CN113136443A - Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis - Google Patents
Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis Download PDFInfo
- Publication number
- CN113136443A CN113136443A CN202110501851.4A CN202110501851A CN113136443A CN 113136443 A CN113136443 A CN 113136443A CN 202110501851 A CN202110501851 A CN 202110501851A CN 113136443 A CN113136443 A CN 113136443A
- Authority
- CN
- China
- Prior art keywords
- bacillus cereus
- bacillus
- bacillus thuringiensis
- genome
- cereus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis. The invention collects public database and Bacillus cereus group strain genome in earlier research as much as possible, carries out authenticity confirmation analysis on the classification information of the existing strains, utilizes a genome comparison and genome generalization method to excavate the distinguishable targets of Bacillus cereus and Bacillus thuringiensis in the public database, utilizes the group of experimental strain verification and screening to distinguish the characteristic molecular targets of the Bacillus cereus and the Bacillus thuringiensis, comprises the steps of selecting different SNP sites in the molecular target ispD gene sequence to design primers, screening primer pairs, respectively using the Bacillus cereus and the Bacillus thuringiensis as templates to carry out HRM experiments, obtaining the characteristic melting curve information of the corresponding strains, and realizing the accurate identification of the Bacillus cereus and the Bacillus thuringiensis.
Description
The technical field is as follows:
the invention belongs to the field of microbial detection, and particularly relates to a nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis through a high-resolution melting curve.
Background art:
bacillus cereus and Bacillus thuringiensis belong to the same Bacillus cereus group. Wherein, the bacillus cereus is a common food-borne conditioned pathogen in China and can produce diarrhea (enterotoxin) toxin and vomit toxin. During the period from 2008 to 2015, bacillus cereus is ranked the third in the prevalence rate of food-borne pathogenic bacteria in China, and is highly harmful. Bacillus thuringiensis is a type of insect pathogen. It forms spores while forming one or more parasporal crystals, and its main component is insecticidal crystal protein, and thus it is widely used as a biopesticide. The physiological and biochemical characteristics of bacillus cereus and bacillus thuringiensis are highly similar, and the only difference which can be used for distinguishing is the generation capacity of parasporal crystals. In addition, the two have high genetic similarity, the 16S rRNA sequences have 99% -100% similarity, the value of dDDH (digital DNA-DNA hybridization) is more than 70% of the species division threshold value, the ANI value is more than 95% of the species division threshold value, and the values are all higher than the standard value of population identification and are extremely difficult to distinguish. Because a molecular rapid detection and identification method for effectively distinguishing bacillus cereus and bacillus thuringiensis is not available in the world, misjudgment can be caused during identification, and great potential safety hazards are brought to food safety and industry. Therefore, there is a need to establish a method for accurately distinguishing between bacillus cereus and bacillus thuringiensis.
At present, the method capable of distinguishing the bacillus cereus from the bacillus thuringiensis is still a traditional biochemical method and is also a national standard method for FDA (food and drug administration) food microorganism safety detection in China and America. According to this method, Bacillus thuringiensis is cultured for 4-5 days to produce protein crystals (parasporal crystals), while other Bacillus bacteria do not produce protein crystals. The process is time consuming and if free spores are not formed sufficiently, the culture is allowed to stand at room temperature for a further 2-3 days for a second examination. In addition, the method is greatly influenced by subjective judgment of observers, misjudgment is possibly generated, and timeliness and operability are not achieved in the actual detection process. In recent years, with the continuous development of high-throughput sequencing technology, the differential identification of bacillus cereus and bacillus thuringiensis can be realized based on the typing and comparison of genome information, but the method needs DNA extraction, second-generation sequencing, downstream informatics analysis and the like, has high time consumption, cost and operation requirements, and cannot meet the requirements of routine use in laboratories, high-throughput rapid detection identification and basic level detection.
Korean researchers have discovered a novel target XRE that can be used to identify and distinguish bacillus thuringiensis from bacillus kindred. Compared with the existing parasporal crystallin gene target cry2, the XRE gene has higher accuracy in the identification of Bacillus thuringiensis. The XRE PCR result shows that neither Bacillus cereus nor Bacillus cereus is amplified, the real-time PCR method established by XRE can be used for identifying the Bacillus thuringiensis, and the established standard curve can be used for quantifying the cell number. However, this target fails to detect both bacillus thuringiensis and bacillus cereus simultaneously and fails to provide a more intuitive and visual approach. Therefore, a new molecular method for rapidly and accurately identifying the two is urgently needed to be established.
High-resolution melting (HRM) is an analytical method that has recently emerged abroad, and is an analytical technique for detecting genetic variation and typing by detecting single-base differences in target fragments based on PCR technology. The method is not limited by base mutation sites and types, does not need a specific probe, and can finish the analysis of Single Nucleotide Polymorphism (SNP), methylation, match type and the like of a sample by directly running high-resolution melting after the PCR is finished. Compared with other molecular typing diagnosis methods, the HRM has the advantages of simple and rapid operation, low cost, high sensitivity and good specificity, and realizes real closed-tube operation. The HRM method is receiving general attention and has been applied to various fields including food safety, environmental monitoring, clinical diagnosis, biological defense and the like, and plays an important role in identification of bacteria, drug susceptibility test, identification of drugs, disease diagnosis and the like.
The invention content is as follows:
the first purpose of the invention is to provide a new molecular target ispD, which encodes 2-C-methyl-D-erythritol-4-phosphocystine transferase (2-C-methyl-D-erythrol-4-phosphate cydylyltransferase), and the target gene is used for distinguishing Bacillus cereus from Bacillus thuringiensis, the application is non-disease and treatment purpose, and the effective distinguishing of the two strains can be carried out in the fields of environment, food and production chain thereof, clinic and the like. The nucleotide sequence of the molecular target ispD is shown as SEQ ID NO:1 (corresponding to bacillus cereus) or a nucleotide sequence shown as SEQ ID NO:2 (corresponding to Bacillus thuringiensis).
The second purpose of the invention is to provide a primer pair for distinguishing bacillus cereus from bacillus thuringiensis, which is designed according to a nucleotide sequence (corresponding to bacillus cereus) shown in SEQ ID NO.1, and the primer pair is effectively distinguished by utilizing SNP sites based on an HRM method, wherein an amplification product in the bacillus cereus is the nucleotide sequence shown in SEQ ID NO.3, and an amplification product in the bacillus thuringiensis is the nucleotide sequence shown in SEQ ID NO. 4.
The primer pairs are shown as follows:
5’-AACGAAGAAGAACGCCCGTA-3’；
5’-TCTTGTCTTTCGGCTCCACC-3’。
the third purpose of the invention is to provide a nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis, which comprises the following steps:
extracting the genome DNA of a sample to be detected, taking the genome DNA as a template, taking the primer pair as an amplification primer, and effectively distinguishing the bacillus cereus and the bacillus thuringiensis by using a high-resolution melting curve method through different characteristic melting curves of the bacillus cereus and the bacillus thuringiensis.
The PCR reaction system of the method using the high-resolution melting curve comprises: 2x HRMAnalysis PreMix, sample DNA to be detected, a primer pair and sterilized double distilled water.
The PCR reaction system is as follows: 10 mu L of 2x HRMAnalysis PreMix reaction buffer solution, 50ng of detection sample DNA, 0.6 mu L of 10 mu M upstream primer and 10 mu M downstream primer respectively, and sterilized double distilled water to make up the volume to 20 mu L.
The method for using the high-resolution melting curve adopts a two-step reaction program to carry out reaction on LightCycler96, and the PCR reaction program comprises the following steps: pre-denaturation at 95 ℃ for 2min, one cycle; denaturation at 95 ℃ for 10 s; annealing and extending for 30min at 60 ℃, and circulating for 40 cycles; the high resolution melting curve reaction program was: denaturation at 95 ℃ for 1min, renaturation at 40 ℃ for 1min, starting the program at an initial melting temperature of 65 ℃, heating to melt to 97 ℃ at the rate of 0.07 ℃/s, and monitoring the fluorescence signal in real time at 15 reading/DEG C in the process.
The fourth purpose of the invention is to provide a method for accurately screening and distinguishing new molecular targets of bacillus cereus and bacillus thuringiensis, which comprises the following steps:
(1) the bacillus cereus group strains in the database comprise bacillus cereus and bacillus thuringiensis genome downloading, redundancy elimination and genome annotation by applying Prokka software;
(2) and (3) authenticity confirmation analysis of genome classification information of the bacillus cereus group strains: average nucleotide homology Analysis (ANI), taking a reference strain of the existing international current bacillus cereus flora or closely related species as a standard strain of the bacillus cereus flora, comparing and analyzing the similarity of the unknown strain and the whole genome of the standard strain, selecting the strain with the highest similarity to the standard strain, and preliminarily considering that the unknown strain is the species;
(3) and (3) authenticity confirmation analysis of genome classification information of the bacillus cereus group strains: and (3) carrying out ribosomal protein multi-site sequence typing (rMLST) analysis by using Phyllosuite software, extracting ribosomal protein genes, connecting the ribosomal protein genes in series, and constructing a maximum likelihood tree to further confirm the species identity of the related strains.
(4) Screening for new molecular targets that distinguish between bacillus cereus and bacillus thuringiensis: and performing pan-genome analysis on the obtained bacillus cereus and bacillus thuringiensis with real Identity information by applying Roary software, setting a threshold (Identity) to be 95%, and selecting core genes of the bacillus cereus and the bacillus thuringiensis which can be separated at the 95% threshold as potential molecular targets.
The invention collects public database and Bacillus cereus group strain genome in earlier research as much as possible, carries out authenticity confirmation analysis on the classification information of the existing strains, utilizes a genome comparison and genome generalization method to excavate the distinguishable targets of Bacillus cereus and Bacillus thuringiensis in the public database, utilizes the group of experimental strain verification and screening to distinguish the characteristic molecular targets of the Bacillus cereus and the Bacillus thuringiensis, comprises the steps of selecting different SNP sites in the molecular target ispD gene sequence to design primers, screening primer pairs, respectively using the Bacillus cereus and the Bacillus thuringiensis as templates to carry out HRM experiments, obtaining the characteristic melting curve information of the corresponding strains, and realizing the accurate identification of the Bacillus cereus and the Bacillus thuringiensis.
The invention carries out sequence comparison on ispD genes, selects SNP loci to design primers and screens so as to realize the detection of the SNP loci, thereby effectively identifying the bacillus cereus and the bacillus thuringiensis. The invention is based on a high-resolution melting curve method, does not need a sequence specific probe, adopts an HRM analysis kit (EvaGreen) (purchased from TIANGEN), utilizes novel saturated dye, has antibody-modified hot-start DNA polymerase, has high amplification efficiency, high amplification specificity and wide credible range, further increases the stability of the melting curve, improves the amplification specificity, has the advantages of high sensitivity, good specificity, low cost, high detection speed and the like, has high resolution, can distinguish the change of a single base, simultaneously finishes all reactions in a closed reaction tube, and effectively avoids cross contamination.
Drawings
FIG. 1 is a phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on rMLST;
FIG. 2 is a phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on the ispD gene full sequence;
FIG. 3 is a phylogenetic tree analysis of Bacillus cereus and Bacillus thuringiensis based on ispD gene amplicon sequences;
FIG. 4 is the HRM melting curve results for the identification of Bacillus cereus ATCC 14579 and Bacillus thuringiensis ATCC10792 based on ispD gene amplicons, wherein A, B is a normalized melting peak plot and melting curve, respectively;
FIG. 5 is a graph of the HRM increase for Bacillus cereus and Bacillus thuringiensis, wherein A, B is a normalized melting peak plot and a melting curve, respectively;
FIG. 6 is a graph of specificity identification for differentiating Bacillus cereus and Bacillus thuringiensis based on HRM method, wherein A, B is normalized melting peak diagram and melting curve obtained from different standard strains;
FIGS. 7 and 8 are sensitivity tests for identifying Bacillus cereus and Bacillus thuringiensis based on HRM method, wherein A, B in FIGS. 7 and 8 are respectively normalized melting peak diagram and melting curve, C, D in FIG. 7 is respectively correlation analysis of genomic DNA concentration and fluorescence intensity of Bacillus cereus and Bacillus thuringiensis, and C, D in FIG. 8 is respectively correlation analysis of number of Bacillus cereus in unit volume and Bacillus thuringiensis and fluorescence intensity in unit volume.
Detailed Description
The present invention will be described in detail below with reference to specific embodiments and the accompanying drawings.
Example 1:
1. based on GenBank bacillus cereus group or kindred species genome and the existing bacillus cereus and bacillus thuringiensis, carrying out genome downloading, removing redundant genome data which do not meet the analysis requirement (contigs is more than or equal to 200), modifying the genome name, and carrying out genome annotation by using Prokka software; and (3) authenticity confirmation analysis of genome classification information of the bacillus cereus group strains: average nucleotide homology Analysis (ANI), taking 25 reference strains (table 1) of the existing international current bacillus cereus flora or closely related species as standard strains of the bacillus cereus flora, comparing and analyzing the similarity of the unknown strains and the whole genome of the standard strains, selecting the strains with the highest similarity to the standard strains, and preliminarily considering that the unknown strains are the strains; the analysis of ribosomal protein multi-site sequence typing (rMLST) was performed using Phyllosuite software, 53 ribosomal protein genes (Table 2) were extracted and connected in series for maximum likelihood tree construction. The strain with the consistent evolutionary relationship and ANI analysis result is the bacillus cereus or bacillus thuringiensis with clear identity (figure 1). As shown in fig. 1, different colors represent different bacillus, and bacillus cereus and bacillus thuringiensis strains can be effectively distinguished based on the rMLST method. Screening for new molecular targets that distinguish between bacillus cereus and bacillus thuringiensis: the acquired bacillus cereus and bacillus thuringiensis with real Identity information are subjected to genome-wide analysis by applying Roary software, a threshold (Identity) is set to be 95%, core genes of the bacillus cereus and the bacillus thuringiensis which can be separated at the 95% threshold are selected as potential molecular targets ispD, nucleotide sequences are shown as follows, SEQ ID No.1 is an ispD nucleotide sequence of the bacillus cereus (such as bacillus cereus ATCC 14579), and SEQ ID No. 2 is an ispD nucleotide sequence of the bacillus thuringiensis (such as bacillus thuringiensis ATCC 10792).
SEQ ID No:1
atgtatacattaattattccggcagcgggccaaggaaaacgaatgggtgctggtaaaaataagttatttttacttatagatgaagtaccaattattgtgcacacattgcgtgcttttgaaaaagataaagcgtgcaaaagtattattatggcaattaacgaagaagaacgcccgtattttgaagagttaatgcagaagtaccagattgaaaagcacgtacaattcattcagggtggagccgaaagacaagatagcgtctataacgcacttcagtatgcgagtggtgtcgaatatgttcttgtgcatgacggggcgcgcccgttcgtaacgaataaagtgattcgcgatgtattaactgcagcagaaaaatatggagcttccatttgtgcagtgccagtaaaagatactgttaagaaagtagagcagggtgttgttgtagaaacggtagagcgatctcaacttaacgctgtacaaacaccacaaggattctctgtttctcttttgctagaagctcatagaagcgcaaagcaaagttgttttcttggcacagatgatgcaagtcttgtagaacgtgttgggaagcaagtaggtgtagtagaggggagttactataatattaaagtgacgactccggaagatctattaattgctgaaagtttcctacgtgttcaaaagaaataa
SEQ ID No:2
atgtatacattaattattccggcagccggccaaggaaagcggatgggtgctggcaaaaataagttgttcttacttataaatgaagtaccgattatcgttcatacattacgtgcttttgaaagagataaagcgtgcaaaagtattgttatggcaattaacgaagaggaacgcccgtattttgaagaattaatgcagaagtatccgattgaaaaacaggtacaatttattcagggtggagccgaaagacaagatagtgtatataacgcgattcagcatgcgagtgatgttgaatacgttcttgtacatgacggagcgcgcccattcgtaacgaataaagtgattcaagatgtattaacagcagcagaaaaatatggagcttccatttgtgcagtgccagtaaaggatacagttaagaaggtagagcaaggtgttgttgtcgaaacggtagaacgatctcagcttaaggctgtacaaacaccgcaagggttctctgtttctcttttgctagaagctcatagaagtgcaaaacagagctgttttcttggtacagatgatgcaagtctcgtggaacgtattggaaagcaagtaggtgtagtagaagggagttactataatattaaagtgacgactccagaggatttactaattgctgaaagtttccttcatgttctgaaaaaatag
SEQ ID No:3
aacgaagaagaacgcccgtattttgaagagttaatgcagaagtaccagattgaaaagcacgtacaattcattcagggtggagccgaaagacaaga
SEQ ID No:4
aacgaagaggaacgcccgtattttgaagaattaatgcagaagtatccgattgaaaaacaggtacaatttattcagggtggagccgaaagacaaga
TABLE 1 International 25 reference strains of the current Bacillus cereus flora or closely related species
TABLE 253 ribosomal protein genes
2. By referring to the gene sequences of bacillus cereus and bacillus thuringiensis provided in GenBank and completed by the existing sequencing, a differential gene ispD is excavated by comparing the whole genome sequence, and a primer is designed based on the SNP locus obtained by comparing the gene sequences.
The specific primers are as follows:
F：5’-AACGAAGAAGAACGCCCGTA-3’；
R：5’-TCTTGTCTTTCGGCTCCACC-3’。
the primer pair is used for amplification, wherein an amplification product in the bacillus cereus is a nucleotide sequence shown in SEQ ID NO.3, and an amplification product in the bacillus thuringiensis is a nucleotide sequence shown in SEQ ID NO. 4.
3. Extracting genomic DNA from 1mL Bacillus cereus ATCC 14579 culture solution and 1mL Bacillus thuringiensis ATCC10792 culture solution respectively by using bacterial DNA kit (Meiji organism) according to the instructionTMNanoDropTMAnd detecting the concentration and purity of the genome DNA by using an One ultramicro ultraviolet-visible spectrophotometer.
4. In order to preliminarily explore the identification effect of the designed primers on the bacillus cereus and the bacillus thuringiensis, phylogenetic tree analysis (figure 2 and figure 3) is carried out based on the ispD gene and the amplicon thereof, the phylogenetic tree analysis is carried out according to an adjacent approach, and the differential gene ispD obtained from the figure 2 and the figure 3 can effectively distinguish the bacillus cereus and the bacillus thuringiensis strains. The PCR amplification of the strain is carried out by using the designed primer (in the step 2), and the specific steps are as follows:
preparing an ispD gene forward primer solution and a reverse primer solution with the concentration of 10 mu M by using sterile water, wherein the sequence of the ispD gene forward primer is as follows: AACGAAGAAGAACGCCCGTA, respectively; sequence of ispD gene reverse primer: TCTTGTCTTTCGGCTCCACC, respectively;
sequentially adding 2x HRMAnalysis PreMix 10 mu L and ispD gene forward primer solution 0.6 mu L, ispD gene reverse primer solution 0.6 mu L into each reaction hole of the eight-link pipe, then respectively adding genomic DNA50ng and sterile water serving as negative control into different reaction holes, and supplementing each reaction hole to 20 mu L by using the sterile water; performing reaction on LightCycler96 by using a two-step reaction program, wherein the PCR reaction condition is pre-denaturation at 95 ℃ for 2min for one cycle; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 30min, and circulating for 40 cycles; HRM reaction conditions: denaturation at 95 ℃ for 1min, renaturation at 40 ℃ for 1min, starting the program at an initial melting temperature of 65 ℃, heating to melt to 97 ℃ at the rate of 0.07 ℃/s, and monitoring the fluorescence signal in real time at 15 reading/DEG C in the process.
The LightCycler96 software is used for analyzing the result of the high-resolution melting curve, and the result shows that the melting curve based on the gene ispD can achieve a good distinguishing effect on the bacillus cereus and the bacillus thuringiensis, as shown in figure 4, the result is consistent with the result of phylogenetic tree analysis, and the feasibility of distinguishing the bacillus cereus and the bacillus thuringiensis by utilizing the primer pair based on HRM is verified theoretically.
5. Increasing the strain numbers (table 3) of bacillus cereus and bacillus thuringiensis based on ispD gene to detect, sequentially adding 2x HRM Analysis PreMix 10 muL and ispD gene forward primer solution 0.6 mu L, ispD gene reverse primer solution 0.6 muL into each reaction hole of the eight-way tube, then respectively adding 50ng of sample genome DNA to be detected and sterile water as negative control into different reaction holes, and supplementing each reaction hole to 20 muL by sterile water; performing reaction on LightCycler96 by using a two-step reaction program, wherein the PCR reaction condition is pre-denaturation at 95 ℃ for 2min for one cycle; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 30min, and circulating for 40 cycles; HRM reaction conditions: denaturation at 95 ℃ for 1min, renaturation at 40 ℃ for 1min, starting the program at an initial melting temperature of 65 ℃, heating to melt to 97 ℃ at the rate of 0.07 ℃/s, and monitoring the fluorescence signal in real time at 15 reading/DEG C in the process. The HRM results were analyzed using LightCycler96 software, and as shown in fig. 5, bacillus cereus and bacillus thuringiensis obtained different characteristic melting curves effectively distinguished between them.
TABLE 3 high resolution melting curve verification of experimental strain information
6. After bacillus cereus and bacillus thuringiensis are accurately identified, specificity detection is carried out on other standard strain bacteria according to the HRM method in the step 5 based on ispD genes, and the standard strain adopted in the experiment is introduced in the table 4, so that the identification of the bacillus cereus and the bacillus thuringiensis can be effectively realized (figure 6), and the specificity is good. Simultaneously, carrying out sensitivity detection by using different template amounts and establishing a standard curve when the concentration range of the genomic DNA is 10-7g-10-12g, the detection can be effectively carried out, namely the detection limit of the method can reach 1pg (figure 7); when the colony count of different unit volumes is detected, the linear detection range of the method for the bacillus cereus is 3.7 multiplied by 102cfu/mL-3.7×108cfu/mL, linear detection range of Bacillus thuringiensis is 3.3 multiplied by 102cfu/mL-3.3×108cfu/mL (FIG. 8).
TABLE 4 high resolution melting curve experiment standard strain information
Sequence listing
<110> institute of microbiology, academy of sciences of Guangdong province (center for microbiological analysis and detection of Guangdong province)
<120> nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 681
<212> DNA
<213> Bacillus cereus (Bacillus cereus)
<400> 1
atgtatacat taattattcc ggcagcgggc caaggaaaac gaatgggtgc tggtaaaaat 60
aagttatttt tacttataga tgaagtacca attattgtgc acacattgcg tgcttttgaa 120
aaagataaag cgtgcaaaag tattattatg gcaattaacg aagaagaacg cccgtatttt 180
gaagagttaa tgcagaagta ccagattgaa aagcacgtac aattcattca gggtggagcc 240
gaaagacaag atagcgtcta taacgcactt cagtatgcga gtggtgtcga atatgttctt 300
gtgcatgacg gggcgcgccc gttcgtaacg aataaagtga ttcgcgatgt attaactgca 360
gcagaaaaat atggagcttc catttgtgca gtgccagtaa aagatactgt taagaaagta 420
gagcagggtg ttgttgtaga aacggtagag cgatctcaac ttaacgctgt acaaacacca 480
caaggattct ctgtttctct tttgctagaa gctcatagaa gcgcaaagca aagttgtttt 540
cttggcacag atgatgcaag tcttgtagaa cgtgttggga agcaagtagg tgtagtagag 600
gggagttact ataatattaa agtgacgact ccggaagatc tattaattgc tgaaagtttc 660
ctacgtgttc aaaagaaata a 681
<210> 2
<211> 681
<212> DNA
<213> Bacillus thuringiensis (Bacillus thuringiensis)
<400> 2
atgtatacat taattattcc ggcagccggc caaggaaagc ggatgggtgc tggcaaaaat 60
aagttgttct tacttataaa tgaagtaccg attatcgttc atacattacg tgcttttgaa 120
agagataaag cgtgcaaaag tattgttatg gcaattaacg aagaggaacg cccgtatttt 180
gaagaattaa tgcagaagta tccgattgaa aaacaggtac aatttattca gggtggagcc 240
gaaagacaag atagtgtata taacgcgatt cagcatgcga gtgatgttga atacgttctt 300
gtacatgacg gagcgcgccc attcgtaacg aataaagtga ttcaagatgt attaacagca 360
gcagaaaaat atggagcttc catttgtgca gtgccagtaa aggatacagt taagaaggta 420
gagcaaggtg ttgttgtcga aacggtagaa cgatctcagc ttaaggctgt acaaacaccg 480
caagggttct ctgtttctct tttgctagaa gctcatagaa gtgcaaaaca gagctgtttt 540
cttggtacag atgatgcaag tctcgtggaa cgtattggaa agcaagtagg tgtagtagaa 600
gggagttact ataatattaa agtgacgact ccagaggatt tactaattgc tgaaagtttc 660
cttcatgttc tgaaaaaata g 681
<210> 3
<211> 95
<212> DNA
<213> Bacillus cereus (Bacillus cereus)
<400> 3
aacgaagaag aacgcccgta ttttgaagag ttaatgcaga agtaccagat tgaaaagcac 60
gtacaattca ttcagggtgg agccgaaaga caaga 95
<210> 4
<211> 95
<212> DNA
<213> Bacillus thuringiensis (Bacillus thuringiensis)
<400> 4
aacgaagagg aacgcccgta ttttgaagaa ttaatgcaga agtatccgat tgaaaaacag 60
gtacaattta ttcagggtgg agccgaaaga caaga 95
Claims (8)
1. An application of a molecular target ispD as a target gene in distinguishing bacillus cereus from bacillus thuringiensis, which is a non-disease treatment purpose, wherein the nucleotide sequence of the molecular target ispD is shown as SEQ ID NO:1, corresponding to bacillus cereus, or a nucleotide sequence shown as SEQ ID NO:2, corresponding to bacillus thuringiensis.
2. A primer pair for distinguishing Bacillus cereus from Bacillus thuringiensis is characterized by being designed according to a nucleotide sequence shown as SEQ ID NO.1, and effectively distinguishing the Bacillus cereus from the Bacillus thuringiensis by utilizing SNP sites based on an HRM method.
3. The primer pair according to claim 2, wherein the primer pair is as follows:
5’-AACGAAGAAGAACGCCCGTA-3’；
5’-TCTTGTCTTTCGGCTCCACC-3’。
4. a nucleic acid detection method for rapidly identifying Bacillus cereus and Bacillus thuringiensis is characterized by comprising the following steps:
extracting the genome DNA of a sample to be detected, taking the genome DNA as a template, taking the primer pair as an amplification primer according to claim 2 or 3, and effectively distinguishing the genome DNA from the amplification primer by using a high-resolution melting curve method through different characteristic melting curves of bacillus cereus and bacillus thuringiensis.
5. The method for detecting a nucleic acid according to claim 4, wherein the PCR reaction system comprises: 2x HRM Analysis PreMix, sample DNA to be detected, a primer pair and sterilized double distilled water.
6. The method for detecting nucleic acid according to claim 5, wherein the PCR reaction system is: 10 mu L of 2 XHRM Analysis PreMix reaction buffer, 50ng of detection sample DNA, 0.6 mu L of 10 mu M upstream primer and 10 mu M downstream primer respectively, and the volume of the buffer is made up to 20 mu L by sterile double distilled water.
7. The method for detecting nucleic acid according to claim 4, wherein the method using high resolution melting curve is performed by a two-step reaction procedure on LightCycler96, and the PCR reaction procedure is as follows: pre-denaturation at 95 ℃ for 2min, one cycle; denaturation at 95 ℃ for 10 s; annealing and extending for 30min at 60 ℃, and circulating for 40 cycles; the high resolution melting curve reaction program was: denaturation at 95 ℃ for 1min, renaturation at 40 ℃ for 1min, starting the program at an initial melting temperature of 65 ℃, heating to melt to 97 ℃ at the rate of 0.07 ℃/s, and monitoring the fluorescence signal in real time at 15 reading/DEG C in the process.
8. A method for accurately screening new molecular targets for distinguishing Bacillus cereus from Bacillus thuringiensis, which is characterized by comprising the following steps:
(1) the bacillus cereus group strains in the database comprise bacillus cereus and bacillus thuringiensis genome downloading, redundancy elimination and genome annotation by applying Prokka software;
(2) and (3) authenticity confirmation analysis of genome classification information of the bacillus cereus group strains: average nucleotide homology Analysis (ANI), taking a reference strain of the existing international current bacillus cereus flora or closely related species as a standard strain of the bacillus cereus flora, comparing and analyzing the similarity of the unknown strain and the whole genome of the standard strain, selecting the strain with the highest similarity to the standard strain, and preliminarily considering that the unknown strain is the species;
(3) and (3) authenticity confirmation analysis of genome classification information of the bacillus cereus group strains: performing ribosome protein multi-site sequence typing analysis by using Phyllosuite software, extracting ribosome protein genes, connecting the ribosome protein genes in series, constructing a maximum likelihood tree, and confirming strain species identities;
(4) screening for new molecular targets that distinguish between bacillus cereus and bacillus thuringiensis: and performing pan-genome analysis on the obtained bacillus cereus and bacillus thuringiensis with real identity information by applying Roary software, setting a threshold value to be 95%, and selecting core genes of the bacillus cereus and the bacillus thuringiensis which can be separated at the 95% threshold value as potential molecular targets.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110501851.4A CN113136443B (en) | 2021-05-08 | 2021-05-08 | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis |
| PCT/CN2021/121143 WO2022068785A1 (en) | 2021-05-08 | 2021-09-28 | Nucleic acid detection method for identifying bacillus cereus and bacillus thuringiensis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110501851.4A CN113136443B (en) | 2021-05-08 | 2021-05-08 | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113136443A true CN113136443A (en) | 2021-07-20 |
| CN113136443B CN113136443B (en) | 2021-12-21 |
Family
ID=76816676
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110501851.4A Active CN113136443B (en) | 2021-05-08 | 2021-05-08 | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113136443B (en) |
| WO (1) | WO2022068785A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022068785A1 (en) * | 2021-05-08 | 2022-04-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Nucleic acid detection method for identifying bacillus cereus and bacillus thuringiensis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104032000A (en) * | 2012-08-27 | 2014-09-10 | 上海交通大学 | Method and kit for detecting bacillus cereus |
| CN112646909A (en) * | 2021-01-05 | 2021-04-13 | 中国人民解放军军事科学院军事医学研究院 | Bacillus anthracis identification method based on specific SNP (single nucleotide polymorphism) sites on chromosome |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039517A (en) * | 2015-06-04 | 2015-11-11 | 广东省实验动物监测所 | PCR-HRM primer and method for distinguishing five types of rodent helicobacters |
| CN110106266A (en) * | 2019-05-09 | 2019-08-09 | 宁夏回族自治区食品检测研究院 | Identify the method for pseudomonas aeruginosa and pseudomonas putida |
| CN113136443B (en) * | 2021-05-08 | 2021-12-21 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis |
-
2021
- 2021-05-08 CN CN202110501851.4A patent/CN113136443B/en active Active
- 2021-09-28 WO PCT/CN2021/121143 patent/WO2022068785A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104032000A (en) * | 2012-08-27 | 2014-09-10 | 上海交通大学 | Method and kit for detecting bacillus cereus |
| CN112646909A (en) * | 2021-01-05 | 2021-04-13 | 中国人民解放军军事科学院军事医学研究院 | Bacillus anthracis identification method based on specific SNP (single nucleotide polymorphism) sites on chromosome |
Non-Patent Citations (1)
| Title |
|---|
| ACCESSION：CP034551: "Bacillus cereus ATCC 14579 chromosome, complete genome", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022068785A1 (en) * | 2021-05-08 | 2022-04-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Nucleic acid detection method for identifying bacillus cereus and bacillus thuringiensis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113136443B (en) | 2021-12-21 |
| WO2022068785A1 (en) | 2022-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Severgnini et al. | Advances in DNA microarray technology for the detection of foodborne pathogens | |
| JP2976406B2 (en) | Nucleic acid probe | |
| Baele et al. | Application and evaluation of the interlaboratory reproducibility of tRNA intergenic length polymorphism analysis (tDNA-PCR) for identification of Streptococcus species | |
| EP2046982A2 (en) | Identification of pathogens | |
| Clementino et al. | PCR analyses of tRNA intergenic spacer, 16S-23S internal transcribed spacer, and randomly amplified polymorphic DNA reveal inter-and intraspecific relationships of Enterobacter cloacae strains | |
| Šimenc et al. | Rapid differentiation of bacterial species by high resolution melting curve analysis | |
| WO2015023616A2 (en) | Method for comprehensive, quantitative, and highly sensitive discrimination of nucleic acid sequences in homogeneous and heterogeneous populations | |
| CN115976235B (en) | Identification method of Lactobacillus delbrueckii CICC6047 strain, and primer, kit and application thereof | |
| CN111893198B (en) | Specific molecular target for identifying staphylococcus albus, detection primer group and rapid detection method thereof | |
| CN110643722A (en) | Neisseria gonorrhoeae drug-resistant site multiple detection method and kit | |
| CN114269944A (en) | Detection of genomic sequences for organism-specific detection using probes, probe molecules and array combinations comprising probes | |
| CN113136443B (en) | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis | |
| Krawczyk et al. | Molecular identification and genotyping of staphylococci: Genus, species, strains, clones, lineages, and interspecies exchanges | |
| WO2005005659A1 (en) | Diagnostics of diarrheagenic escherichia coli (dec) and shigella spp. | |
| Tang et al. | Bacterial identification based on 16S ribosomal RNA gene sequence analysis | |
| Singh et al. | Multilocus sequence typing of Salmonella strains by high-throughput sequencing of selectively amplified target genes | |
| Chandler et al. | Diagnostic oligonucleotide microarray fingerprinting of Bacillus isolates | |
| CN112899382B (en) | Detection method for identifying amycolatopsis | |
| CN116004863A (en) | Primer pair for detecting and identifying rice bacterial leaf blight bacteria and application thereof | |
| CN110628927B (en) | Burkholderia detection method based on gyrB gene sequence | |
| CN103421892A (en) | Multiple real-time fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni | |
| CN109652573B (en) | For Salmonella typhimurtum or the site VNTR, detection primer group and the determination method of its single-phase bacterium mutation parting detection | |
| KR101399720B1 (en) | VNTR genotyping kit and VNTR genotyping method using the same | |
| CN106591466B (en) | Method for typing vibrio parahaemolyticus based on real-time fluorescent PCR | |
| Qurban et al. | Bacterial Identification by 16S Ribotyping, A Review |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |