CN113135921B - Dihydropyrimidine-spiro derivative and preparation method and application thereof - Google Patents

Dihydropyrimidine-spiro derivative and preparation method and application thereof Download PDF

Info

Publication number
CN113135921B
CN113135921B CN202110451567.0A CN202110451567A CN113135921B CN 113135921 B CN113135921 B CN 113135921B CN 202110451567 A CN202110451567 A CN 202110451567A CN 113135921 B CN113135921 B CN 113135921B
Authority
CN
China
Prior art keywords
spiro
diazaspiro
dihydropyrimidine
reaction
nmr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110451567.0A
Other languages
Chinese (zh)
Other versions
CN113135921A (en
Inventor
展鹏
马悦
刘新泳
赵树洁
任玉洁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202110451567.0A priority Critical patent/CN113135921B/en
Publication of CN113135921A publication Critical patent/CN113135921A/en
Application granted granted Critical
Publication of CN113135921B publication Critical patent/CN113135921B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/04—Ortho-condensed systems
    • C07D491/056—Ortho-condensed systems with two or more oxygen atoms as ring hetero atoms in the oxygen-containing ring

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)

Abstract

The invention provides a dihydropyrimidine-spiro derivative, a preparation method and application thereof. The compound has a structure shown in formula I. The invention also relates to a preparation method of the compound containing the structure shown in the formula I, a pharmaceutical composition and application of the compound in preparing anti-HBV medicines.

