inoculation, the untreated group was not injected with the substance; the peritoneal cavity of each tumor-bearing mouse in the radiotherapy and chemotherapy + PBS group is injected with 100 mu L of PBS; chemoradiotherapy + EMT6 sorting exosomes group containing mDEK-GFP protein the 200. mu.g/mL of sorting exosomes PBS solution containing mDEK-GFP protein of EMT6 prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g of total protein per 20g of mouse body weight; radiotherapy and chemotherapy + EMT 6-containing mDEK^△NLSSorting exosomes of GFP proteins 200. mu.g/mL EMT 6-containing mDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15 was injected in an amount of 20. mu.g total protein per 20g mouse body weight^△NLSSorting exosomes PBS solution of GFP proteins. 20Gy X-ray irradiation was performed for 3 minutes and 45 seconds in the axilla range on the 7 th, 10 th and 13 th days after the inoculation, and paclitaxel was intraperitoneally injected at 1 dose of 3mg/kg mouse body weight on the 6 th, 12 th and 18 th days after the inoculation. The length and width of the tumor were measured weekly after cell inoculation, the tumor volume was calculated using the formula (length. times. width/2), the growth curve of the tumor was plotted, and it was found that the tumor diameter reached the ethical upper limit 3 weeks after cell inoculation in the untreated group, the radiotherapy + PBS group and the radiotherapy + EMT 6-containing mDEK^△NLSThe exosome group of GFP proteins reached the ethical upper limit of tumor diameter 6 weeks after cell inoculation, whereas in the sorted exosome group containing mDEK-GFP protein in chemoradiotherapy + EMT6, the tumors were in the tumorIs significantly inhibited (fig. 64). The results show that EMT6 tumor can be completely cured by using sorting exosome containing exogenous DEK protein and radiotherapy and chemotherapy, and the recurrence of tumor is inhibited.

3. Chemotherapy combined with sorting exosomes to cure MCF7 transplanted tumor mice

100 ten thousand MCF7 cells were inoculated into the axillary mammary fat pad of the 6-8 week female Nod/Scid rat, and divided into untreated group, chemotherapy + PBS group, chemotherapy + MCF7 sorted exosome group containing hDEK-GFP protein, chemotherapy + MCF7 group containing hDEK^△NLSSorting exosome groups of GFP proteins, 5 per group. At weeks 3-8 after inoculation, untreated groups were not injected with material; in the chemotherapy + PBS group, 1 time of PBS and 1 time of paclitaxel with the dose of 3mg/kg mouse body weight are injected into the abdominal cavity of each mouse every week, and the injection amount of the PBS is 100 mu L; chemotherapy + MCF7 sorting exosomes group containing hDEK-GFP protein was intraperitoneally injected weekly with 1 dose of 3mg/kg mouse body weight of paclitaxel and 1 dose of 1 μ g/g mouse body weight of 200 μ g/mL MCF7 sorting exosomes PBS solution containing hDEK-GFP protein prepared by the overexpression lentiviral transfection method in step 3 of example 15; chemotherapy + MCF7 hDEK-containing formulations^△NLSSorting exosome group of GFP proteins was intraperitoneally injected weekly with 1 dose of 3mg/kg mouse body weight of paclitaxel and 1 dose of 1. mu.g/g mouse body weight of 200. mu.g/mL MCF7 containing hDEK prepared by the overexpression lentivirus transfection method in step 3 of example 15^△NLSSorting exosomes PBS solution of GFP proteins. The length and width of the tumor were measured weekly after cell inoculation, the tumor volume was calculated using the formula (length. times. width/2), the growth curve of the tumor was plotted, and it was found that the tumor diameter reached the ethical upper limit 5 weeks after cell inoculation in the untreated group, and that the chemotherapy + PBS group and chemotherapy + MCF7 containing hDEK contained in the chemotherapy + PBS group and the MCF7^△NLSThe exosome group of GFP proteins reached the ethical upper limit of tumor diameter 12 weeks after cell inoculation, whereas no tumors were found in the exosome group of chemotherapy + MCF7 containing hDEK-GFP protein (fig. 65). The results show that MCF7 tumor can be completely cured by using sorting exosome containing exogenous DEK protein and chemotherapy, and the recurrence of the tumor is eliminated.

Example 23 the number of dormant tumor cells is closely related to the extent of clinical breast cancer progression

In 8 cases of paraffin-embedded samples of stage I, 12 cases of stage II and 3 cases of stage III breast cancer patients, the immunofluorescence assay of SETD4 was performed after sectioning (as in example 2), and the proportion of SETD4 cells in stage III samples was found to be much higher than in stage I and II samples (FIG. 66). The results indicate that the greater the number of resting tumor cells, the greater the degree of tumor progression in clinical breast cancer.

EXAMPLE 24 acquisition, activation and killing of dormant tumor cells from clinical Breast cancer samples

1. Obtaining tumor cells resistant to radiotherapy and chemotherapy from patient samples

Clinical breast cancer samples from 2 patients were treated with a tumor dissociation kit (America whirlpool, cat # 130-. 3mL of DMEM/F12 medium (Corning, Cat.: 10-092-cv) containing 10% serum replacement (Thermo Fisher Scientific Cat #10828028), paclitaxel at a final concentration of 100nM and 5-fluorouracil at a final concentration of 1mM was added to each well, incubated at 37 ℃ for 1 month, the medium was changed every 3 days, and 30Gy X-rays were irradiated once a week for a total of 2 times (two times every 7 days) for the first two weeks, each for 10 minutes. One month later, tumor cells resistant to radiotherapy and chemotherapy, i.e., quiescent tumor cells, were selected using a dead cell removal kit (Miltenyi Biotec, catalog No. 130-.

2. Effect of DEK protein binding chemotherapy on SeTD4 and Ki67 Signaling of quiescent tumor cells

Each 20 ten thousand of the 2 patient-derived dormant tumor cells were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, paclitaxel at a final concentration of 100nM, and 5-fluorouracil at a final concentration of 1 mM. To the above cells were added 25. mu.L of PBS, 25. mu.L of 200. mu.g/mL of PBS solution of sorted exosome MCF7 containing hDEK-GFP protein prepared by the transfection method for overexpression lentivirus in step 3 of example 15, and 25. mu.L of 200. mu.g/mL of PBS solution of sorted exosome MCF7 containing hDEK prepared by the transfection method for overexpression lentivirus in step 3 of example 15^ΔNLSSorting exosomes of GFP protein PBS solution, MCF7 containing sorting exosomes of hDEK-GFP protein and MCF7 containing hDEK^ΔNLSSorting exosomes of GFP proteins in culture mediumThe final concentration was 50 ng/mL. After culturing at 37 ℃ for 20 hours, the cells were harvested and immunofluorescence experiments were carried out using Rabbit polyclonal anti-DEK (Proteintetech, cat # 16448-1-AP), Rabbit polyclonal anti-SETD4(Sigma-Aldrich, cat # HPA024073) and Rabbit monoclonal anti-Ki67(abcam, cat # ab16667) antibodies (the procedure was the same as in step 2 of example 2, and the secondary antibodies used were Alexa Fluor 594 fluorescently labeled donkey anti-Rabbit, Thermo Fisher, cat # R37119). The samples were observed with a fluorescence microscope and found to contain hDEK compared to the PBS-supplemented control and MCF 7-supplemented control^ΔNLSControl group of sorted exosomes PBS solution of GFP protein, following addition of MCF7 sorted exosomes PBS solution containing hDEK-GFP protein to dormant tumor cells, the level of SETD4 in the cells decreased and the level of Ki67 increased (b in fig. 67). Research results show that the sorting exosomes containing exogenous DEK proteins can activate 100% of dormant tumor cells derived from clinical breast cancer samples.

3. Effect of DEK protein binding chemotherapy on dormant tumor cell death

Each 20 ten thousand of the 2 patient-derived dormant tumor cells were inoculated into 10mL of DMEM/F12 medium containing 10% serum replacement, paclitaxel at a final concentration of 100nM, and 5-fluorouracil at a final concentration of 1 mM. To the above cells were added 25. mu.L of PBS, 25. mu.L of 200. mu.g/mL of PBS solution of sorted exosome MCF7 containing hDEK-GFP protein prepared by the transfection method for overexpression lentivirus in step 3 of example 15, and 25. mu.L of 200. mu.g/mL of PBS solution of sorted exosome MCF7 containing hDEK prepared by the transfection method for overexpression lentivirus in step 3 of example 15^ΔNLSSorting exosomes of GFP protein PBS solution, MCF7 containing sorting exosomes of hDEK-GFP protein and MCF7 containing hDEK^ΔNLSSorting exosomes of GFP protein were all at 50ng/mL in the culture medium. After 30 hours of culture at 37 ℃ cell samples were collected and trypan blue staining examined for dead cells, and it was found that the dormant tumor cells, which were otherwise resistant to chemotherapy, all died after addition of MCF7 sorting exosomes containing hDEK-GFP protein (c in fig. 67). Research results show that the addition of sorting exosomes containing exogenous DEK protein in combination with chemotherapy can kill 100% of dormant tumor cells derived from clinical breast cancer samples.

Example 25 activation and depletion of dormant tumor cells by DEK-binding chemotherapy in various human tumor cells 1 Lung cancer cell line H226-derived crude exosomes activate and deplete H226 dormant tumor cells 100% by binding chemotherapy

H226 cell line (from Table 2) in RPMI-1640 medium (Gibco, Cat: 31800022) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin.

1000 ten thousand H226 cell lines were seeded into 20mL of medium. Culturing at 37 deg.C for 24 hr, collecting cell culture solution, centrifuging at 1000rpm and 4 deg.C for 10 min, collecting supernatant, centrifuging at 12000rpm and 4 deg.C for 20min, and collecting supernatant as H226 cell culture solution. 1mL of an exosome-separating agent (brand: Thermo Fisher, cat # 4478359) was added to the cell culture solution, and the mixture was mixed by reversing the above-mentioned mixture 3 times, and incubated at 4 ℃ overnight. The next day, the mixture was centrifuged at 10000rpm and 4 ℃ for 60 minutes, the supernatant was removed, 200. mu.L of PBS was used to resuspend the pellet at the bottom of the centrifuge tube (the pellet was the crude exosome), the total amount of protein in the crude exosome suspension was measured using BCA protein quantitative assay kit (brand: manufacturer, cat # C503021), and PBS was used to prepare a crude exosome solution with a protein concentration of 20. mu.g/mL for subsequent use.

To 100 ten thousand H226 cells, 0.1mL of Phosphate Buffered Saline (PBS) containing 2500U/mL of trypsin and 0.02% of ethylenediaminetetraacetic acid (EDTA) was added, and the cells were incubated at 25 ℃ for 40 seconds while standing, and then neutralized by adding 0.2mL of fetal calf serum, and the cells on the walls were aspirated, centrifuged at 1000rpm and 25 ℃ for 5 minutes, and then the supernatant was removed, and the pellet was resuspended in 1mL of cell culture medium. The above-mentioned resuspension was seeded at a density of 80 ten thousand per well in an ultra-low adsorption six-well plate (brand: Corning, cat. No.: 3471). 3mL of DMEM/F12 medium (Corning, Cat.: 10-092-cv) containing 10% serum replacement (Thermo Fisher Scientific Cat #10828028), paclitaxel at a final concentration of 100nM and 5-fluorouracil at a final concentration of 1mM was added to each well, incubated at 37 ℃ for 1 month, the medium was changed every 3 days, and 30Gy X-rays were irradiated once a week for a total of 2 times (two times every 7 days) for the first two weeks, each for 10 minutes. One month later, the dormant tumor cells resistant to chemotherapy were selected using a dead cell removal kit (Miltenyi Biotec, Cat. No.: 130-.

1000 of the above-described dormant tumor cells were inoculated into 2mL of DMEM/F12 medium containing 10% serum replacement, paclitaxel at a final concentration of 100nM and 5mM fluorouracil at a final concentration of 1mM, and 5. mu.L of the above-prepared crude exosome solution at 20. mu.g/mL was added to make the final concentration of 50ng/mL in the medium. After 30 hours of incubation at 37 ℃, cell mortality was found to be 100%, and H226-derived crude exosomes activated and cleared H226 dormant tumor cells 100% in combination with chemotherapy.

2. Gastric cancer cell line MKN 45-derived crude exosomes are 100% activated and eliminate MKN45 dormant tumor cells in combination with chemotherapy

Following the procedure of example 25, step 1(cell line was replaced with MKN45), MKN 45-derived crude exosomes were found to activate 100% and clear MKN45 dormant tumor cells in conjunction with chemotherapy.

3. Prostate cancer cell line PC-3 source crude exosome combined with chemotherapy for 100% activation and elimination of PC-3 dormant tumor cells

In the same manner as in step 1 of example 25 (cell line was replaced with PC-3, culture medium was replaced with F-12 medium (Gibco, Cat: 21700075) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin), it was found that PC-3-derived crude exosomes activated and cleared PC-3 dormant tumor cells 100% in combination with chemotherapy.

4. HeLa-derived crude exosome of cervical cancer cell line combined with chemotherapy for 100% activation and elimination of HeLa resting tumor cells

As in example 25, step 1(cell line was replaced with HeLa, medium was replaced with MEM medium (Gibco, Cat. No: 41500034) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin), HeLa-derived crude exosomes were found to 100% activate and eliminate HeLa quiescent tumor cells in combination with chemotherapy.

The results of the study indicate that the activation and elimination of dormant tumor cells using DEK can be useful in the treatment of a variety of different types of human cancers.

TABLE 2 DEK protein activation and elimination effects on tumor cells

Sequence listing

<110> Zhejiang university

<160> 25

<170> SIPOSequenceListing 1.0

<210> 1

<211> 375

<212> PRT

<213> human DEK protein (Humanized)

<400> 1

Met Ser Ala Ser Ala Pro Ala Ala Glu Gly Glu Gly Thr Pro Thr Gln

1 5 10 15

Pro Ala Ser Glu Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser

20 25 30

Glu Glu Glu Glu Asp Glu Asp Asp Glu Glu Glu Glu Glu Glu Glu Lys

35 40 45

Glu Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu

50 55 60

Arg Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Ile

65 70 75 80

Ala Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe

85 90 95

Phe Leu Ser Lys Lys Lys Thr Asp Glu Leu Arg Asn Leu His Lys Leu

100 105 110

Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly

115 120 125

Gln Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Val Gln Tyr Lys Lys

130 135 140

Lys Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile

145 150 155 160

Cys Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val

165 170 175

Lys Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro

180 185 190

Leu Pro Lys Ser Lys Lys Thr Cys Ser Lys Gly Ser Lys Lys Glu Arg

195 200 205

Asn Ser Ser Gly Met Ala Arg Lys Ala Lys Arg Thr Lys Cys Pro Glu

210 215 220

Ile Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys

225 230 235 240

Glu Glu Ser Ser Asp Asp Glu Asp Lys Glu Ser Glu Glu Glu Pro Pro

245 250 255

Lys Lys Thr Ala Lys Arg Glu Lys Pro Lys Gln Lys Ala Thr Ser Lys

260 265 270

Ser Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser

275 280 285

Thr Thr Lys Lys Asn Gln Asn Ser Ser Lys Lys Glu Ser Glu Ser Glu

290 295 300

Asp Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro

305 310 315 320

Thr Asp Glu Glu Leu Lys Glu Thr Ile Lys Lys Leu Leu Ala Ser Ala

325 330 335

Asn Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys Lys Val Tyr Glu

340 345 350

Asn Tyr Pro Thr Tyr Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr

355 360 365

Thr Val Lys Glu Leu Ile Ser

370 375

<210> 2

<211> 17

<212> PRT

<213> NLS Domain (Humanized)

<400> 2

Lys Lys Glu Arg Asn Ser Ser Gly Met Ala Arg Lys Ala Lys Arg Thr

1 5 10 15

Lys

<210> 3

<211> 35

<212> PRT

<213> SAP Domain (Humanized)

<400> 3

Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile Cys Glu Val Leu

1 5 10 15

Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val Lys Arg Ile Leu

20 25 30

Asn Phe Leu

35

<210> 4

<211> 39

<212> PRT

<213> pseudo-SAP Domain (Humanized)

<400> 4

Ile Glu Arg Ile His Phe Phe Leu Ser Lys Lys Lys Thr Asp Glu Leu

1 5 10 15

Arg Asn Leu His Lys Leu Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser

20 25 30

Leu Lys Lys Asn Val Gly Gln

35

<210> 5

<211> 1128

<212> DNA

<213> DEK Gene (Humanized)

<400> 5

atgtccgcct cggcccctgc tgcggagggg gagggaaccc ccacccagcc cgcgtccgag 60

aaagaacccg aaatgcccgg tcccagagag gagagcgagg aggaagagga cgaggacgac 120

gaggaggagg aggaggagga aaaagaaaag agtctcatcg tggaaggcaa gagggaaaag 180

aaaaaagtag agaggttgac aatgcaagtc tcttccttac agagagagcc atttacaatt 240

gcacaaggaa aggggcagaa actttgtgaa attgagagga tacatttttt tctaagtaag 300

aagaaaaccg atgaacttag aaatctacac aaactgcttt acaacaggcc aggcactgtg 360

tcctcattaa agaagaatgt gggtcagttc agtggctttc catttgaaaa aggaagtgtc 420

caatataaaa agaaggaaga aatgttgaaa aaatttagaa atgccatgtt aaagagcatc 480

tgtgaggttc ttgatttgga gagatcaggt gtaaatagtg aactagtgaa gaggatcttg 540

aatttcttaa tgcatccaaa gccttctggc aaaccattgc cgaaatctaa aaaaacttgt 600

agcaaaggca gtaaaaagga acggaacagt tctggaatgg caaggaaggc taagcgaacc 660

aaatgtcctg aaattctgtc agatgaatct agtagtgatg aagatgaaaa gaaaaacaag 720

gaagagtctt cagatgatga agataaagaa agtgaagagg agccaccaaa aaagacagcc 780

aaaagagaaa aacctaaaca gaaagctact tctaaaagta aaaaatctgt gaaaagtgcc 840

aatgttaaga aagcagatag cagcaccacc aagaagaatc aaaacagttc caaaaaagaa 900

agtgagtctg aggatagttc agatgatgaa cctttaatta aaaagttgaa gaaaccccct 960

acagatgaag agttaaagga aacaataaag aaattactgg ccagtgctaa cttggaagaa 1020

gtcacaatga aacagatttg caaaaaggtc tatgaaaatt atcctactta tgatttaact 1080

gaaagaaaag atttcataaa aacaactgta aaagagctaa tttcttga 1128

<210> 6

<211> 1881

<212> DNA

<213> EGFP-DEK Gene (Humanized)

<400> 6

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtcc 720

ggactcagat ctcgagctca agcttcgaat tctatgtccg cctcggcccc tgctgcggag 780

ggggagggaa cccccaccca gcccgcgtcc gagaaagaac ccgaaatgcc cggtcccaga 840

gaggagagcg aggaggaaga ggacgaggac gacgaggagg aggaggagga ggaaaaagaa 900

aagagtctca tcgtggaagg caagagggaa aagaaaaaag tagagaggtt gacaatgcaa 960

gtctcttcct tacagagaga gccatttaca attgcacaag gaaaggggca gaaactttgt 1020

gaaattgaga ggatacattt ttttctaagt aagaagaaaa ccgatgaact tagaaatcta 1080

cacaaactgc tttacaacag gccaggcact gtgtcctcat taaagaagaa tgtgggtcag 1140

ttcagtggct ttccatttga aaaaggaagt gtccaatata aaaagaagga agaaatgttg 1200

aaaaaattta gaaatgccat gttaaagagc atctgtgagg ttcttgattt ggagagatca 1260

ggtgtaaata gtgaactagt gaagaggatc ttgaatttct taatgcatcc aaagccttct 1320

ggcaaaccat tgccgaaatc taaaaaaact tgtagcaaag gcagtaaaaa ggaacggaac 1380

agttctggaa tggcaaggaa ggctaagcga accaaatgtc ctgaaattct gtcagatgaa 1440

tctagtagtg atgaagatga aaagaaaaac aaggaagagt cttcagatga tgaagataaa 1500

gaaagtgaag aggagccacc aaaaaagaca gccaaaagag aaaaacctaa acagaaagct 1560

acttctaaaa gtaaaaaatc tgtgaaaagt gccaatgtta agaaagcaga tagcagcacc 1620

accaagaaga atcaaaacag ttccaaaaaa gaaagtgagt ctgaggatag ttcagatgat 1680

gaacctttaa ttaaaaagtt gaagaaaccc cctacagatg aagagttaaa ggaaacaata 1740

aagaaattac tggccagtgc taacttggaa gaagtcacaa tgaaacagat ttgcaaaaag 1800

gtctatgaaa attatcctac ttatgattta actgaaagaa aagatttcat aaaaacaact 1860

gtaaaagagc taatttcttg a 1881

<210> 7

<211> 626

<212> PRT

<213> EGFP-DEK(Humanized)

<400> 7

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Ser

225 230 235 240

Gly Leu Arg Ser Arg Ala Gln Ala Ser Asn Ser Met Ser Ala Ser Ala

245 250 255

Pro Ala Ala Glu Gly Glu Gly Thr Pro Thr Gln Pro Ala Ser Glu Lys

260 265 270

Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser Glu Glu Glu Glu Asp

275 280 285

Glu Asp Asp Glu Glu Glu Glu Glu Glu Glu Lys Glu Lys Ser Leu Ile

290 295 300

Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu Arg Leu Thr Met Gln

305 310 315 320

Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Ile Ala Gln Gly Lys Gly

325 330 335

Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe Phe Leu Ser Lys Lys

340 345 350

Lys Thr Asp Glu Leu Arg Asn Leu His Lys Leu Leu Tyr Asn Arg Pro

355 360 365

Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly Gln Phe Ser Gly Phe

370 375 380

Pro Phe Glu Lys Gly Ser Val Gln Tyr Lys Lys Lys Glu Glu Met Leu

385 390 395 400

Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile Cys Glu Val Leu Asp

405 410 415

Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val Lys Arg Ile Leu Asn

420 425 430

Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro Leu Pro Lys Ser Lys

435 440 445

Lys Thr Cys Ser Lys Gly Ser Lys Lys Glu Arg Asn Ser Ser Gly Met

450 455 460

Ala Arg Lys Ala Lys Arg Thr Lys Cys Pro Glu Ile Leu Ser Asp Glu

465 470 475 480

Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys Glu Glu Ser Ser Asp

485 490 495

Asp Glu Asp Lys Glu Ser Glu Glu Glu Pro Pro Lys Lys Thr Ala Lys

500 505 510

Arg Glu Lys Pro Lys Gln Lys Ala Thr Ser Lys Ser Lys Lys Ser Val

515 520 525

Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser Thr Thr Lys Lys Asn

530 535 540

Gln Asn Ser Ser Lys Lys Glu Ser Glu Ser Glu Asp Ser Ser Asp Asp

545 550 555 560

Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro Thr Asp Glu Glu Leu

565 570 575

Lys Glu Thr Ile Lys Lys Leu Leu Ala Ser Ala Asn Leu Glu Glu Val

580 585 590

Thr Met Lys Gln Ile Cys Lys Lys Val Tyr Glu Asn Tyr Pro Thr Tyr

595 600 605

Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr Thr Val Lys Glu Leu

610 615 620

Ile Ser

625

<210> 8

<211> 1830

<212> DNA

<213> EGFP-DEK DELTA NLS Gene (Humanized)

<400> 8

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtcc 720

ggactcagat ctcgagctca agcttcgaat tctatgtccg cctcggcccc tgctgcggag 780

ggggagggaa cccccaccca gcccgcgtcc gagaaagaac ccgaaatgcc cggtcccaga 840

gaggagagcg aggaggaaga ggacgaggac gacgaggagg aggaggagga ggaaaaagaa 900

aagagtctca tcgtggaagg caagagggaa aagaaaaaag tagagaggtt gacaatgcaa 960

gtctcttcct tacagagaga gccatttaca attgcacaag gaaaggggca gaaactttgt 1020

gaaattgaga ggatacattt ttttctaagt aagaagaaaa ccgatgaact tagaaatcta 1080

cacaaactgc tttacaacag gccaggcact gtgtcctcat taaagaagaa tgtgggtcag 1140

ttcagtggct ttccatttga aaaaggaagt gtccaatata aaaagaagga agaaatgttg 1200

aaaaaattta gaaatgccat gttaaagagc atctgtgagg ttcttgattt ggagagatca 1260

ggtgtaaata gtgaactagt gaagaggatc ttgaatttct taatgcatcc aaagccttct 1320

ggcaaaccat tgccgaaatc taaaaaaact tgtagcaaag gcagttgtcc tgaaattctg 1380

tcagatgaat ctagtagtga tgaagatgaa aagaaaaaca aggaagagtc ttcagatgat 1440

gaagataaag aaagtgaaga ggagccacca aaaaagacag ccaaaagaga aaaacctaaa 1500

cagaaagcta cttctaaaag taaaaaatct gtgaaaagtg ccaatgttaa gaaagcagat 1560

agcagcacca ccaagaagaa tcaaaacagt tccaaaaaag aaagtgagtc tgaggatagt 1620

tcagatgatg aacctttaat taaaaagttg aagaaacccc ctacagatga agagttaaag 1680

gaaacaataa agaaattact ggccagtgct aacttggaag aagtcacaat gaaacagatt 1740

tgcaaaaagg tctatgaaaa ttatcctact tatgatttaa ctgaaagaaa agatttcata 1800

aaaacaactg taaaagagct aatttcttga 1830

<210> 9

<211> 609

<212> PRT

<213> EGFP-DEK DELTA NLS Gene (Humanized)

<400> 9

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Ser

225 230 235 240

Gly Leu Arg Ser Arg Ala Gln Ala Ser Asn Ser Met Ser Ala Ser Ala

245 250 255

Pro Ala Ala Glu Gly Glu Gly Thr Pro Thr Gln Pro Ala Ser Glu Lys

260 265 270

Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser Glu Glu Glu Glu Asp

275 280 285

Glu Asp Asp Glu Glu Glu Glu Glu Glu Glu Lys Glu Lys Ser Leu Ile

290 295 300

Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu Arg Leu Thr Met Gln

305 310 315 320

Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Ile Ala Gln Gly Lys Gly

325 330 335

Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe Phe Leu Ser Lys Lys

340 345 350

Lys Thr Asp Glu Leu Arg Asn Leu His Lys Leu Leu Tyr Asn Arg Pro

355 360 365

Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly Gln Phe Ser Gly Phe

370 375 380

Pro Phe Glu Lys Gly Ser Val Gln Tyr Lys Lys Lys Glu Glu Met Leu

385 390 395 400

Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile Cys Glu Val Leu Asp

405 410 415

Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val Lys Arg Ile Leu Asn

420 425 430

Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro Leu Pro Lys Ser Lys

435 440 445

Lys Thr Cys Ser Lys Gly Ser Cys Pro Glu Ile Leu Ser Asp Glu Ser

450 455 460

Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys Glu Glu Ser Ser Asp Asp

465 470 475 480

Glu Asp Lys Glu Ser Glu Glu Glu Pro Pro Lys Lys Thr Ala Lys Arg

485 490 495

Glu Lys Pro Lys Gln Lys Ala Thr Ser Lys Ser Lys Lys Ser Val Lys

500 505 510

Ser Ala Asn Val Lys Lys Ala Asp Ser Ser Thr Thr Lys Lys Asn Gln

515 520 525

Asn Ser Ser Lys Lys Glu Ser Glu Ser Glu Asp Ser Ser Asp Asp Glu

530 535 540

Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro Thr Asp Glu Glu Leu Lys

545 550 555 560

Glu Thr Ile Lys Lys Leu Leu Ala Ser Ala Asn Leu Glu Glu Val Thr

565 570 575

Met Lys Gln Ile Cys Lys Lys Val Tyr Glu Asn Tyr Pro Thr Tyr Asp

580 585 590

Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr Thr Val Lys Glu Leu Ile

595 600 605

Ser

<210> 10

<211> 1896

<212> DNA

<213> EGFP-DEK Gene (Murine)

<400> 10

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtcc 720

ggactcagat ctcgagctca agcttcgaat tctatgtcgg cggcggcggc ccccgctgcg 780

gagggagagg acgcccccgt gccgccctca tccgagaagg aacccgagat gccgggtccc 840

agggaagaga gtgaggagga ggaggaggat gacgaagacg atgatgaaga ggacgaggag 900

gaagaaaaag aaaagagtct tatcgtggaa ggcaagagag agaagaagaa agtagagaga 960

ctgacgatgc aagtgtcttc cttacagaga gagccattta cagtgacaca agggaagggt 1020

cagaaacttt gtgaaattga aaggatacat ttctttctga gtaagaaaaa accagatgaa 1080

cttagaaatc tacacaaact gctttacaac aggccgggca cagtgtcctc gttgaagaag 1140

aacgtgggtc agttcagtgg ctttccattc gaaaaaggca gtacccagta taaaaagaag 1200

gaagaaatgt tgaaaaagtt tcgaaatgcc atgttaaaga gcatctgtga ggttcttgat 1260

ttagagaggt caggcgtgaa cagcgaactc gtgaagagga tcttgaactt cttaatgcat 1320

ccaaagcctt ctggcaaacc attaccaaaa tccaaaaaat cttccagcaa aggtagtaaa 1380

aaggaacgga acagttctgg aacaacaagg aagtcaaagc aaactaaatg ccctgaaatt 1440

ctgtcagatg agtctagtag tgatgaagat gagaagaaaa ataaggaaga gtcttcggaa 1500

gatgaagaga aagaaagtga agaggagcaa ccaccaaaaa agacatctaa aaaagaaaaa 1560

gcaaaacaga aagctactgc taaaagtaaa aaatctgtga agagtgctaa tgttaagaag 1620

gcagacagca gtaccaccaa gaagaatcaa aaaagttcca aaaaagagtc tgaatctgaa 1680

gacagttctg atgatgaacc cttaattaaa aaattgaaaa agccacctac agatgaagag 1740

ctaaaggaaa cagtgaagaa attactggct gatgctaact tggaagaagt cacaatgaag 1800

cagatttgca aagaggtata tgaaaattat cctgcttatg atttgactga gaggaaagat 1860

ttcattaaaa caactgtaaa agagctaatt tcttga 1896

<210> 11

<211> 631

<212> PRT

<213> EGFP-DEK Gene (Murine)

<400> 11

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Ser

225 230 235 240

Gly Leu Arg Ser Arg Ala Gln Ala Ser Asn Ser Met Ser Ala Ala Ala

245 250 255

Ala Pro Ala Ala Glu Gly Glu Asp Ala Pro Val Pro Pro Ser Ser Glu

260 265 270

Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser Glu Glu Glu Glu

275 280 285

Glu Asp Asp Glu Asp Asp Asp Glu Glu Asp Glu Glu Glu Glu Lys Glu

290 295 300

Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu Arg

305 310 315 320

Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Val Thr

325 330 335

Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe Phe

340 345 350

Leu Ser Lys Lys Lys Pro Asp Glu Leu Arg Asn Leu His Lys Leu Leu

355 360 365

Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly Gln

370 375 380

Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Thr Gln Tyr Lys Lys Lys

385 390 395 400

Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile Cys

405 410 415

Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val Lys

420 425 430

Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro Leu

435 440 445

Pro Lys Ser Lys Lys Ser Ser Ser Lys Gly Ser Lys Lys Glu Arg Asn

450 455 460

Ser Ser Gly Thr Thr Arg Lys Ser Lys Gln Thr Lys Cys Pro Glu Ile

465 470 475 480

Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys Glu

485 490 495

Glu Ser Ser Glu Asp Glu Glu Lys Glu Ser Glu Glu Glu Gln Pro Pro

500 505 510

Lys Lys Thr Ser Lys Lys Glu Lys Ala Lys Gln Lys Ala Thr Ala Lys

515 520 525

Ser Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser

530 535 540

Thr Thr Lys Lys Asn Gln Lys Ser Ser Lys Lys Glu Ser Glu Ser Glu

545 550 555 560

Asp Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro

565 570 575

Thr Asp Glu Glu Leu Lys Glu Thr Val Lys Lys Leu Leu Ala Asp Ala

580 585 590

Asn Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys Glu Val Tyr Glu

595 600 605

Asn Tyr Pro Ala Tyr Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr

610 615 620

Thr Val Lys Glu Leu Ile Ser

625 630

<210> 12

<211> 1845

<212> DNA

<213> EGFP-DEK DELTA NLS Gene (Murine)

<400> 12

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtcc 720

ggactcagat ctcgagctca agcttcgaat tctatgtcgg cggcggcggc ccccgctgcg 780

gagggagagg acgcccccgt gccgccctca tccgagaagg aacccgagat gccgggtccc 840

agggaagaga gtgaggagga ggaggaggat gacgaagacg atgatgaaga ggacgaggag 900

gaagaaaaag aaaagagtct tatcgtggaa ggcaagagag agaagaagaa agtagagaga 960

ctgacgatgc aagtgtcttc cttacagaga gagccattta cagtgacaca agggaagggt 1020

cagaaacttt gtgaaattga aaggatacat ttctttctga gtaagaaaaa accagatgaa 1080

cttagaaatc tacacaaact gctttacaac aggccgggca cagtgtcctc gttgaagaag 1140

aacgtgggtc agttcagtgg ctttccattc gaaaaaggca gtacccagta taaaaagaag 1200

gaagaaatgt tgaaaaagtt tcgaaatgcc atgttaaaga gcatctgtga ggttcttgat 1260

ttagagaggt caggcgtgaa cagcgaactc gtgaagagga tcttgaactt cttaatgcat 1320

ccaaagcctt ctggcaaacc attaccaaaa tccaaaaaat cttccagcaa aggtagttgc 1380

cctgaaattc tgtcagatga gtctagtagt gatgaagatg agaagaaaaa taaggaagag 1440

tcttcggaag atgaagagaa agaaagtgaa gaggagcaac caccaaaaaa gacatctaaa 1500

aaagaaaaag caaaacagaa agctactgct aaaagtaaaa aatctgtgaa gagtgctaat 1560

gttaagaagg cagacagcag taccaccaag aagaatcaaa aaagttccaa aaaagagtct 1620

gaatctgaag acagttctga tgatgaaccc ttaattaaaa aattgaaaaa gccacctaca 1680

gatgaagagc taaaggaaac agtgaagaaa ttactggctg atgctaactt ggaagaagtc 1740

acaatgaagc agatttgcaa agaggtatat gaaaattatc ctgcttatga tttgactgag 1800

aggaaagatt tcattaaaac aactgtaaaa gagctaattt cttga 1845

<210> 13

<211> 614

<212> PRT

<213> EGFP-DEKΔNLS(Murine)

<400> 13

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Ser

225 230 235 240

Gly Leu Arg Ser Arg Ala Gln Ala Ser Asn Ser Met Ser Ala Ala Ala

245 250 255

Ala Pro Ala Ala Glu Gly Glu Asp Ala Pro Val Pro Pro Ser Ser Glu

260 265 270

Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser Glu Glu Glu Glu

275 280 285

Glu Asp Asp Glu Asp Asp Asp Glu Glu Asp Glu Glu Glu Glu Lys Glu

290 295 300

Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu Arg

305 310 315 320

Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Val Thr

325 330 335

Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe Phe

340 345 350

Leu Ser Lys Lys Lys Pro Asp Glu Leu Arg Asn Leu His Lys Leu Leu

355 360 365

Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly Gln

370 375 380

Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Thr Gln Tyr Lys Lys Lys

385 390 395 400

Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile Cys

405 410 415

Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val Lys

420 425 430

Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro Leu

435 440 445

Pro Lys Ser Lys Lys Ser Ser Ser Lys Gly Ser Cys Pro Glu Ile Leu

450 455 460

Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys Glu Glu

465 470 475 480

Ser Ser Glu Asp Glu Glu Lys Glu Ser Glu Glu Glu Gln Pro Pro Lys

485 490 495

Lys Thr Ser Lys Lys Glu Lys Ala Lys Gln Lys Ala Thr Ala Lys Ser

500 505 510

Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser Thr

515 520 525

Thr Lys Lys Asn Gln Lys Ser Ser Lys Lys Glu Ser Glu Ser Glu Asp

530 535 540

Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro Thr

545 550 555 560

Asp Glu Glu Leu Lys Glu Thr Val Lys Lys Leu Leu Ala Asp Ala Asn

565 570 575

Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys Glu Val Tyr Glu Asn

580 585 590

Tyr Pro Ala Tyr Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr Thr

595 600 605

Val Lys Glu Leu Ile Ser

610

<210> 14

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 14

ggatagttca gatgatgaac 20

<210> 15

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 15

gtgatgaaga tgaaaagaaa 20

<210> 16

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 16

gtgaagaaat tactggctga t 21

<210> 17

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 17

cgaactcgtg aagaggatct t 21

<210> 18

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 18

atgttaacag ctgtactggt g 21

<210> 19

<211> 1077

<212> DNA

<213> DEK DELTA NLS Gene (Humanized)

<400> 19

atgtccgcct cggcccctgc tgcggagggg gagggaaccc ccacccagcc cgcgtccgag 60

aaagaacccg aaatgcccgg tcccagagag gagagcgagg aggaagagga cgaggacgac 120

gaggaggagg aggaggagga aaaagaaaag agtctcatcg tggaaggcaa gagggaaaag 180

aaaaaagtag agaggttgac aatgcaagtc tcttccttac agagagagcc atttacaatt 240

gcacaaggaa aggggcagaa actttgtgaa attgagagga tacatttttt tctaagtaag 300

aagaaaaccg atgaacttag aaatctacac aaactgcttt acaacaggcc aggcactgtg 360

tcctcattaa agaagaatgt gggtcagttc agtggctttc catttgaaaa aggaagtgtc 420

caatataaaa agaaggaaga aatgttgaaa aaatttagaa atgccatgtt aaagagcatc 480

tgtgaggttc ttgatttgga gagatcaggt gtaaatagtg aactagtgaa gaggatcttg 540

aatttcttaa tgcatccaaa gccttctggc aaaccattgc cgaaatctaa aaaaacttgt 600

agcaaaggca gttgtcctga aattctgtca gatgaatcta gtagtgatga agatgaaaag 660

aaaaacaagg aagagtcttc agatgatgaa gataaagaaa gtgaagagga gccaccaaaa 720

aagacagcca aaagagaaaa acctaaacag aaagctactt ctaaaagtaa aaaatctgtg 780

aaaagtgcca atgttaagaa agcagatagc agcaccacca agaagaatca aaacagttcc 840

aaaaaagaaa gtgagtctga ggatagttca gatgatgaac ctttaattaa aaagttgaag 900

aaacccccta cagatgaaga gttaaaggaa acaataaaga aattactggc cagtgctaac 960

ttggaagaag tcacaatgaa acagatttgc aaaaaggtct atgaaaatta tcctacttat 1020

gatttaactg aaagaaaaga tttcataaaa acaactgtaa aagagctaat ttcttga 1077

<210> 20

<211> 358

<212> PRT

<213> DEKΔNLS(Humanized)

<400> 20

Met Ser Ala Ser Ala Pro Ala Ala Glu Gly Glu Gly Thr Pro Thr Gln

1 5 10 15

Pro Ala Ser Glu Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser

20 25 30

Glu Glu Glu Glu Asp Glu Asp Asp Glu Glu Glu Glu Glu Glu Glu Lys

35 40 45

Glu Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu

50 55 60

Arg Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Ile

65 70 75 80

Ala Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe

85 90 95

Phe Leu Ser Lys Lys Lys Thr Asp Glu Leu Arg Asn Leu His Lys Leu

100 105 110

Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly

115 120 125

Gln Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Val Gln Tyr Lys Lys

130 135 140

Lys Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile

145 150 155 160

Cys Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val

165 170 175

Lys Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro

180 185 190

Leu Pro Lys Ser Lys Lys Thr Cys Ser Lys Gly Ser Cys Pro Glu Ile

195 200 205

Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys Glu

210 215 220

Glu Ser Ser Asp Asp Glu Asp Lys Glu Ser Glu Glu Glu Pro Pro Lys

225 230 235 240

Lys Thr Ala Lys Arg Glu Lys Pro Lys Gln Lys Ala Thr Ser Lys Ser

245 250 255

Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser Thr

260 265 270

Thr Lys Lys Asn Gln Asn Ser Ser Lys Lys Glu Ser Glu Ser Glu Asp

275 280 285

Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro Thr

290 295 300

Asp Glu Glu Leu Lys Glu Thr Ile Lys Lys Leu Leu Ala Ser Ala Asn

305 310 315 320

Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys Lys Val Tyr Glu Asn

325 330 335

Tyr Pro Thr Tyr Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr Thr

340 345 350

Val Lys Glu Leu Ile Ser

355

<210> 21

<211> 1143

<212> DNA

<213> DEK Gene (Murine)

<400> 21

atgtcggcgg cggcggcccc cgctgcggag ggagaggacg cccccgtgcc gccctcatcc 60

gagaaggaac ccgagatgcc gggtcccagg gaagagagtg aggaggagga ggaggatgac 120

gaagacgatg atgaagagga cgaggaggaa gaaaaagaaa agagtcttat cgtggaaggc 180

aagagagaga agaagaaagt agagagactg acgatgcaag tgtcttcctt acagagagag 240

ccatttacag tgacacaagg gaagggtcag aaactttgtg aaattgaaag gatacatttc 300

tttctgagta agaaaaaacc agatgaactt agaaatctac acaaactgct ttacaacagg 360

ccgggcacag tgtcctcgtt gaagaagaac gtgggtcagt tcagtggctt tccattcgaa 420

aaaggcagta cccagtataa aaagaaggaa gaaatgttga aaaagtttcg aaatgccatg 480

ttaaagagca tctgtgaggt tcttgattta gagaggtcag gcgtgaacag cgaactcgtg 540

aagaggatct tgaacttctt aatgcatcca aagccttctg gcaaaccatt accaaaatcc 600

aaaaaatctt ccagcaaagg tagtaaaaag gaacggaaca gttctggaac aacaaggaag 660

tcaaagcaaa ctaaatgccc tgaaattctg tcagatgagt ctagtagtga tgaagatgag 720

aagaaaaata aggaagagtc ttcggaagat gaagagaaag aaagtgaaga ggagcaacca 780

ccaaaaaaga catctaaaaa agaaaaagca aaacagaaag ctactgctaa aagtaaaaaa 840

tctgtgaaga gtgctaatgt taagaaggca gacagcagta ccaccaagaa gaatcaaaaa 900

agttccaaaa aagagtctga atctgaagac agttctgatg atgaaccctt aattaaaaaa 960

ttgaaaaagc cacctacaga tgaagagcta aaggaaacag tgaagaaatt actggctgat 1020

gctaacttgg aagaagtcac aatgaagcag atttgcaaag aggtatatga aaattatcct 1080

gcttatgatt tgactgagag gaaagatttc attaaaacaa ctgtaaaaga gctaatttct 1140

tga 1143

<210> 22

<211> 380

<212> PRT

<213> DEK(Murine)

<400> 22

Met Ser Ala Ala Ala Ala Pro Ala Ala Glu Gly Glu Asp Ala Pro Val

1 5 10 15

Pro Pro Ser Ser Glu Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu

20 25 30

Ser Glu Glu Glu Glu Glu Asp Asp Glu Asp Asp Asp Glu Glu Asp Glu

35 40 45

Glu Glu Glu Lys Glu Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys

50 55 60

Lys Lys Val Glu Arg Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu

65 70 75 80

Pro Phe Thr Val Thr Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu

85 90 95

Arg Ile His Phe Phe Leu Ser Lys Lys Lys Pro Asp Glu Leu Arg Asn

100 105 110

Leu His Lys Leu Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys

115 120 125

Lys Asn Val Gly Gln Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Thr

130 135 140

Gln Tyr Lys Lys Lys Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met

145 150 155 160

Leu Lys Ser Ile Cys Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn

165 170 175

Ser Glu Leu Val Lys Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro

180 185 190

Ser Gly Lys Pro Leu Pro Lys Ser Lys Lys Ser Ser Ser Lys Gly Ser

195 200 205

Lys Lys Glu Arg Asn Ser Ser Gly Thr Thr Arg Lys Ser Lys Gln Thr

210 215 220

Lys Cys Pro Glu Ile Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu

225 230 235 240

Lys Lys Asn Lys Glu Glu Ser Ser Glu Asp Glu Glu Lys Glu Ser Glu

245 250 255

Glu Glu Gln Pro Pro Lys Lys Thr Ser Lys Lys Glu Lys Ala Lys Gln

260 265 270

Lys Ala Thr Ala Lys Ser Lys Lys Ser Val Lys Ser Ala Asn Val Lys

275 280 285

Lys Ala Asp Ser Ser Thr Thr Lys Lys Asn Gln Lys Ser Ser Lys Lys

290 295 300

Glu Ser Glu Ser Glu Asp Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys

305 310 315 320

Leu Lys Lys Pro Pro Thr Asp Glu Glu Leu Lys Glu Thr Val Lys Lys

325 330 335

Leu Leu Ala Asp Ala Asn Leu Glu Glu Val Thr Met Lys Gln Ile Cys

340 345 350

Lys Glu Val Tyr Glu Asn Tyr Pro Ala Tyr Asp Leu Thr Glu Arg Lys

355 360 365

Asp Phe Ile Lys Thr Thr Val Lys Glu Leu Ile Ser

370 375 380

<210> 23

<211> 1092

<212> DNA

<213> DEKΔNLS(Murine)

<400> 23

atgtcggcgg cggcggcccc cgctgcggag ggagaggacg cccccgtgcc gccctcatcc 60

gagaaggaac ccgagatgcc gggtcccagg gaagagagtg aggaggagga ggaggatgac 120

gaagacgatg atgaagagga cgaggaggaa gaaaaagaaa agagtcttat cgtggaaggc 180

aagagagaga agaagaaagt agagagactg acgatgcaag tgtcttcctt acagagagag 240

ccatttacag tgacacaagg gaagggtcag aaactttgtg aaattgaaag gatacatttc 300

tttctgagta agaaaaaacc agatgaactt agaaatctac acaaactgct ttacaacagg 360

ccgggcacag tgtcctcgtt gaagaagaac gtgggtcagt tcagtggctt tccattcgaa 420

aaaggcagta cccagtataa aaagaaggaa gaaatgttga aaaagtttcg aaatgccatg 480

ttaaagagca tctgtgaggt tcttgattta gagaggtcag gcgtgaacag cgaactcgtg 540

aagaggatct tgaacttctt aatgcatcca aagccttctg gcaaaccatt accaaaatcc 600

aaaaaatctt ccagcaaagg tagttgccct gaaattctgt cagatgagtc tagtagtgat 660

gaagatgaga agaaaaataa ggaagagtct tcggaagatg aagagaaaga aagtgaagag 720

gagcaaccac caaaaaagac atctaaaaaa gaaaaagcaa aacagaaagc tactgctaaa 780

agtaaaaaat ctgtgaagag tgctaatgtt aagaaggcag acagcagtac caccaagaag 840

aatcaaaaaa gttccaaaaa agagtctgaa tctgaagaca gttctgatga tgaaccctta 900

attaaaaaat tgaaaaagcc acctacagat gaagagctaa aggaaacagt gaagaaatta 960

ctggctgatg ctaacttgga agaagtcaca atgaagcaga tttgcaaaga ggtatatgaa 1020

aattatcctg cttatgattt gactgagagg aaagatttca ttaaaacaac tgtaaaagag 1080

ctaatttctt ga 1092

<210> 24

<211> 363

<212> PRT

<213> DEKΔNLS(Murine)

<400> 24

Met Ser Ala Ala Ala Ala Pro Ala Ala Glu Gly Glu Asp Ala Pro Val

1 5 10 15

Pro Pro Ser Ser Glu Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu

20 25 30

Ser Glu Glu Glu Glu Glu Asp Asp Glu Asp Asp Asp Glu Glu Asp Glu

35 40 45

Glu Glu Glu Lys Glu Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys

50 55 60

Lys Lys Val Glu Arg Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu

65 70 75 80

Pro Phe Thr Val Thr Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu

85 90 95

Arg Ile His Phe Phe Leu Ser Lys Lys Lys Pro Asp Glu Leu Arg Asn

100 105 110

Leu His Lys Leu Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys

115 120 125

Lys Asn Val Gly Gln Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Thr

130 135 140

Gln Tyr Lys Lys Lys Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met

145 150 155 160

Leu Lys Ser Ile Cys Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn

165 170 175

Ser Glu Leu Val Lys Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro

180 185 190

Ser Gly Lys Pro Leu Pro Lys Ser Lys Lys Ser Ser Ser Lys Gly Ser

195 200 205

Cys Pro Glu Ile Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys

210 215 220

Lys Asn Lys Glu Glu Ser Ser Glu Asp Glu Glu Lys Glu Ser Glu Glu

225 230 235 240

Glu Gln Pro Pro Lys Lys Thr Ser Lys Lys Glu Lys Ala Lys Gln Lys

245 250 255

Ala Thr Ala Lys Ser Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys

260 265 270

Ala Asp Ser Ser Thr Thr Lys Lys Asn Gln Lys Ser Ser Lys Lys Glu

275 280 285

Ser Glu Ser Glu Asp Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu

290 295 300

Lys Lys Pro Pro Thr Asp Glu Glu Leu Lys Glu Thr Val Lys Lys Leu

305 310 315 320

Leu Ala Asp Ala Asn Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys

325 330 335

Glu Val Tyr Glu Asn Tyr Pro Ala Tyr Asp Leu Thr Glu Arg Lys Asp

340 345 350

Phe Ile Lys Thr Thr Val Lys Glu Leu Ile Ser

355 360

<210> 25

<211> 375

<212> PRT

<213> Unknown (Unknown)

<400> 25

Met Ser Ala Xaa Ala Pro Ala Ala Glu Gly Glu Xaa Xaa Pro Xaa Xaa

1 5 10 15

Pro Xaa Ser Glu Lys Glu Pro Glu Met Pro Gly Pro Arg Glu Glu Ser

20 25 30

Glu Glu Glu Glu Xaa Xaa Asp Asp Glu Glu Xaa Glu Glu Glu Glu Lys

35 40 45

Glu Lys Ser Leu Ile Val Glu Gly Lys Arg Glu Lys Lys Lys Val Glu

50 55 60

Arg Leu Thr Met Gln Val Ser Ser Leu Gln Arg Glu Pro Phe Thr Xaa

65 70 75 80

Xaa Gln Gly Lys Gly Gln Lys Leu Cys Glu Ile Glu Arg Ile His Phe

85 90 95

Phe Leu Ser Lys Lys Lys Xaa Asp Glu Leu Arg Asn Leu His Lys Leu

100 105 110

Leu Tyr Asn Arg Pro Gly Thr Val Ser Ser Leu Lys Lys Asn Val Gly

115 120 125

Gln Phe Ser Gly Phe Pro Phe Glu Lys Gly Ser Xaa Gln Tyr Lys Lys

130 135 140

Lys Glu Glu Met Leu Lys Lys Phe Arg Asn Ala Met Leu Lys Ser Ile

145 150 155 160

Cys Glu Val Leu Asp Leu Glu Arg Ser Gly Val Asn Ser Glu Leu Val

165 170 175

Lys Arg Ile Leu Asn Phe Leu Met His Pro Lys Pro Ser Gly Lys Pro

180 185 190

Leu Pro Lys Ser Lys Lys Xaa Xaa Ser Lys Gly Ser Lys Lys Glu Arg

195 200 205

Asn Ser Ser Gly Xaa Xaa Arg Lys Xaa Lys Xaa Thr Lys Cys Pro Glu

210 215 220

Ile Leu Ser Asp Glu Ser Ser Ser Asp Glu Asp Glu Lys Lys Asn Lys

225 230 235 240

Glu Glu Ser Ser Xaa Asp Glu Xaa Lys Glu Ser Glu Glu Glu Pro Pro

245 250 255

Lys Lys Thr Xaa Lys Xaa Glu Lys Xaa Lys Gln Lys Ala Thr Xaa Lys

260 265 270

Ser Lys Lys Ser Val Lys Ser Ala Asn Val Lys Lys Ala Asp Ser Ser

275 280 285

Thr Thr Lys Lys Asn Gln Xaa Ser Ser Lys Lys Glu Ser Glu Ser Glu

290 295 300

Asp Ser Ser Asp Asp Glu Pro Leu Ile Lys Lys Leu Lys Lys Pro Pro

305 310 315 320

Thr Asp Glu Glu Leu Lys Glu Thr Xaa Lys Lys Leu Leu Ala Xaa Ala

325 330 335

Asn Leu Glu Glu Val Thr Met Lys Gln Ile Cys Lys Xaa Val Tyr Glu

340 345 350

Asn Tyr Pro Xaa Tyr Asp Leu Thr Glu Arg Lys Asp Phe Ile Lys Thr

355 360 365

Thr Val Lys Glu Leu Ile Ser

370 375

Claims

1. An application of SETD4 protein inhibitor in preparing medicine for activating dormant tumor cells is disclosed.

2. The use as claimed in claim 1 wherein the inhibitor of SETD4 protein comprises DEK protein.

3. Use according to claim 2, characterized in that the DEK protein has the conserved sequence shown in SEQ ID No. 25.

4. Use according to claim 3, characterized in that the DEK protein has an amino acid sequence of the NLS domain represented by SEQ ID No.2 which is more than 95% similar.

5. Use according to claim 3, characterized in that the DEK protein has an amino acid sequence of the SAP domain of SEQ ID No.3 which is more than 95% similar.

6. Use according to claim 3, wherein the DEK protein has more than 95% similarity to the amino acid sequence of the pseudo-SAP domain of SEQ ID No. 4.

7. Use according to claim 3, characterized in that the DEK protein has one or both of the pseudo-SAP domain of SEQ ID No.4 or the SAP domain of SEQ ID No.3 and at the same time has the NLS domain of SEQ ID No. 2.

8. Use according to one of claims 3 to 7, characterized in that the DEK protein has an amino acid sequence of SEQ ID No.1 or SEQ ID No.22 which is more than 95% similar.

9. Use according to claim 8, characterized in that the DEK protein has the amino acid sequence shown in SEQ ID No. 1.

10. Use according to claim 8, characterized in that the DEK protein has the amino acid sequence shown in SEQ ID No. 22.

11. Use according to claim 1, characterized in that said dormant tumor cells comprise cells derived from the following tumors: head and neck tumors, breast tumors, tumors of the digestive system, genitourinary system, bone and soft tissue tumors, lymphatic and hematological tumors.

12. The use of claim 11, wherein said dormant tumor cell is selected from the group consisting of brain cancer, eye cancer, ear cancer, jaw tumor, neck tumor, nasal cavity cancer, sinus cancer, nasopharyngeal cancer, gum cancer, tongue cancer, soft and hard palate cancer, maxillo cancer, orofloor cancer, oropharyngeal cancer, lip cancer, maxillary sinus cancer, cancer of the skin mucosa of the face, larynx cancer, salivary gland tumor, thyroid cancer, meningioma, ependymoma, pituitary tumor, epithelial neuroblastoma, neuroectodermal tumor, paraganglioma, lung cancer, esophageal cancer, breast cancer, mediastinal tumor, thymus cancer, stomach cancer, large intestine cancer, liver cancer, pancreatic cancer, bile duct cancer, small intestine cancer, kidney cancer, prostate cancer, bladder cancer, testicular malignancy, penis cancer, cervical cancer, uterine cancer, ovarian cancer, fallopian tube cancer, vaginal cancer, ewing's sarcoma, adipose tumor, kaposi's sarcoma, cervical cancer, cervical, Smooth muscle tumors, rhabdomyosarcoma, vascular tumors, synovial sarcoma, fibrosarcoma, bone cancer, malignant lymphoma, multiple myeloma, leukemia, heart tumor, mesothelial tumor, fibroblast tumor, trophoblastic tumor, melanoma.

13. A delivery protein for an inhibitor of SETD4 protein for activating dormant tumor cells, characterized in that the delivery protein comprises delivery of a DEK protein, the delivery DEK protein being a medically acceptable carrier containing the DEK protein.

14. The delivery protein of claim 13, characterized in that the carrier comprises exosomes, liposomes or nanomaterials.

15. The delivery protein of claim 13, characterized in that the DEK protein has a conserved sequence as set forth in SEQ ID No. 25.

16. Delivery protein according to claim 15, characterized in that the DEK protein has an amino acid sequence of the NLS domain as shown in SEQ ID No.2 which is more than 95% similar.

17. The delivery protein of claim 15, characterized in that the DEK protein has an amino acid sequence of the SAP domain as shown in SEQ ID No.3 with more than 95% similarity.

18. The delivery protein of claim 15, characterized in that said DEK protein has an amino acid sequence of the pseudo-SAP domain of SEQ ID No.4 which is more than 95% similar.

19. Delivery protein according to claim 15, characterized in that the DEK protein has one or both of the pseudo-SAP domain according to SEQ ID No.4 or the SAP domain according to SEQ ID No.3 and at the same time has the NLS domain according to SEQ ID No. 2.

20. Delivery protein according to one of claims 15 to 19, characterized in that the DEK protein has an amino acid sequence according to SEQ ID No.1 or SEQ ID No.22 with more than 95% similarity.

21. The delivery protein of claim 20, characterized in that the DEK protein has the amino acid sequence shown in SEQ ID No. 1.

22. The delivery protein of claim 20, characterized in that the DEK protein has the amino acid sequence shown in SEQ ID No. 22.

23. The delivery protein of claim 14, wherein when the vector is an exosome, the delivery of the DEK protein is by isolating an exosome containing the DEK protein from a tumor cell line culture, or by introducing a gene encoding the DEK protein into a gene expression vector, overexpressing the DEK protein in a cell line and producing an exosome containing the DEK protein.

24. The delivery protein of claim 23, wherein the DEK protein-encoding gene is incorporated into a gene expression vector to obtain an exosome containing the DEK protein is prepared by one of the following methods: (1) plasmids overexpressing the DEK protein were constructed and transfected into cell lines to make exosomes: inserting the DEK gene into EcoRI and Xba I sites of a pEGFP-C1 plasmid, and screening to obtain a recombinant plasmid pEGFP-C1-DEK; transferring the recombinant plasmid into a cell line by using a liposome transfer assistant lipo8000, collecting cell culture solution after over-expressing DEK protein, and separating and purifying an exosome solution A containing the DEK protein from the culture solution; (2) constructing lentivirus over expressing DEK protein and infecting the lentivirus with the lentivirus to construct cell strain expressing DEK protein to prepare exosome: inserting DEK genes into EcoRI and Xba I sites of a lentivirus expression vector of pLent-N-GFP respectively, and screening to obtain a recombinant lentivirus expression vector pLent-N-GFP-DEK; transfecting 293T cells with the recombinant lentivirus expression vector and the lentivirus packaging plasmid mixture together, collecting cell culture supernatant which is virus liquid after 72 hours of transfection, concentrating and purifying to obtain lentiviruses for over-expressing DEK proteins; infecting a cell line with a lentivirus overexpressing a DEK protein and constructing a cell strain overexpressing the DEK protein; collecting cell culture solution in a cell strain over-expressing DEK protein, and separating and purifying an exosome solution B containing DEK protein from the culture solution; the lentivirus packaging plasmid mixture comprises pMDL, VSVG and pRSV-Rev in a mass ratio of 5:3: 2.

25. The delivery protein of claim 23, characterized in that the cell lines comprise the following tumors: head and neck tumors, breast tumors, tumors of the digestive system, genitourinary system, bone and soft tissue tumors, lymphatic and hematological tumors.

26. The delivery protein of claim 25, wherein the cell line is selected from the group consisting of brain, eye, ear, jaw, neck, nasal cavity, sinus, nasopharynx, gingiva, tongue, soft and hard palate, jaw, orofloor, oropharynx, lip, maxillary sinus, facial skin mucosa, laryngeal, salivary gland, thyroid, meningioma, ependymoma, pituitary tumor, epithelial neuroblastoma, neuroectodermal tumor, paraganglioma, lung, esophageal, breast, mediastinal, thymus, stomach, large intestine, liver, pancreas, bile duct, small intestine, kidney, prostate, bladder, testicular malignancy, penis, cervix, uterus, ovary, fallopian tube, vagina, ewing's sarcoma, adipose, kaposi's sarcoma, smooth muscle tumor, cervical cancer, vaginal cancer, ewing's sarcoma, fatty tumor, kaposi's sarcoma, smooth muscle tumor, cervical cancer, cervical, Rhabdomyosarcoma, vascular tumor, synovial sarcoma, fibrosarcoma, osteocarcinoma, malignant lymphoma, multiple myeloma, leukemia, heart tumor, mesothelial tumor, fibroblast tumor, trophoblastic tumor, and melanoma.

27. The delivery protein of claim 14, wherein when the carrier is a liposome, the DEK protein-containing liposome is prepared by a membrane hydration method comprising: dissolving dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidyl acetamide-methoxy polyethylene glycol in chloroform, performing reduced pressure rotary evaporation to obtain a uniform film, completely volatilizing residual chloroform in vacuum overnight, adding a PBS solution containing DEK protein, performing ice bath at 25KHz and ultrasonic treatment for 20min to make liposome membrane fall off, and shaking on an oscillator to fully hydrate to form turbid liquid; then, carrying out ultrasonic treatment on the turbid liquid at the power of 135W for 30min to obtain liposome suspension; ultrafiltering with 10kD ultrafiltering tube at 12000g rotation speed at 4 deg.C, taking out every five minutes, blowing and beating once, supplementing PBS, washing off free protein, and collecting retentate to obtain DEK protein-containing liposome suspension.

28. The delivery protein of claim 27, characterized in that the mass ratio of dipalmitoylphosphatidylcholine to cholesterol is 1:0.1, the mass ratio of dipalmitoylphosphatidylcholine to distearoylphosphatidylacetamide-methoxypolyethylene glycol is 1:0.1, and the volume of chloroform employed is 0.1mL/mg by mass of dipalmitoylphosphatidylcholine; the mass ratio of DEK protein in the PBS solution of dipalmitoyl phosphatidylcholine to DEK protein is 1: 0.2.

29. The delivery protein of claim 14, wherein when the carrier is a nanomaterial, the nanomaterial comprising DEK protein is prepared by a modified solvent evaporation method comprising: transferring the DEK protein in PBS solution into a dichloromethane solution of polylactic acid-glycolic acid copolymer, carrying out ultrasonic treatment at 25KHz for 1 minute to form colostrum, transferring the colostrum into a polyvinyl alcohol aqueous solution with the volume concentration of 1%, carrying out ultrasonic treatment at 25KHz for 5 minutes to form multiple emulsion, stirring for 4 hours, after the organic solvent is volatilized, centrifuging at 18000r/min to collect precipitate, and freeze-drying the precipitate at-55 ℃ for 24 hours to obtain the PLGA nano material containing the DEK protein.

30. The delivery protein of claim 29, wherein the mass ratio of DEK protein to poly (lactic-co-glycolic acid) copolymer in PBS solution of DEK protein is 1:0.1, and the volume dosage of the polyvinyl alcohol aqueous solution is 1mL/mg based on the mass of the DEK protein in the PBS solution of the DEK protein.

31. An application of an SETD4 protein inhibitor in preparing a reagent for activating dormant tumor cells.

32. Use according to claim 31, wherein the agent comprises a DEK protein.

33. The use according to claim 32, wherein the DEK protein has the conserved sequence as shown in SEQ ID No. 25.

34. Use according to claim 33, characterized in that the DEK protein has an amino acid sequence of the NLS domain as shown in SEQ ID No.2 which is more than 95% similar.

35. The use according to claim 33, wherein the DEK protein has an amino acid sequence of the SAP domain of SEQ ID No.3 which is more than 95% similar.

36. The use of claim 33, wherein said DEK protein has greater than 95% similarity to the amino acid sequence of the pseudo-SAP domain of SEQ ID No. 4.

37. Use according to claim 33, characterized in that the DEK protein has one or both of the pseudo-SAP domain of SEQ ID No.4 or the SAP domain of SEQ ID No.3 and at the same time has the NLS domain of SEQ ID No. 2.

38. Use according to one of claims 33 to 37, characterized in that the DEK protein has an amino acid sequence according to SEQ ID No.1 or SEQ ID No.22 which is more than 95% similar.

39. The use as claimed in claim 38 wherein the DEK protein has the amino acid sequence shown in SEQ ID No. 1.

40. The use as claimed in claim 38 wherein the DEK protein has the amino acid sequence shown in SEQ ID No. 22.

41. The use according to claim 31, wherein said use comprises delivering an inhibitor of the SETD4 protein to the dormant tumor cell for the purpose of activating the dormant tumor cell.

42. The use according to claim 31, wherein said tumor cells comprise cells derived from: head and neck tumors, breast tumors, tumors of the digestive system, genitourinary system, bone and soft tissue tumors, lymphatic and hematological tumors.

43. The use of claim 42, wherein said tumor cell is selected from the group consisting of brain, eye, ear, jaw, neck, nasal cavity, sinus, nasopharynx, gingiva, tongue, soft and hard palate, maxilla, orofloor, oropharynx, lip, maxillary sinus, facial skin mucosa, laryngeal, salivary gland, thyroid, meningioma, ependymoma, pituitary, epithelial neuroblastoma, neuroectodermal, paraganglionic, lung, esophageal, breast, mediastinal, thymus, stomach, large intestine, liver, pancreas, bile duct, small intestine, kidney, prostate, bladder, testicular malignancy, penis, cervix, uterus, ovary, fallopian tube, vagina, Ewing's sarcoma, adipose, Kaposi's sarcoma, smooth muscle, cervical, esophageal, cervical, fatty tumors, Kaposi's sarcoma, smooth muscle tumors, cervical, or cervical, or cervical cancer, or/or cervical cancer, or/or, Rhabdomyosarcoma, vascular tumor, synovial sarcoma, fibrosarcoma, osteocarcinoma, malignant lymphoma, multiple myeloma, leukemia, heart tumor, mesothelial tumor, fibroblast tumor, trophoblastic tumor, and melanoma.

44. The use according to any one of claims 32 to 37 or 39 to 43, wherein the agent comprises an SETD4 protein inhibitor and a drug for the elimination of tumor cells.

45. The use according to claim 44, wherein said tumor cell-removing agent comprises paclitaxel or 5-fluorouracil.

46. An application of an SETD4 protein inhibitor in preparing an anti-tumor medicament is characterized in that the anti-tumor medicament comprises the SETD4 protein inhibitor and a medicament for eliminating tumor cells.

47. The use according to claim 46, wherein the SETD4 protein inhibitor comprises a DEK protein.

48. The use according to claim 47, wherein the DEK protein has the conserved sequence as shown in SEQ ID No. 25.

49. The use according to claim 48, wherein the DEK protein has an amino acid sequence of the NLS domain of SEQ ID No.2 which is more than 95% similar.

50. The use according to claim 48, wherein the DEK protein has an amino acid sequence of the SAP domain of SEQ ID No.3 that is more than 95% similar.

51. The use according to claim 48, wherein said DEK protein has more than 95% similarity to the amino acid sequence of the pseudo-SAP domain of SEQ ID No. 4.

52. Use according to claim 48, characterized in that the DEK protein has one or both of the pseudo-SAP domain according to SEQ ID No.4 or the SAP domain according to SEQ ID No.3 and at the same time has the NLS domain according to SEQ ID No. 2.

53. Use according to one of claims 47 to 52, characterized in that the DEK protein has an amino acid sequence according to SEQ ID No.1 or SEQ ID No.22 which is more than 95% similar.

54. The use according to claim 53, wherein the DEK protein has the amino acid sequence shown in SEQ ID No. 1.

55. The use according to claim 53, wherein the DEK protein has the amino acid sequence shown in SEQ ID No. 22.

56. The use according to claim 46, wherein said tumor cell-removing agent comprises paclitaxel or 5-fluorouracil.

57. The use of claim 46, wherein said tumor comprises a tumor of the head and neck, a tumor of the chest, a tumor of the digestive system, a tumor of the urogenital system, a tumor of bone and soft tissue, a tumor of the lymphatic and blood systems.

58. The use of claim 57, wherein the tumor comprises brain cancer, eye cancer, ear cancer, jaw cancer, neck cancer, nasal cavity cancer, sinus cancer, nasopharyngeal cancer, gum cancer, tongue cancer, soft and hard palate cancer, maxilla cancer, orofloor cancer, oropharyngeal cancer, lip cancer, maxillary sinus cancer, cancer of the facial skin mucosa, cancer of the throat, salivary gland, thyroid cancer, meningioma, ependymoma, pituitary tumor, epithelial neuroblastoma, neuroectodermal tumor, paraganglionic tumors, lung cancer, esophageal cancer, breast cancer, mediastinal tumor, thymus cancer, stomach cancer, large intestine cancer, liver cancer, pancreatic cancer, bile duct cancer, small intestine cancer, kidney cancer, prostate cancer, bladder cancer, testicular malignancy, penile cancer, cervical cancer, uterine cancer, ovarian cancer, fallopian tube cancer, vaginal cancer, Ewing's sarcoma, adipose tumor, Kaposi's sarcoma, smooth muscle tumor, cervical cancer, rhabdomyosarcoma, vascular tumor, synovial sarcoma, fibrosarcoma, osteocarcinoma, malignant lymphoma, multiple myeloma, leukemia, heart tumor, mesothelial tumor, fibroblast tumor, trophoblastic tumor, and melanoma.

59. A method of treating a tumor with an inhibitor of SETD4 protein, said method comprising: in tumor patients at various stages, the SETD4 protein inhibitor is delivered into tumors by intravenous injection, intraperitoneal injection or intrabody injection of the SETD4 protein inhibitor, so that dormant tumor cells are activated, and the dormant tumor cells are killed and thoroughly eliminated under the action of clinical operation, radiotherapy, chemotherapy, targeting or immunization, and the clinical tumor healing without metastasis and recurrence is realized.

60. The method of claim 59, wherein the SETD4 protein inhibitor comprises a DEK protein.

61. The method of claim 60, wherein said DEK protein has a conserved sequence as set forth in SEQ ID No. 25.

62. The method of claim 61, wherein the DEK protein has greater than 95% similarity to the amino acid sequence of the NLS domain of SEQ ID No. 2.

63. The method of claim 61, wherein said DEK protein has greater than 95% similarity to the amino acid sequence of the SAP domain of SEQ ID No. 3.

64. The method of claim 61, wherein said DEK protein has greater than 95% similarity to the amino acid sequence of the pseudo-SAP domain of SEQ ID No. 4.

65. The method of claim 61, wherein said DEK protein has one or both of the pseudo-SAP domain of SEQ ID No.4 or the SAP domain of SEQ ID No.3, and at the same time has the NLS domain of SEQ ID No. 2.

66. The method according to any one of claims 61 to 65, wherein the DEK protein has an amino acid sequence as set forth in SEQ ID No.1 or SEQ ID No.22 which is more than 95% similar.

67. The method of claim 66, wherein the DEK protein has the amino acid sequence set forth in SEQ ID No. 1.

68. The method of claim 66, wherein the DEK protein has the amino acid sequence set forth in SEQ ID No. 22.

69. The method of claim 59, wherein the DEK protein is injected in the form of a delivered DEK protein, which is an exosome, liposome or nanomaterial comprising DEK protein.

70. The method of claim 59, wherein said tumor comprises a tumor of the head and neck, a tumor of the chest, a tumor of the digestive system, a tumor of the urogenital system, a tumor of bone and soft tissue, a tumor of the lymphatic and blood systems.

71. The method of claim 70, wherein said tumor comprises brain cancer, eye cancer, ear cancer, jaw cancer, neck cancer, nasal cavity cancer, sinus cancer, nasopharyngeal cancer, gum cancer, tongue cancer, soft and hard palate cancer, maxilla cancer, orofloor cancer, oropharyngeal cancer, lip cancer, maxillary sinus cancer, cancer of the facial skin mucosa, cancer of the throat, salivary gland, thyroid cancer, meningioma, ependymoma, pituitary tumor, epithelial neuroblastoma, neuroectodermal tumor, paraganglionic tumors, lung cancer, esophageal cancer, breast cancer, mediastinal tumor, thymus cancer, stomach cancer, large intestine cancer, liver cancer, pancreatic cancer, bile duct cancer, small intestine cancer, kidney cancer, prostate cancer, bladder cancer, testicular malignancy, penile cancer, cervical cancer, uterine cancer, ovarian cancer, fallopian tube cancer, vaginal cancer, Ewing's sarcoma, adipose tumor, Kaposi's sarcoma, smooth muscle tumor, cervical cancer, rhabdomyosarcoma, vascular tumor, synovial sarcoma, fibrosarcoma, osteocarcinoma, malignant lymphoma, multiple myeloma, leukemia, heart tumor, mesothelial tumor, fibroblast tumor, trophoblastic tumor, and melanoma.