Description

Dihydropyrimidine-spiro derivative and preparation method and application thereof
Technical Field
The invention belongs to the technical field of medicines, and particularly relates to a preparation method of dihydropyrimidine-spiro derivatives and application of anti-HBV (hepatitis B virus) medicines.
Background
Viral Hepatitis B (Hepatitis B), abbreviated as Hepatitis B, is a serious infectious disease caused by Hepatitis B Virus (HBV), and can lead to acute and chronic viral Hepatitis, severe Hepatitis, cirrhosis and primary hepatocellular carcinoma (HCC) after long-term development. The medicines for preventing and treating chronic hepatitis B at present mainly comprise vaccines, interferon, immunomodulators and DNA polymerase inhibitors. However, the compounds have the defects of drug resistance, side effect, rebound after drug withdrawal, incomplete hepatitis B virus elimination and the like, so that the research and development of a new generation of safe, efficient, low-toxicity and drug-resistance non-nucleoside HBV inhibitor has important scientific significance.
The core protein is the main structural protein composed of HBV nucleocapsid, and is relatively conserved in the virus evolution process, and the assembly of the core protein plays an important role in the life cycle of hepatitis B virus. However, no relevant target drugs are currently on the market. Aiming at the defects of strong hepatotoxicity, poor water solubility and poor metabolic stability of the existing clinical candidate drugs, the reasonable drug design based on the target spot is carried out through the crystal complex structure of the core protein and the ligand, and a novel dihydropyrimidine-spiro compound is designed and synthesized, and has no relevant report in the prior art.
Disclosure of Invention
The invention provides dihydropyrimidine-spiro derivatives and a preparation method thereof, and also provides an activity screening result of the compounds as non-nucleoside HBV inhibitors and pharmaceutical application thereof.
The technical scheme of the invention is as follows:
mono-or dihydropyrimidine-spiro derivatives
The dihydropyrimidine-spiro derivative has a structure shown as the following general formula I:
Figure BDA0003038892470000011
wherein, the first and the second end of the pipe are connected with each other,
m＝1,2,3；
n＝0,1,2；
R1comprises the following steps: h1、H2、H3A halogen atom, a hydroxyl group, an amino group, a carbonyl group or a carboxyl group;
R2comprises the following steps: h1、H2、H3A halogen atom, a hydroxyl group, an amino group, a carbonyl group or a carboxyl group;
R3comprises the following steps: h1、H2、H3Hydroxy, amino, carbonyl, carboxyl, tert-butoxycarbonyl or C1-C6Alkyl aliphatic chain carboxylic acids;
R4and R5Is a hydrogen atom or a halogen atom;
R6is methyl or ethyl;
w, X, Y and Z are oxygen, nitrogen or carbon atoms.
Preferred according to the invention, C1-C6Alkyl aliphatic chain carboxylic acids are: dimethylpropionic acid, 3-dimethylbutyric acid, 2-cyclobutylpropionic acid and propionic acid.
According to a further preferred embodiment of the invention, the dihydropyrimidine-spiro derivative is one of the compounds having the following structure:
table 1. structure of dihydropyrimidine-spiro derivatives as target compounds.
Figure BDA0003038892470000021
Figure BDA0003038892470000031
Figure BDA0003038892470000041
Figure BDA0003038892470000051
Figure BDA0003038892470000061
Figure BDA0003038892470000071
Preparation method of di-or dihydropyrimidine-spiro derivatives
The preparation method of the dihydropyrimidine-spiro derivative comprises the following steps: firstly, taking 2-thiazole formamidine hydrochloride, 2-bromo-4-fluorobenzaldehyde and ethyl acetoacetate as initial raw materials, and performing cyclization reaction by a Biginelli reaction to obtain a key intermediate 2; in a dichloromethane solution, carrying out bromination reaction on the intermediate 2 and N-bromosuccinimide to obtain an important intermediate 3; reacting the N-spiro fragment with NaH in tetrahydrofuran, and adding intermediate 3 to react with the NaH to obtain partial final product 4(a-c) or K2CO3Using KI as a catalyst, and carrying out substitution reaction with the N-spiro fragment in acetonitrile solution to obtain a partial final product 4 (d-r); finally, 4(a-k) was Boc-removed in trifluoroacetic acid in dichloromethane to yield the final product 5 (a-k).
The synthetic route is as follows:
Figure BDA0003038892470000081
the reagent and the conditions are (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate and ethanol, and 80 ℃; (ii) n-bromosuccinimide, dichloromethane, 40 ℃; (iii) spiro fragment, sodium hydride, tetrahydrofuran, room temperature; or a spiro fragment, potassium carbonate, potassium iodide, acetonitrile, 75 ℃; (iv) trifluoroacetic acid, dichloromethane, room temperature;
wherein the content of the first and second substances,
m＝1,2,3；
n＝0,1,2；
R1comprises the following steps: an H atom or a carbonyl group;
R2comprises the following steps: h atom, amino group or carbonyl group;
R3comprises the following steps: a tert-butoxycarbonyl group;
w, X, Y and Z are oxygen, nitrogen or carbon atoms.
The spiro fragment is 7-oxo-2, 6-diazaspiro [3,4] octane-2-carboxylic acid tert-butyl ester, 6-oxo-2, 7-diazaspiro [4,4] nonane-2-carboxylic acid tert-butyl ester, 8-oxo-2, 7-diazaspiro [4,4] nonane-2-carboxylic acid tert-butyl ester, 3, 9-diazaspiro [5.5] undecane-3-carboxylic acid tert-butyl ester, 2, 8-diazaspiro [4.5] decane-2-carboxylic acid tert-butyl ester, 2, 7-diazaspiro [3.5] nonane-2-carboxylic acid tert-butyl ester, 7-azaspiro [3.5] nonane-2-carbamic acid tert-butyl ester, 2, 8-diazaspiro [4.5] decane-8-carboxylic acid tert-butyl ester, Tert-butyl 2, 7-diazaspiro [4.4] nonane-2-carboxylate, tert-butyl 2, 6-diazaspiro [3.4] octane-2-carboxylate, tert-butyl 2, 6-diazaspiro [3.3] heptane-2-carboxylate, 2, 8-diazaspiro [4,5] decan-1-one, 2, 8-diazaspiro [4,5] decane-1, 3-dione, 2, 7-diazaspiro [4,4] nonane-3-one, 2, 8-diazaspiro [4,5] decan-3-one, 1-oxo-2, 7-diazaspiro [3.5] nonane, 2-benzyl-2, 7-diazaspiro [4.4] nonane-1, 3-dione, 4-piperidone ethylene glycol.
The room temperature of the invention is 20-30 ℃.
The preparation method of the dihydropyrimidine-spiro derivative preferred by the invention comprises the following specific steps:
(1) weighing 2-thiazolecarboxamide hydrochloride, 2-bromo-4-fluorobenzaldehyde and sodium acetate, dissolving in absolute ethyl alcohol, adding ethyl acetoacetate under stirring at room temperature, and refluxing with ethanol at 80 ℃ for 8 h; after the reaction is finished, extracting, separating by fast column chromatography, and recrystallizing to obtain the compound 2.
(2) Dissolving the intermediate 2 in dichloromethane, stirring at room temperature, adding N-bromosuccinimide for multiple times in small amount, and refluxing for 1.5 h; after the reaction is finished, extracting, separating by fast column chromatography, and recrystallizing to obtain a compound 3.
(3) Dissolving different spiro fragments and sodium hydride in dry tetrahydrofuran solution, and stirring at room temperature for 0.5-1h until the substituted spiro is dissolved. A tetrahydrofuran solution of intermediate 3 was added dropwise and stirred at room temperature for 0.5 h. After the reaction is finished, extracting, performing fast column chromatography separation, and recrystallizing to obtain a target compound 4 (a-c); or weighing the intermediate 3, different spiro segments, potassium carbonate and potassium iodide, dissolving in acetonitrile, and refluxing at 75 ℃ for one hour. After the reaction is finished, extracting, separating by flash column chromatography, and recrystallizing to obtain the target compound 4 (d-r).
(4) Compound 4(a-k) was dissolved in dichloromethane, and trifluoroacetic acid was added thereto and stirred at room temperature for 10 hours. After the reaction is finished, the target compound 5(a-k) is obtained by extraction, preparative TLC separation and recrystallization.
Application of tri-dihydropyrimidine-spiro derivative
The invention discloses a screening result of anti-HBV activity of dihydropyrimidine-spiro derivatives and application of the dihydropyrimidine-spiro derivatives as anti-HBV inhibitors. Experiments prove that the dihydropyrimidine-spiro derivative can be used as an HBV non-nucleoside inhibitor.
The HBV DNA replication inhibition activity under the action of drugs is measured by a PCR method on the synthesized target compounds 4(a-r) and 5(a-k), and the cytotoxicity of the compounds is measured by an MTS method; meanwhile, lead compound GLS4 and marketed drug lamivudine were selected as positive controls. A total of 29 compounds synthesized were initially screened for anti-HBV DNA replication activity in vitro at the cellular level, of which 13 compounds produced significant inhibitory effects on HBV DNA expression at 20 and 10. mu.M concentration levels.
The 13 compounds are further evaluated for anti-HBV activity in vitro, and the cytotoxicity of the medicine at different concentrations is determined by an MTS method; the inhibition of HBV DNA replication activity of the drug at different concentrations was determined by PCR method. Selecting lead compound GLS4 and marketed drug Lamivudine as positive control, setting five concentration gradients for each compound, and calculating CC50、EC50And a selectivity coefficient SI.
The dihydropyrimidine-spiro derivatives are non-nucleoside HBV inhibitors with novel structures and can be used as anti-HBV lead compounds.
The dihydropyrimidine-spiro derivative can be used as a non-nucleoside HBV inhibitor. In particular to the application of the derivative as an HBV inhibitor in preparing anti-hepatitis B medicines.
An anti-HBV pharmaceutical composition comprising a dihydropyrimidine-spiro derivative of the present invention and one or more pharmaceutically acceptable carriers or excipients.
The invention discloses a dihydropyrimidine-spiro derivative, a preparation method thereof, an anti-HBV activity screening result and a first application of the dihydropyrimidine-spiro derivative as an anti-HBV inhibitor. Experiments prove that the dihydropyrimidine-spiro derivative can be used as an HBV inhibitor for preparing anti-hepatitis B drugs.
Detailed Description
The following examples are given to aid in the understanding of the invention, but are not intended to limit the scope of the invention.
The synthetic route is as follows:
Figure BDA0003038892470000101
the reagent and the conditions are (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate and ethanol, and 80 ℃; (ii) n-bromosuccinimide, dichloromethane, 40 ℃; (iii) spiro fragment, sodium hydride, tetrahydrofuran, room temperature; or a spiro fragment, potassium carbonate, potassium iodide, acetonitrile, 75 ℃; (iv) trifluoroacetic acid, dichloromethane, room temperature.
EXAMPLE 1 preparation of Compound 2
Dissolving 2-thiazolecarboxamidine hydrochloride (0.50g, 3.05mmol), 2-bromo-4-fluorobenzaldehyde (0.93g, 4.60mmol) and sodium acetate (0.50g, 6.13mmol) in 50mL of anhydrous ethanol, adding ethyl acetoacetate (600. mu.L, 4.60mmol) at room temperature, and reacting at 80 ℃ under reflux for 8 h; after the reaction, the reaction mixture was filtered to remove salts. The mother liquor was cooled to room temperature, and yellow crystals (2) precipitated. The remaining mother liquor was subjected to removal of anhydrous ethanol under reduced pressure, water (60mL) was added, extraction was performed with ethyl acetate (25 mL. times.3), the organic phases were collected and combined, extracted once with saturated sodium chloride (25mL), and the organic phase was dried over anhydrous magnesium sulfate. Filtering, loading the sample by a dry method, separating by fast column chromatography, recrystallizing by a dichloromethane-n-hexane system to obtain yellow powder, and mixing to obtain 0.75g of a product with a yield of 58%; melting point 153-.
1H NMR(400MHz,DMSO-d6)δ9.92(s,1H),7.97(d,J＝2.8Hz,1H),7.89(s,1H),7.59–7.50(m,1H),7.42–7.31(m,1H),7.23(t,J＝8.3Hz,1H),5.98(s,1H),3.94(q,J＝6.9Hz,2H),2.48(s,3H),1.03(t,J＝7.0Hz,3H)；13C NMR(100MHz,DMSO-d6)δ166.07,163.13,159.93,147.99,144.78,143.69,141.19,131.14(d,J＝8.7Hz),124.85,122.94(d,J＝9.6Hz),119.98(d,J＝24.2Hz),115.85(d,J＝21.0Hz),97.33,59.57,58.14,17.86,14.46；EI-MS:426.04[M+2+H]+,C17H15BrFN3O2S[423.01].
EXAMPLE 2 preparation of Compound 3
Dissolving the intermediate 2(0.50g, 1.17mmol) in 50mL dichloromethane, slowly adding N-bromosuccinimide (0.22g, 1.24mmol), and carrying out reflux reaction at 40 ℃ for 1.5 h; after the reaction is finished, cooling to room temperature, removing the solvent by rotary evaporation, adding water (50mL), extracting with ethyl acetate for three times (20mL multiplied by 3), combining organic phases, extracting once with saturated sodium chloride solution (25mL), and drying with anhydrous sodium sulfate; filtering, loading the sample by a dry method, separating by a rapid preparative chromatography silica gel column, and recrystallizing by a dichloromethane-n-hexane mixed solvent to obtain 0.35g of yellow solid with the yield of 59 percent; melting point 123-.
1H NMR(400MHz,CDCl3)δ7.84(d,J＝3.1Hz,1H),7.52(s,2H),7.44–7.35(m,1H),7.32(dd,J＝8.1,2.6Hz,1H),7.02(t,J＝8.0Hz,1H),6.09(s,1H),4.94(d,J＝8.9Hz,1H),4.61(s,1H),4.09(d,J＝7.0Hz,2H),1.16(t,J＝7.1Hz,3H)；EI-MS:502.2[M+H]+；13C NMR(100MHz,CDCl3)δ164.73,163.27,160.76,155.66,150.28,143.87,143.01,137.84,130.60(d,J＝8.6Hz),124.62,123.45,122.10(d,J＝9.2Hz),120.26(d,J＝24.8Hz),115.72(d,J＝20.9Hz),106.39,60.72,51.61,31.79,14.03；EI-MS:499.90[M-H]-,501.94[M+2-H]-,503.91[M+4-H]-,C17H14Br2FN3O2S[500.92].
EXAMPLE 3 preparation of Compound 4(a-c)
The different substituted spiro rings (0.442mmol) and NaH (54mg,1.33mmol) were dissolved in dry tetrahydrofuran solution and stirred at room temperature for 0.5-1h until the substituted spiro ring was dissolved. A solution of intermediate 3(220mg,0.440mmol) in tetrahydrofuran was added dropwise. Stir at rt for 0.5 h. After completion of the reaction, tetrahydrofuran was removed under reduced pressure, water (25mL) was added, extraction was performed with ethyl acetate (20 mL. times.3), the organic phases were collected and combined, extracted once with saturated sodium chloride (25mL), and the organic phase was dried over anhydrous magnesium sulfate. Filtering and separating by flash column chromatography. And recrystallizing by adopting a dichloromethane-n-hexane system to obtain the target compound 4 (a-c).
The substituted spiro ring is 7-oxo-2, 6-diazaspiro [3,4]]Octane-2-carboxylic acid tert-butyl ester. The product 4a is a yellow powdery solid with a yield of 65.6% and a melting point of 92-93 ℃;1H NMR(400MHz,DMSO-d6)δ9.06(s,1H),8.01(s,1H),7.97–7.87(m,1H),7.57(d,J＝8.6Hz,1H),7.43(ddd,J＝11.4,8.7,6.2Hz,1H),7.30–7.19(m,1H),4.68(d,J＝2.1Hz,1H),4.00(dd,J＝7.1,3.6Hz,2H),3.94–3.77(m,4H),3.76–3.64(m,2H),2.67(d,J＝9.5Hz,2H),1.37(d,J＝1.3Hz,9H),1.08(dt,J＝9.0,7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ174.82,165.58,155.94,155.63,144.81,144.27,143.84,140.69,132.01,131.51,126.48,125.27,119.94,116.41,115.84,99.60,79.12,60.30,60.21,58.94,58.00,52.07,44.87,41.30,34.26,28.51,14.39；EI-MS:648.18[M+H]+；C28H31BrFN5O5S[647.12].
the substituted spiro ring is 6-oxo-2, 7-diazaspiro [4,4]]Nonane-2-carboxylic acid tert-butyl ester. The product 4b is a yellow powdery solid with a yield of 11.2% and a melting point of 85-87 ℃;1H NMR(400MHz,Chloroform-d)δ7.84(s,1H),7.51(s,1H),7.44–7.28(m,2H),7.04(s,1H),6.12(d,J＝41.0Hz,1H),4.91(d,J＝26.0Hz,2H),4.07(s,2H),3.64(s,2H),3.50(s,2H),3.40(s,2H),2.31(s,1H),2.10(s,2H),1.47(s,9H),1.15(s,3H)；13C NMR(100MHz,DMSO-d6)δ175.69,165.55,162.56,160.09,155.85,153.89,144.79,144.36,143.91,132.03,126.39,125.28,120.18,119.94,116.14,115.88,99.78,78.81,60.35,60.24,56.50,50.03,49.11,45.63,44.97,34.91,31.43,28.63,14.52；C29H33BrFN5O5S[661.14].
by substituted spiro-rings to 8-oxo-2, 7-diazaspiro [4,4]]Nonane-2-carboxylic acid tert-butyl ester. The product 4c was a yellow powdery solid with a yield of 53.4% and a melting point of 119-120 ℃;1H NMR(400MHz,DMSO-d6)δ9.63(s,1H),7.97(d,J＝31.4Hz,2H),7.57(d,J＝8.5Hz,1H),7.42(s,1H),7.25(s,1H),6.08–5.86(m,1H),4.71(s,2H),4.06–3.92(m,2H),3.40(d,J＝12.9Hz,4H),3.27(s,2H),2.41(d,J＝13.0Hz,2H),1.90(s,2H),1.45–1.26(m,9H),1.07(dt,J＝14.2,7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ173.29,165.59,162.90,155.53,154.05,144.78,144.30,143.96,140.66,140.48,131.98,126.48,125.24,122.04,120.19,120.01,116.38,116.17,99.82,78.85,60.31,60.22,58.34,56.49,52.11,45.08,44.96,41.60,41.37,28.60,14.52；EI-MS:662.16[M+H]+,684.12[M+Na]+,C29H33BrFN5O5S[661.14].
EXAMPLE 4 preparation of Compound 4(d-r)
Intermediate 3(0.608g, 1.21mmol), the different spiro fragments (1.21mmol), potassium carbonate (0.25g, 1.82mmol) and potassium iodide (0.30g, 1.82mmol) were taken up in 25mL acetonitrile and refluxed at 75 ℃ for one hour. After completion of the reaction, the excess solvent was spin-dried, water (30mL) was added, extraction was performed with ethyl acetate (20 mL. times.3), the organic phases were collected and combined, extracted once with saturated sodium chloride (25mL), and the organic phase was dried over anhydrous magnesium sulfate. Filtering, adding 200 mesh silica gel, stirring, and separating by flash column chromatography. And recrystallizing by adopting a dichloromethane-n-hexane system to obtain the target compound 4 (d-r).
The substituted spirocycle used is 8-oxo-2, 7-diazaspiro [4,4]]Nonane-2-carboxylic acid tert-butyl ester. The product 4d was a yellow oily solid with a yield of 39.0% and a melting point of 77-80 ℃;1H NMR(400MHz,DMSO-d6)δ9.69(s,1H),8.00(s,1H),7.93(s,1H),7.56(d,J＝8.1Hz,1H),7.37(s,1H),7.22(s,1H),6.02(s,1H),4.08–3.79(m,4H),1.53(s,4H),1.39(s,9H),1.23(s,2H),1.05(t,J＝6.9Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.53,160.01,154.16,147.35,144.41,144.11,140.69,131.38,125.16,123.05(d,J＝9.8Hz),120.18,119.94,116.05,115.84,97.30,78.67,59.81,58.65,56.33,51.11,44.47,44.30,39.24,34.94,28.67,14.46；EI-MS:676.97[M+H]+,C31H39BrFN5O4S[675.19].
the substituted spiro ring is 2, 8-diazaspiro [4.5]]Decane-2-carboxylic acid tert-butyl ester. The product 4e was a yellow oily solid with a yield of 71.0% and a melting point of 167-;1H NMR(400MHz,DMSO-d6)δ9.68(d,J＝4.9Hz,1H),8.03(t,J＝2.3Hz,1H),7.95(t,J＝2.3Hz,1H),7.57(dd,J＝8.7,2.5Hz,1H),7.39(dd,J＝8.8,6.2Hz,1H),7.23(dd,J＝9.9,7.5Hz,1H),6.03(s,1H),3.96(d,J＝6.8Hz,2H),3.30(d,J＝5.3Hz,2H),3.12(s,2H),2.59–2.45(m,6H),1.73(d,J＝7.6Hz,2H),1.58(d,J＝5.1Hz,4H),1.41(s,9H),1.06(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.53,156.12,147.25,144.37,144.11,140.69,131.39,125.16,120.18,119.94,116.06,115.85,97.31,78.90,59.84,58.66,56.24,50.68,35.61,33.04,28.56,14.45；EI-MS:661.97[M+H]+,C30H37BrFN5O4S[661.17].
the substituted spiro ring is 2, 7-diazaspiro [3.5]]Nonane-2-carboxylic acid tert-butyl ester. The product 4f was a yellow oily solid in 38% yield, mp 103-;1H NMR(400MHz,DMSO-d6)δ9.66(s,1H),8.02(d,J＝2.4Hz,H),7.95(d,J＝2.4Hz,1H),7.57(dt,J＝8.5,2.2Hz,1H),7.38(dd,J＝9.0,6.0Hz,1H),7.27–7.20(m,1H),6.03(s,1H),3.96(d,J＝7.1Hz,2H),3.86(d,J＝12.3Hz,2H),3.58(s,4H),2.45(s,4H),1.76(d,J＝5.4Hz,4H),1.39(d,J＝1.7Hz,9H),1.06(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.53,156.12,147.25,144.37,144.11,140.69,131.39,125.16,120.18,119.94,116.06,115.85,97.31,78.90,59.84,58.66,56.24,50.68,35.61,33.04,28.56,14.45；EI-MS:648.04[M+H]+；C29H35BrFN5O4S[647.16].
the substituted spiro ring is 7-azaspiro [3.5]]Nonane-2-carbamic acid tert-butyl ester. The product 4g was a yellow powdery solid with a yield of 35.9% and a melting point of 153-;1H NMR(400MHz,DMSO-d6)δ9.69(s,1H),8.03(t,J＝2.5Hz,1H),7.94(d,J＝2.5Hz,1H),7.43–7.34(m,1H),7.23(t,J＝8.4Hz,1H),7.10(d,J＝8.0Hz,1H),6.02(s,1H),3.97–3.82(m,4H),2.46(s,2H),2.38(s,2H),2.11(t,J＝9.8Hz,2H),1.72–1.48(m,6H),1.38(d,J＝1.9Hz,9H),1.05(td,J＝7.1,1.9Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.55,160.01,155.01,147.44,144.37,144.13,140.71(d,J＝3.3Hz),131.39,131.30,125.12,123.08,120.17,119.93,116.05,115.85,97.13,77.94,59.79,58.66,56.48,51.05,50.79,36.34,31.16,28.73,14.47；EI-MS:662.20[M+H]+；C30H37BrFN5O4S[661.17].
the substituted spiro ring is 2, 8-diazaspiro [4.5]]Decane-8-carboxylic acid tert-butyl ester. The product is yellow powdery solid in 4 hours, the yield is 68.7 percent, and the melting point is 91-94 ℃;1H NMR(400MHz,DMSO-d6)δ9.65(s,1H),8.06–7.89(m,4H),7.57(dd,J＝8.7,2.4Hz,1H),7.38(d,J＝7.0Hz,1H),7.25(dd,J＝8.5,2.4Hz,1H),6.03(s,1H),4.05–3.95(m,4H),3.31(s,4H),2.84(d,J＝7.8Hz,1H),2.60(d,J＝9.2Hz,1H),1.68(t,J＝7.0Hz,2H),1.60–1.45(m,4H),1.39(s,9H),1.06(t,J＝7.2Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.64,162.42,160.03,154.38,147.75,144.44,143.92,140.61,131.38,131.29,125.24,123.05(d,J＝9.6Hz),120.19,119.95,116.08,115.87,96.75,78.92,65.02,59.83,58.61,53.60,53.50,40.94,36.60,28.56,14.48；EI-MS:662.65[M+H]+；C30H37BrFN5O4S[661.17].
the substituted spiro ring is 2, 7-diazaspiro [4.4]Nonane-2-carboxylic acid tert-butyl ester. Product 4i was a yellow powdery solid with a yield of 89.4%, melting point118-121℃；1H NMR(400MHz,DMSO-d6)δ9.65(d,J＝15.8Hz,1H),7.98(d,J＝17.4Hz,2H),7.57(dd,J＝8.5,2.3Hz,1H),7.39(t,J＝7.5Hz,1H),7.27–7.18(m,1H),6.03(s,1H),4.07–3.92(m,4H),3.25(dd,J＝21.9,10.5Hz,4H),2.94–2.56(m,4H),1.83(d,J＝7.0Hz,4H),1.36(d,J＝21.2Hz,9H),1.06(t,J＝7.2Hz,3H)；13C NMR(100MHz,DMSO-d6)δ166.78,161.38,157.36,152.23,146.11,143.15,138.89,138.87,138.65,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,100.34,79.60,65.57,63.33,61.52,61.37,60.26,52.58,50.52,48.65,39.20,38.09,28.33,14.46；EI-MS:648.67[M+H]+；C29H35BrFN5O4S[647.16].
The substituted spiro ring is 2, 6-diazaspiro [3.4]]Octane-2-carboxylic acid tert-butyl ester. The product 4j was a yellow powdery solid with a yield of 51.0% and a melting point of 158-;1H NMR(400MHz,DMSO-d6)δ9.57(s,1H),7.99–7.90(m,2H),7.56(dt,J＝8.5,2.1Hz,1H),7.42–7.36(m,1H),7.23(dd,J＝9.7,7.4Hz,1H),4.01(s,2H),3.95(dd,J＝7.1,1.6Hz,2H),3.82(s,4H),2.77(ddd,J＝28.4,20.3,8.7Hz,4H),2.07(t,J＝7.4Hz,2H),1.37(d,J＝1.7Hz,9H),1.05(td,J＝7.1,1.7Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.63,162.49,155.92,147.54,144.36,143.75,140.70,131.41,131.33,125.33,123.08,122.99,120.17,119.93,116.08,115.87,96.83,78.90,64.72,59.84,58.58,53.61,53.40,36.46,28.53,14.47；EI-MS:634.37[M+H]+；C28H33BrFN5O4S[633.14].
the substituted spiro ring is 2, 6-diazaspiro [3.3]Heptane-2-carboxylic acid tert-butyl ester. The product 4k is a yellow powdery solid with a yield of 41.0 percent and a melting point of 166-169 ℃;1H NMR(400MHz,DMSO-d6)δ9.43(s,1H),8.03(d,J＝2.4Hz,1H),7.95(d,J＝2.6Hz,1H),7.57(dd,J＝6.8,4.4Hz,1H),7.35(dd,J＝8.7,5.9Hz,1H),7.23(t,J＝8.5Hz,1H),6.00(d,J＝1.9Hz,1H),3.96(d,J＝7.1Hz,8H),3.49(s,4H),1.42–1.35(m,9H),1.06(ddd,J＝8.3,6.5,1.8Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.56,162.43,160.02,155.79,147.09,144.31,144.06,140.60,131.27,125.23,123.02,120.22,119.98,115.95,97.21,79.01,64.56,59.87,58.40,56.79,33.50,28.52,14.46；EI-MS:620.10[M+H]+；C27H31BrFN5O4S[619.13].
the substituted spiro ring is 2, 8-diazaspiro [4,5]]Decan-1-one. Product 4l was a yellow powdery solid, yield 48.0%, melting point>200℃；1H NMR(400MHz,DMSO-d6)δ9.62(s,1H),8.05(s,1H),7.95(s,1H),7.58(s,1H),7.42–7.37(m,1H),7.23(t,J＝8.4Hz,1H),6.04(s,1H),4.05–4.02(m,2H),3.96(d,J＝6.9Hz,2H),3.18(t,J＝6.8Hz,2H),2.90(d,J＝11.5Hz,1H),2.77(d,J＝11.6Hz,1H),2.29(d,J＝31.2Hz,2H),1.97(s,2H),1.80(d,J＝11.8Hz,2H),1.45–1.36(m,2H),1.05(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ180.66,165.66,162.59,160.01,147.29,144.32,140.74,131.98,129.13,125.17,120.17,119.93,115.86,97.34,65.49,59.82,58.64,56.59,50.35,41.63,38.37,32.25,31.32,30.48,14.46；EI-MS:576.53[M+H]+；C25H27BrFN5O3S[575.10].
The substituted spiro ring is 2, 8-diazaspiro [4,5]]Decane-1, 3-dione. Product 4m is a yellow powdery solid with a yield of 56.0%, melting point>200℃；1H NMR(400MHz,DMSO-d6)δ11.17(s,1H),9.61(s,1H),8.05(t,J＝2.3Hz,1H),7.96(d,J＝2.5Hz,1H),7.57(dd,J＝8.5,2.4Hz,1H),7.42–7.35(m,1H),7.23(s,1H),6.03(d,J＝1.7Hz,1H),3.96(d,J＝7.1Hz,2H),3.91(d,J＝11.6Hz,2H),2.93(d,J＝11.6Hz,1H),2.78(d,J＝11.8Hz,1H),2.61(s,2H),2.31(t,J＝11.6Hz,1H),2.22(t,J＝11.8Hz,1H),1.90(d,J＝11.3Hz,2H),1.70–1.56(m,2H),1.06(td,J＝7.1,1.8Hz,3H)；13C NMR(100MHz,CDCl3)δ182.39,170.41,167.32,162.72,149.10,148.86,145.45,129.96,124.93,124.69,120.83,120.62,102.23,64.98,64.62,63.39,61.05,54.90,54.69,48.71,37.83,25.98,19.30,19.21,18.59；EI-MS:590.42[M+H]+；C25H25BrFN5O4S[589.08].
The substituted spiro ring is 2, 7-diazaspiro [4,4]]Nonan-3-ones. The product 4n is a yellow powdery solid with a yield of 58.9 percent and a melting point of 150-152 ℃;1H NMR(400MHz,DMSO-d6)δ9.62(d,J＝3.4Hz,1H),8.00–7.93(m,2H),7.56(dd,J＝8.4,2.6Hz,1H),7.44–7.34(m,1H),7.26–7.19(m,1H),6.02(s,1H),4.04(s,2H),3.95(q,J＝7.0Hz,2H),2.89–2.56(m,6H),2.32–2.22(m,2H),1.95–1.87(m,2H),1.05(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ176.29,165.63,162.45,160.03,147.70,144.40,143.98,140.65,131.34,131.26,125.24,123.00,120.20,119.96,116.08,115.87,96.80,65.46,59.84,58.59,56.50,54.08,53.79,45.78,43.74,37.08,14.47；EI-MS:562.36[M+H]+；C24H25BrFN5O3S[561.08].
the substituted spiro ring is 2, 8-diazaspiro [4,5]]Decan-3-one. The product 4o was a yellow powdery solid with a yield of 75.5% and a melting point of 140-;1H NMR(400MHz,DMSO-d6)δ10.16(s,1H),9.66(s,1H),7.98(d,J＝29.5Hz,2H),7.59–7.24(m,3H),6.02(s,1H),4.55(s,1H),3.95(d,J＝6.5Hz,3H),3.54(s,1H),3.08(s,2H),2.08(s,2H),1.91(s,2H),1.64(s,2H),1.14–0.99(m,3H)；13C NMR(100MHz,DMSO-d6)δ176.70,166.78,162.39,160.37,152.23,146.11,143.15,138.89,138.87,138.65,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,100.34,65.57,61.37,60.21,52.24,49.33,43.15,36.30,34.24,14.46；EI-MS:576.43[M+H]+；C25H27BrFN5O3S[575.10].
the substituted spirocycles used are 1-oxo-2, 7-diazaspiro [3.5]Nonane. The product 4p was a yellow powdery solid with a yield of 32.8% and a melting point of 135-;1H NMR(400MHz,Chloroform-d)δ7.86(s,1H),7.47(s,1H),7.31(s,2H),7.00(s,1H),6.16(s,1H),5.69(s,2H),4.03(s,2H),3.22(s,2H),2.11(d,J＝51.6Hz,4H),1.50–0.90(m,7H)；13C NMR(100MHz,DMSO-d6)δ180.24,166.78,162.39,160.37,152.23,146.11,143.15,138.89,138.87,138.65,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,100.34,65.57,61.37,60.21,49.00,48.43,43.54,29.82,14.46；EI-MS:562.40[M+H]+；C24H25BrFN5O3S[561.08].
the substituted spiro ring is 2-benzyl-2, 7-diazaspiro [4.4]Nonane-1, 3-dione. Product produced by birthSubstance 4q is a yellow powdery solid with a yield of 55.7% and a melting point of 74-78 ℃;1H NMR(400MHz,Chloroform-d)δ9.48(d,J＝9.7Hz,1H),7.86(dd,J＝10.1,3.1Hz,1H),7.43(s,1H),7.30(t,J＝7.2Hz,6H),7.26–7.21(m,1H),7.00–6.89(m,1H),6.17(d,J＝4.2Hz,1H),4.66(d,J＝10.0Hz,2H),4.17(d,J＝2.6Hz,1H),4.07–3.99(m,3H),3.25(s,1H),3.05(s,1H),2.87(d,J＝20.2Hz,3H),2.55(s,1H),2.04–1.88(m,1H),1.17–1.08(m,3H)；13C NMR(100MHz,DMSO-d6)δ181.41,176.32,165.63,162.52,147.31,144.27,143.97,143.87,136.64,131.51(d,J＝8.7Hz),128.99,127.86,127.84,127.78,127.75,125.29,125.23,115.94,96.98,64.30,59.86,58.59,54.10,53.35,49.74,44.00,43.84,42.04,37.11,36.96,14.45；EI-MS:666.49[M+H]+；C31H29BrFN5O4S[665.11].
the substituted spiro ring is 4-piperidone ethylene glycol. The product 4r is a yellow powdery solid with a yield of 24.1% and a melting point of 142-;1H NMR(400MHz,DMSO-d6)δ9.74(s,1H),8.04(d,J＝3.1Hz,1H),7.95(d,J＝3.1Hz,1H),7.57(dd,J＝8.6,2.6Hz,1H),7.39(dd,J＝8.7,6.2Hz,1H),7.22(td,J＝8.5,2.6Hz,1H),6.03(s,1H),4.00–3.84(m,8H),2.61(s,4H),1.73(d,J＝5.2Hz,4H),1.05(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO)δ165.65,162.54,162.49,160.02,147.29,144.41,144.12,140.67,140.64,131.42,131.33,125.21,123.10,123.00,120.18,119.94,116.07,115.86,106.33,97.18,64.17,59.83,58.65,56.50,55.79,51.70,35.27,14.46；EI-MS:565.58[M+H]+；C24H26BrFN4O4S[564.08]
EXAMPLE 5 preparation of Compound 5(a-k)
The corresponding compound 4(a-k) was dissolved in 25mL of dichloromethane, 2.5mL of trifluoroacetic acid was added, and the mixture was stirred at room temperature overnight. After the reaction was completed, the excess solvent was spin-dried, a saturated sodium carbonate solution (30mL) was added, extraction was performed with methylene chloride (20 mL. times.3), the organic phases were collected and combined, extracted once with saturated sodium chloride (25mL), and the organic phase was dried over anhydrous magnesium sulfate. Filtration, concentration to 1mL under reduced pressure, preparative TLC separation, and recrystallization afforded the title compound 5 (a-k).
5a yellow powderThe yield of the powder solid is 92.0 percent, and the melting point is 160-178 ℃;1H NMR(400MHz,DMSO-d6)δ8.01(s,2H),7.57(s,1H),7.43(s,1H),7.27(s,1H),5.98(d,J＝38.6Hz,1H),4.68(s,1H),4.55(s,1H),4.00(d,J＝6.9Hz,2H),3.95–3.57(m,6H),2.72(s,2H),1.08(d,J＝6.9Hz,3H)；13C NMR(100MHz,DMSO-d6)δ176.81,166.78,162.39,160.37,152.23,146.11,143.15,141.00,138.89,138.87,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,103.01,65.57,64.62,61.37,57.71,48.56,37.58,32.55,14.46；EI-MS:548.23[M+H]+；C23H23BrFN5O3S[547.07].
5b yellow powdery solid, yield 45.8%, melting point 168-170 ℃;1H NMR(400MHz Chloroform-d),δ7.82(s,1H),7.50(s,1H),7.30(s,1H),7.09(s,1H),6.12(d,J＝36.3Hz,1H),4.84(s,2H),4.08(s,2H),3.90(s,2H),3.25(s,1H),2.84(s,2H),2.42(s,4H),1.13(s,3H)；13C NMR(100MHz,DMSO-d6)δ180.24,166.78,162.39,160.37,152.23,146.11,143.15,141.00,138.89,138.87,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,103.01,65.57,61.37,57.00,48.00,47.46,46.28,45.24,35.68,35.58,14.46；EI-MS:562.44[M+H]+；C24H25BrFN5O3S[561.08].
5c yellow powdery solid, yield 94%, melting point 135-140 ℃;1H NMR(400MHz,Chloroform-d)δ7.84(dd,J＝7.9,3.2Hz,1H),7.52(d,J＝3.4Hz,1H),7.46–7.27(m,2H),7.12–6.95(m,1H),6.12(d,J＝39.3Hz,1H),4.92–4.66(m,2H),4.11–3.99(m,2H),3.72(q,J＝7.0Hz,2H),3.66–3.47(m,2H),3.33(d,J＝11.6Hz,2H),3.25–3.12(m,2H),3.12–3.04(m,1H),2.76–2.49(m,4H),1.96(t,J＝7.5Hz,1H),1.13(td,J＝7.0,4.6Hz,3H)；13C NMR(100MHz,DMSO-d6)δ180.14,166.78,162.39,160.37,152.23,146.11,143.15,141.00,138.89,138.87,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,103.01,65.57,62.01,61.37,58.07,48.56,45.82,41.93,41.79,38.57,14.46；EI-MS:562.45[M+H]+；C24H25BrFN5O3S[561.08].
5d yellow oily solid, yield 54%, melting point 185-188 ℃;1H NMR(400MHz,DMSO-d6)δ9.67(s,1H),9.10(s,1H),8.01(d,J＝3.2Hz,2H),7.57(dd,J＝8.5,2.6Hz,1H),7.38(t,J＝7.5Hz,1H),7.24(d,J＝8.6Hz,1H),6.03(s,1H),4.01–3.82(m,4H),3.36–3.19(m,4H),3.01(t,J＝5.7Hz,4H),1.65(d,J＝6.2Hz,4H),1.57(d,J＝5.4Hz,4H),1.05(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.66,162.50,160.03,144.43,144.10,140.64,130.11,128.11,125.95,125.25,125.24,120.09(d,J＝24.2Hz),59.85,58.64,56.28,49.09,35.58,31.75,30.86,29.30(dd,J＝40.6,10.4Hz),28.73,27.02,14.44；EI-MS:576.91[M+H]+；C26H31BrFN5O2S[575.14].
5e yellow solid, 56.0% yield, mp 121-124 deg.C;1H NMR(400MHz,DMSO-d6)δ9.64(s,1H),9.42(s,1H),8.01(t,J＝2.4Hz,1H),7.97–7.89(m,1H),7.57(dd,J＝8.6,2.3Hz,1H),7.38(t,J＝7.5Hz,1H),7.24(d,J＝8.6Hz,1H),6.02(s,1H),4.02–3.83(m,4H),3.22(t,J＝7.5Hz,2H),3.00(s,2H),1.81(t,J＝7.4Hz,2H),1.65(s,4H),1.24(s,4H),1.05(t,J＝7.0Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.52,160.02,147.29,144.39,144.12,140.66,131.40,125.24,120.18,119.94,116.10,115.89,97.33,59.84,58.63,56.22,51.02,43.41,34.89,31.76,29.50,29.05,27.02,22.57,14.47；EI-MS:562.95[M+H]+；C25H29BrFN5O2S[561.12].
5f yellow solid, yield 33.0%, melting point 130-;1H NMR(400MHz,DMSO-d6)δ9.55(s,1H),8.07–7.87(m,2H),7.59(dd,J＝14.7,7.6Hz,1H),7.40(t,J＝7.4Hz,1H),7.23(d,J＝7.3Hz,1H),6.03(s,1H),4.23(t,J＝6.6Hz,1H),3.96(q,J＝7.2Hz,2H),3.82(t,J＝13.6Hz,2H),2.88(s,2H),2.74(dd,J＝16.5,8.4Hz,2H),2.13–1.93(m,4H),1.37(d,J＝6.0Hz,2H),1.06(t,J＝7.0Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.64,162.53,160.02,147.18,144.33,144.09,140.65,131.42,130.12,125.25,119.94,116.10,115.89,97.33,59.84,58.62,56.10,54.54,50.14,36.09,34.86,29.56,14.47,14.43；EI-MS:548.96[M+H]+；C24H27BrFN5O2S[547.11].
5g of yellow solid, yield 65.0%, melting point 110-113 ℃;1H NMR(400MHz,DMSO-d6)δ9.68(s,1H),8.05–7.98(m,1H),7.94(t,J＝2.5Hz,1H),7.57(dd,J＝8.7,2.5Hz,1H),7.37(dd,J＝8.7,6.1Hz,1H),7.22(dd,J＝9.9,7.4Hz,1H),6.02(s,1H),3.94(d,J＝7.0Hz,2H),3.84(d,J＝13.3Hz,2H),3.54(t,J＝8.0Hz,2H),2.39(s,2H),2.13(t,J＝9.9Hz,2H),1.90(d,J＝1.7Hz,1H),1.73(t,J＝10.0Hz,2H),1.62(d,J＝5.9Hz,4H),1.04(td,J＝7.1,1.7Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.65,162.54,160.01,147.44,144.37,144.14,140.70,131.40,131.31,125.22,123.08,122.99,120.18,119.94,116.09,115.88,97.15,59.81,58.63,56.44,50.81,50.58,41.12,38.66,36.21,31.76,14.47；EI-MS:562.87[M+H]+；C25H29BrFN5O2S[561.12].
5h of yellow solid, the yield is 51.0 percent, and the melting point is 85-88 ℃;1H NMR(400MHz,DMSO-d6)δ9.62(s,1H),7.97(dd,J＝11.3,3.0Hz,2H),7.58(d,J＝8.9Hz,1H),7.40(t,J＝7.5Hz,1H),7.24(t,J＝8.7Hz,1H),6.04(s,1H),4.02(s,2H),3.97(d,J＝7.1Hz,2H),3.01(dq,J＝12.5,6.1,5.6Hz,4H),2.90(d,J＝7.7Hz,1H),2.71(d,J＝8.9Hz,2H),2.35(d,J＝9.6Hz,1H),1.85(s,1H),1.74(d,J＝8.3Hz,4H),1.06(t,J＝7.0Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.64,162.44,160.03,147.65,144.44,144.01,140.61,131.40,130.11,128.11,125.95,125.27,120.19,119.95,116.10,115.89,96.74,59.84,58.61,56.47,53.39,41.37,41.31,36.63,33.54,31.75,29.55,29.50,29.16,14.49；EI-MS:562.91[M+H]+；C25H29BrFN5O2S[561.12].
5i yellow solid, 66.0% yield, mp 87-88 ℃;1H NMR(400MHz,DMSO-d6)δ9.60(s,1H),8.00(q,J＝2.5Hz,1H),7.96(d,J＝3.1Hz,1H),7.57(d,J＝8.8Hz,1H),7.45–7.36(m,1H),7.26(t,J＝8.8Hz,1H),6.03(s,1H),4.04(s,2H),3.97(d,J＝7.0Hz,2H),3.26–3.07(m,4H),2.76(ddd,J＝28.5,13.7,8.3Hz,4H),2.11–1.93(m,3H),1.90–1.81(m,1H),1.06(t,J＝7.1Hz,3H)；13C NMR(100MHz,DMSO-d6)δ165.63,162.47,160.02,147.50,144.42,144.01,140.55,130.12,128.11,125.95,120.19,119.94,116.24,115.98,96.94,63.35,59.88,58.56,56.47,54.50,48.89,44.12,36.21,34.97,14.48；EI-MS:548.37[M+H]+；C24H27BrFN5O2S[547.11].
5j yellow solid, yield 11.3%, melting point 127-;1H NMR(400MHz,DMSO-d6)δ9.55(s,1H),8.07–7.87(m,2H),7.59(dd,J＝14.7,7.6Hz,1H),7.40(t,J＝7.4Hz,1H),7.32(d,J＝6.2Hz,1H),6.03(s,1H),4.02(s,2H),3.96(d,J＝7.3Hz,2H),3.88–3.77(m,2H),2.88(s,2H),2.71(dd,J＝16.9,8.1Hz,2H),2.13–1.93(m,4H),1.06(t,J＝7.0Hz,3H)；13C NMR(100MHz,DMSO-d6)δ166.78,162.39,160.37,152.23,146.11,143.15,138.89,138.87,138.65,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,100.34,65.57,62.75,62.71,61.37,60.26,52.58,49.14,45.82,39.13,38.26,14.46.EI-MS:534.01[M+H]+；C23H25BrFN5O2S[533.09].
5k yellow solid, yield 11.7%, melting point 147-150 ℃;1H NMR(400MHz,DMSO-d6)δ9.39(s,1H),9.28(s,1H),8.01(s,1H),7.96(s,1H),7.59(dd,J＝15.0,7.4Hz,1H),7.37–7.30(m,1H),7.25(d,J＝8.9Hz,1H),6.00(s,1H),4.27–4.04(m,4H),3.96(d,J＝5.2Hz,4H),3.53(d,J＝10.1Hz,4H),1.06(t,J＝7.2Hz,3H)；13C NMR(100MHz,DMSO-d6)δ166.78,162.39,160.37,152.23,146.11,143.15,138.89,138.87,138.65,129.35,129.28,126.57,126.51,121.71,120.94,120.78,113.30,113.14,100.34,65.82,65.57,64.46,61.37,58.92,27.63,14.46；EI-MS:520.08[M+H]+；C22H23BrFN5O2S[519.07].
example 6 in vitro anti-HBV Activity test of the Compound of interest (HepDES19 cells)
The test principle is as follows: HepDES19 cells are derivatives of HepG2 (human hepatoblastoma) cell line stably transfected with HBV type D genomic gene under the control of tetracycline (repressible promoter). Induction of HepDES19 cells for HBV replication in the absence of tetracycline, addition of compounds, and incubation of cellsThe HBV DNA content expressed by the cells and the survival condition of the cells will be changed in 3 days. Analyzing the HBV DNA content by quantitative polymerase chain reaction (qPCR), namely the effectiveness of the compound in inhibiting HBV replication, to obtain the compound concentration required by reducing the HBV DNA to half, namely the half Effective Concentration (EC)50) Showing the anti-HBV activity of the compound. Testing the toxicity of the compound on cells by an MTS method to obtain the concentration required by the compound to kill half of the cells, namely half lethal concentration (CC)50) It indicates the cytotoxicity of the compound. (Guo H, Jiang D, Zhou T, et al. journal of virology 2007; 81(22): 12472-.
The experimental method comprises the following steps:
(1) and (5) culturing the cells. The cells were maintained in Dulbecco 'S modified Eagle' S medium (DMEM)/F12 supplemented with 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin (P/S) and 1. mu.g/mL tetracycline. The simultaneous expression of HBV pgRNA was induced by removing tetracycline from the medium.
(2) And (5) carrying out drug-containing culture on the cells. HepDES19 cells were plated at 4x 10 per well in the absence of tetracycline4Individual cells were seeded at density in 96-well plates. After 48 hours of induction of HBV replication, compound solutions with a final DMSO concentration of 1% were added and incubated with the cells for 3 days.
(3) Cell Activity (EC)50) And (4) a test method. Cells were washed in 200 μ L Phosphate Buffered Saline (PBS) and lysed in 150 μ L core lysis buffer (10mM Tris pH 7.4, 1% Tween20, 150mM NaCl). Cells were incubated for 40 minutes at 350rpm on an orbital shaker at 20-23 ℃. The cell lysates were transferred to 96-well PCR plates and centrifuged at 3300 × g for 5 min. 50 μ L of supernatant was transferred to another 96-well PCR plate and incubated with 20 units of Micrococcus nuclease and 100 μ M CaCl2And (4) mixing. The lysates were incubated at 37 ℃ for 1 hour, and then the nucleases were inactivated at 70 ℃ for 10 minutes. Qiagen protease (0.005Anson units) was added to the lysate and the mixture was incubated overnight, followed by 10 min of protease inactivation at 95 ℃.
The lysates were used as templates for strand-first quantitative polymerase chain reaction (qPCR) analysis. Quantitative PCR was performed at 95 ℃ for 15s and 60 ℃ for 1min with 40 cycles. A Kappa Probe Force universal PCR master mix was used. Primers and probes for the positive polarity DNA strands were 5' CATGAACAAGAGATGTGTAGTAGGCAGAG 3', 5' GGAGGCTGTAGGCATAAATTGG 3' and 5 '/56-FAM/CTGCGCACC/ZEN/AGCACCATGCA/3 IABKFQ. The primers and probes for the negative polarity DNA strands were 5' GCAGATGAGAAGGCACAGA3', 5' CTTCTCCGTCTGCCGTT3' and 5'/56-FAM/AGTCCGCGT/ZEN/AAAGAGAGGTGCG/3 IABKFQ. The EC for positive strand DNA was calculated using GraphPad Prism and the three-parameter variable response-to-logarithm (inhibitor) -reaction algorithm (variable-response log (inhibitor) -vertuss-response algorithm) to set the floor to zero50The value is obtained.
(4) Cytotoxicity (CC)50) And (4) a test method. Cell viability in the presence of compound was measured in HepDES19 cells using the CellTiter 96TMAQueous nonradioactive cell proliferation assay (MTS). In the absence of tetracycline, cells were plated at 1x 10 per well4The density of individual cells was seeded in 96-well plates, the compounds were applied two days later, and the cells were incubated for 3 days. The 50% Cytotoxic Concentration (CC) was calculated using GraphPad Prism and the three-parameter variable response-to-logarithm (inhibitor) -response algorithm (base set to zero)50) The value is obtained.
TABLE 2 preliminary evaluation of inhibition of HBV DNA replication and cytotoxicity by the target Compounds (dihydropyrimidine-Spirocyclic derivatives)
Figure BDA0003038892470000211
Figure BDA0003038892470000212
Figure BDA0003038892470000221
Figure BDA0003038892470000231
Figure BDA0003038892470000241
The preliminary evaluation of the in vitro anti-HBV DNA replication activity was carried out at the cellular level on 29 compounds of the synthesized dihydropyrimidine-spiro series, among which 13 compounds produced significant inhibitory effects on the expression of HBV DNA at the concentration level of 20 or 10. mu.M (the expression rate of HBV DNA is less than 50%). Re-screening the 13 compounds, establishing concentration gradient, and testing to calculate EC50And CC50The values and Selection Indices (SI) are shown in table 3.
TABLE 3 evaluation of the inhibitory Activity of Compounds of interest against HBV DNA replication and cytotoxicity
Figure BDA0003038892470000242
Figure BDA0003038892470000251
And (4) experimental conclusion analysis: the new synthesized dihydropyrimidine-spiro derivatives exhibit significant anti-HBV activity. The anti-HBV activity of 13 compounds 4a, 4b, 4c, 4f, 4i, 4j, 4l, 4M, 4n, 4o, 4p, 4q, 4r was in the range of 0.2-13.27. mu.M by primary activity screening. The compound 4r has the best activity (EC)500.2 μ M), superior to the positive control drug lamivudine, on the same order of magnitude as GLS4, and also less cytotoxic (CC)50> 100 μ M) for further investigation.

Claims (5)

1. Dihydropyrimidine-spiro derivatives are characterized by being one of the compounds with the following structures:
Figure FDA0003537535580000011
Figure FDA0003537535580000021
2. a process for preparing dihydropyrimidine-spiro derivatives according to claim 1, comprising the steps of: firstly, taking 2-thiazole formamidine hydrochloride, 2-bromo-4-fluorobenzaldehyde and ethyl acetoacetate as initial raw materials, and performing cyclization reaction by a Biginelli reaction to obtain a key intermediate 2; in a dichloromethane solution, carrying out bromination reaction on the intermediate 2 and N-bromosuccinimide to obtain an important intermediate 3; reacting the N-spiro fragment with NaH in tetrahydrofuran, and adding intermediate 3 to react with the NaH to obtain partial final product 4(a-c) or K2CO3Using KI as a catalyst, and carrying out substitution reaction with the N-spiro fragment in acetonitrile solution to obtain a partial final product 4 (d-q);
the synthetic route is as follows:
Figure FDA0003537535580000031
the reagent and the conditions are (i) 2-bromo-4-fluorobenzaldehyde, ethyl acetoacetate, sodium acetate and ethanol, and 80 ℃; (ii) n-bromosuccinimide, dichloromethane, 40 ℃; (iii) spiro fragment, sodium hydride, tetrahydrofuran, room temperature; or a spiro fragment, potassium carbonate, potassium iodide, acetonitrile, 75 ℃;
the spiro fragment is 7-oxo-2, 6-diazaspiro [3,4] octane-2-carboxylic acid tert-butyl ester, 6-oxo-2, 7-diazaspiro [4,4] nonane-2-carboxylic acid tert-butyl ester, 8-oxo-2, 7-diazaspiro [4,4] nonane-2-carboxylic acid tert-butyl ester, 2, 7-diazaspiro [3.5] nonane-2-carboxylic acid tert-butyl ester, 2, 7-diazaspiro [4.4] nonane-2-carboxylic acid tert-butyl ester, 2, 6-diazaspiro [3.4] octane-2-carboxylic acid tert-butyl ester, 2, 8-diazaspiro [4,5] decan-1-one, 2, 8-diazaspiro [4,5] decan-1, 3-dione, 2, 7-diazaspiro [4,4] nonan-3-one, 2, 8-diazaspiro [4,5] decan-3-one, 1-oxo-2, 7-diazaspiro [3.5] nonane, 2-benzyl-2, 7-diazaspiro [4.4] nonane-1, 3-dione.
3. A process for the preparation of dihydropyrimidine-spiro derivatives as claimed in claim 2, which comprises the following steps:
(1) weighing 2-thiazolecarboxamide hydrochloride, 2-bromo-4-fluorobenzaldehyde and sodium acetate, dissolving in absolute ethyl alcohol, adding ethyl acetoacetate under stirring at room temperature, and refluxing with ethanol at 80 ℃ for 8 h; after the reaction is finished, extracting, performing fast column chromatography separation, and recrystallizing to obtain a compound 2;
(2) dissolving the intermediate 2 in dichloromethane, stirring at room temperature, adding N-bromosuccinimide for multiple times in small amount, and refluxing for 1.5 h; after the reaction is finished, extracting, performing fast column chromatography separation, and recrystallizing to obtain a compound 3;
(3) dissolving different spiro fragments and sodium hydride in dry tetrahydrofuran solution, stirring at room temperature for 0.5-1h until substituted spiro is dissolved; dropwise adding a tetrahydrofuran solution of the intermediate 3, and stirring at room temperature for 0.5 h; after the reaction is finished, extracting, performing fast column chromatography separation, and recrystallizing to obtain a target compound 4 (a-c); or weighing the intermediate 3, different spiro segments, potassium carbonate and potassium iodide, dissolving in acetonitrile, and refluxing at 75 ℃ for one hour; after the reaction is finished, extracting, separating by flash column chromatography, and recrystallizing to obtain the target compound 4 (d-q).
4. Use of dihydropyrimidine-spiro derivatives according to claim 1 for the preparation of anti-HBV drugs.
5. An anti-HBV pharmaceutical composition comprising a dihydropyrimidine-spiro derivative according to claim 1 and one or more pharmaceutically acceptable carriers or excipients.
CN202110451567.0A 2021-04-26 2021-04-26 Dihydropyrimidine-spiro derivative and preparation method and application thereof Active CN113135921B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110451567.0A CN113135921B (en) 2021-04-26 2021-04-26 Dihydropyrimidine-spiro derivative and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110451567.0A CN113135921B (en) 2021-04-26 2021-04-26 Dihydropyrimidine-spiro derivative and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN113135921A CN113135921A (en) 2021-07-20
CN113135921B true CN113135921B (en) 2022-06-17

Family

ID=76812513

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110451567.0A Active CN113135921B (en) 2021-04-26 2021-04-26 Dihydropyrimidine-spiro derivative and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN113135921B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115181023B (en) * 2022-05-17 2023-07-28 东华理工大学 Spiro active plasticizer and preparation method thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068641A1 (en) * 2000-03-17 2001-09-20 Bayer Aktiengesellschaft 6-aminoalkyl-dihydropyrimidines and the use thereof as medicaments against viral diseases
CN105209470A (en) * 2013-05-17 2015-12-30 豪夫迈·罗氏有限公司 6-bridged heteroaryldihydropyrimidines for the treatment and prophylaxis of hepatitis b virus infection
CN107501257A (en) * 2017-08-17 2017-12-22 山东大学 Dihydro-pyrimidin triazole derivative and preparation method and application
CN109021015A (en) * 2018-07-12 2018-12-18 山东大学 Dihydro-pyrimidin-phosphonaminate and the preparation method and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001068641A1 (en) * 2000-03-17 2001-09-20 Bayer Aktiengesellschaft 6-aminoalkyl-dihydropyrimidines and the use thereof as medicaments against viral diseases
CN105209470A (en) * 2013-05-17 2015-12-30 豪夫迈·罗氏有限公司 6-bridged heteroaryldihydropyrimidines for the treatment and prophylaxis of hepatitis b virus infection
CN107501257A (en) * 2017-08-17 2017-12-22 山东大学 Dihydro-pyrimidin triazole derivative and preparation method and application
CN109021015A (en) * 2018-07-12 2018-12-18 山东大学 Dihydro-pyrimidin-phosphonaminate and the preparation method and application thereof

Also Published As

Publication number Publication date
CN113135921A (en) 2021-07-20

Similar Documents

Publication Publication Date Title
US10442804B2 (en) Compounds for the treatment of hepatitis B virus infection
EP3325477B1 (en) Novel tricyclic 4-pyridone-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
JP6959247B2 (en) Spiro-condensed pyrrolidine derivative as a deubiquitinating enzyme (DUB) inhibitor
US10160771B2 (en) Hepatitis C virus inhibitors and uses thereof in preparation of drugs
EP3204383B1 (en) Spirodiamine derivatives as aldosterone synthase inhibitors
EP3924055B1 (en) Substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
BR102017010009A2 (en) COMPOUNDS FOR THE TREATMENT OF HEPATITIS B VIRUS INFECTION
CN114008035A (en) SHP2 phosphatase allosteric inhibitor
JP6936815B2 (en) Heteroaromatic derivatives as NIK inhibitors
CN116942663A (en) Compounds for the treatment of HBV
CA3139940A1 (en) Tricyclic akr1c3 dependent kars inhibitors
TW202028205A (en) Tyk2 inhibitors and uses thereof
KR20180041748A (en) PARP inhibitors, processes for preparing crystalline forms and uses thereof
CN112939967A (en) Pyrazolo [1,5-a ] pyridine compound and preparation method and application thereof
CN103403010A (en) Inhibitors of polo-like kinase
WO2012087872A1 (en) Quinolines and aza-quinolines as crth2 receptor modulators
CN113135921B (en) Dihydropyrimidine-spiro derivative and preparation method and application thereof
CN117355299A (en) Substituted 2- (2, 6-dioxopiperidin-3-yl) -5- (1-piperidin-4-yl) isoindoline-1, 3-dione derivatives and uses thereof
AU2006343604A1 (en) 3,4-disubstituted coumarin and quinolone compounds
CN114591352A (en) Triazolopyridazine compound and application thereof
CN113045569B (en) Compounds useful as RET kinase inhibitors and uses thereof
TW202222797A (en) Pyrazolo[1,5-a]pyridine compound, preparation method therefor and use thereof
JP2023502675A (en) Crystal forms of nucleoprotein inhibitors and uses thereof
CN109575008B (en) FXR receptor agonists
JP2024520969A (en) Wee1 inhibitors and their uses

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant