CN113125747A

CN113125747A - High-throughput detection method and kit for protein interaction of ispLA-Seq and application thereof

Info

Publication number: CN113125747A
Application number: CN202110278036.6A
Authority: CN
Inventors: 马振毅; 刘喆; 周瑞敏; 殷曰苑; 王国斌
Original assignee: Tianjin Medical University
Current assignee: Tianjin Medical University
Priority date: 2021-03-15
Filing date: 2021-03-15
Publication date: 2021-07-16
Anticipated expiration: 2041-03-15
Also published as: CN113125747B

Abstract

The invention provides a method for in vitro screening or detecting the interaction between proteins, a detection kit and application thereof. The method comprises the following steps: 1) constructing a first recombinant expression vector comprising a cDNA library of a first tag; 2) constructing a second recombinant expression vector capable of expressing the protein to be studied containing the second tag; 3) co-transfecting the first recombinant expression vector and the second recombinant expression vector to cells, and fixing the cells after culturing for a period of time; 4) performing in-situ proximity ligation assay (isPLA) on the fixed cells prepared in the step 3), and then sorting isPLA positive cells; 5) cracking the ispLA positive cells obtained in the step 4) and then using the cells as a template, designing primers according to the upstream and downstream sequences of the foreign gene insertion site of the first recombinant expression vector to perform PCR amplification, then sequencing the PCR product, and obtaining the amino acid sequence of the interacting protein according to the sequence.

Description

High-throughput detection method and kit for protein interaction of ispLA-Seq and application thereof

Technical Field

The invention relates to a detection method of protein interaction, in particular to a method and a kit for high-throughput screening and detection of protein interaction by using an ispLA-Seq technology and application thereof.

Background

The physiological functions of cells are mostly mediated by protein-protein interactions (PPIs), so the study of molecular mechanisms of protein-protein interactions has been an important content in the field of life science and basic medicine research.

At present, several experimental methods for screening PPIs have been developed, including yeast two-hybrid, co-immunoprecipitation (co-IP), protein mass spectrometry, etc., and these experimental techniques have their own advantages and disadvantages.

The yeast two-hybrid is a mature technology which is more traditional, has the advantages of lower culture cost and low requirement on culture conditions, but also has the defects that: the interactive protein for screening bait protein in yeast cell may have a large difference from the conformation of protein of mammal in physiological state, so that partial real interaction may be lost and high false positive may be caused.

As for the co-immunoprecipitation and mass spectrometry technology, the advantages of the co-immunoprecipitation and mass spectrometry are that the protein interaction under the cell physiological condition can be truly reflected, the defects of the co-immunoprecipitation are that the transient conformation of the specific protein in the cell is difficult to reflect, some interaction proteins can be lost, and the weak transient interactions are difficult to capture, so that the false negative result is generated. In addition, the technology is not suitable for some proteins with poor solubility, such as membrane proteins, and the requirement of later-stage mass spectrometry on the technology is high, so that the technology depends on an expensive mass spectrometer and detection sensitivity, and false positive is easily caused.

Because intracellular protein conformations are in dynamic changes, these prior art techniques are more difficult to capture for some transient protein-protein interactions, and are less capable of detecting protein interactions at high throughput.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention mainly aims to provide a method for detecting the interaction between proteins in vitro, which can screen the interacting proteins in situ in a single cell, can detect the transient interaction, and has high sensitivity and low false positive rate; moreover, the method can screen the interacting protein with high flux, and has low cost and high efficiency.

Another object of the present invention is to provide a detection kit for detecting the interaction between proteins in vitro.

It is a further object of the present invention to provide the use of the above-mentioned in vitro method for detecting protein-protein interactions and the test kit for high throughput screening of protein molecules that interact with a protein to be investigated (or referred to as a bait protein).

In order to achieve the above objects, according to one aspect of the present invention, there is provided a method for in vitro detection of an interaction between proteins, comprising:

1) constructing a first recombinant expression vector comprising a cDNA library of a first tag;

2) constructing a second recombinant expression vector capable of expressing a protein to be studied (or referred to as a decoy protein) containing a second tag, wherein the second tag is different from the first tag, and the second recombinant expression vector is the same as or different from the starting vector of the first recombinant expression vector;

3) co-transfecting the first recombinant expression vector and the second recombinant expression vector to cells, and fixing the cells after culturing for a period of time;

4) performing in-situ proximity ligation assay (isPLA) on the fixed cells prepared in the step 3), and then sorting isPLA positive cells;

5) cracking the ispLA positive cells obtained in the step 4) to be used as a template, designing primers according to the upstream and downstream sequences of the foreign gene insertion site of the first recombinant expression vector to perform Polymerase Chain Reaction (PCR) amplification, then sequencing the PCR product, and identifying and obtaining the protein possibly interacting with the protein to be researched (or called bait protein) according to the sequencing result.

According to the invention, the method comprises detection for non-disease diagnostic or therapeutic purposes.

According to the present invention, the cDNA library in step 1) can be derived from mRNA of organs, tissues, cell lines or specific cell types of various organisms, and can be selected according to the type of the protein to be studied (or referred to as bait protein), the purpose of the study (e.g., understanding cells in a certain cell differentiation stage, tissue or organ formation stage, neoplasm, etc.), including but not limited to various stem cells or progenitor cells, various differentiated tissue cells (e.g., leukocytes, osteocytes, fibroblasts, vascular epithelial cells, etc.), various tumor cells (e.g., lung cancer cells, colon cancer cells, liver cancer cells, etc.), germ cells, etc. In one embodiment of the invention, the cDNA library is derived from H1 embryonic stem cells.

According to the present invention, the starting vector of said first recombinant expression vector in step 1) may be a prokaryotic or eukaryotic expression vector commonly used in the art, including but not limited to: pcDNA3.1, pCMV, pEGFP and the like, and the starting vector of the first recombinant expression vector may also carry a specific promoter. The starting vector of the first recombinant expression vector can be selected according to transfected cells to be used subsequently, and is preferably a eukaryotic expression vector commonly used in the art, and in one embodiment of the present invention, the starting vector of the first recombinant expression vector is pcDNA3.1.

According to the present invention, the first label in step 1) may be a label commonly used in the art, including but not limited to: fluorescent protein tags such as Flag, Myc, HA, S tag and GFP. In one embodiment of the invention, the first tag is Flag, Myc or HA.

According to the present invention, in one embodiment of the present invention, in step 1), mRNA of the cell is extracted to synthesize a cDNA library with a first tag, and then cloned into an expression vector pcDNA3.1 to obtain a recombinant expression vector pcDNA3.1-M1-X (M1 represents the first tag, e.g., Flag, X represents cDNA of mRNA derived from the cell) of the cDNA library with the first tag.

According to the present invention, the protein to be studied in step 2) (or referred to as bait protein) may be any protein from mammalian cells and may be selected according to the purpose of the study, including but not limited to autophagy receptor proteins SQSTM1/p62, NDP52, TAX1BP1, Optineurin, p40-phox, Cdc24, MEK5, p67-phox, Beml, Par6, MEKK2, MEKK3, TFG, aPKC, etc.

Autophagy (Autophagy) is a highly regulated in vivo cell process that uses lysosomes to eliminate protein aggregates, damaged organelles, invading pathogens, etc. to cope with internal and external cellular stresses and maintain homeostasis. Autophagy receptor proteins (autophagy receptors) are adapter proteins playing a crucial role in selective autophagy of cells, and can be used as a bridging protein to link a target substrate with an autophagosome so as to mediate the selective autophagy process of the target substrate. Numerous human diseases, such as neurodegenerative diseases, are associated with dysfunction or loss of autophagy receptor protein. In an exemplary method of the invention, the autophagy receptor protein SQSTM1/p62 was selected and proteins with which interaction is likely to occur were investigated.

According to the present invention, the starting vector of the second recombinant expression vector in step 2) may be a eukaryotic expression vector commonly used in the art, including but not limited to: pcDNA3.1, pCMV, pEGFP, etc. The starting vector for the second recombinant expression vector may be selected according to the transfected cells to be subsequently used.

According to the invention, the starting vectors of the first recombinant expression vector and the second recombinant expression vector are preferably different vectors, so that the subsequent PCR amplification can obtain specific cDNA fragments.

In one embodiment of the present invention, the starting vector of the second recombinant expression vector is pCMV-HA.

According to the present invention, the second label in step 2) may be a label commonly used in the art, including but not limited to: fluorescent protein tags such as Flag, Myc, HA, S tag and GFP. In a specific embodiment of the present invention, when the first tag is Flag, the second tag is HA. In another embodiment of the present invention, when the first tag is HA, the second tag is Flag.

According to the invention, in one embodiment of the invention, in step 2), the cDNA of the protein to be investigated carrying the second tag is cloned into the expression vector pCMV-HA, obtaining the recombinant expression vector pCMV-HA-Y of the protein to be investigated carrying the second tag (Y stands for protein to be investigated).

In one embodiment of the invention, in step 2), cDNA (NM-003900) of autophagy receptor protein molecule Sequestosome 1(SQSTM1)/p62 is cloned into expression vector pCMV-HA, and recombinant expression vector pCMV-HA-SQSTM1 of HA-tagged SQSTM1 protein is obtained.

In a specific embodiment of the invention, in step 2), the cDNA of SQSTM1 DeltaLIR with the deletion of the LIR domain is cloned into an expression vector pCMV-HA to obtain a recombinant expression vector pCMV-HA-SQSTM1 DeltaLIR.

According to the present invention, the cells used for co-transfection in step 3) may be selected from any kind of cells as long as the cells are capable of expressing the foreign proteins on the first and second recombinant expression vectors, including but not limited to mammalian cells, such as HEK293T cells.

According to the present invention, the reagent for fixing cells in step 3) may be selected from 1% paraformaldehyde, glutaraldehyde, methanol, etc., as long as the general reagent for fixing cells can be used in the present invention.

According to the present invention, in one embodiment of the present invention, in step 3), the cDNA library recombinant expression vector pcdna3.1-Flag-X and the recombinant expression vector pCMV-HA-Y were co-transfected into HEK293T cells, and after culturing for 36-72 hours, the cells were digested and then fixed with a reagent for fixing the cells.

PLA (proximity ligation assay, also known as proximity extension assay) is a proximity probe-based detection assay known in the art. The proximity probes have nucleic acid domains or labels coupled to analytes which, upon binding of the analytes to each other, interact in a proximity-dependent manner, typically by means of one or more nucleic acid duplexes, such that at least one nucleic acid domain extends from its 3' end, which extension product forms a detectable, in particular amplifiable, nucleic acid detection product or detection label. A number of commercial kits for PLA are commercially available In the art, such as the Duolink In Situ Red Starter Kit Mouse/Rabbit Kit (DUO92101, Sigma-Aldrich).

According to the invention, step 4) comprises: collecting fixed cells, treating with penetrating fluid, adding confining fluid, incubating for a period of time, adding antibody mixture containing PLA probe and directed to the label, incubating, connecting with ligase, performing rolling circle amplification, staining cell nucleus with dye, and selecting ISPLA positive cells.

According to the invention, step 4) comprises: collecting fixed cells, treating the cells with a penetrating fluid, adding a confining fluid, incubating for a period of time, adding a primary antibody mixture aiming at the two labels respectively, incubating, adding a mixture of secondary antibody PLA probe conjugates aiming at the two primary antibodies respectively, incubating, connecting with ligase, performing rolling circle amplification, lining cell nuclei with DAPI dye, and sorting ispLA positive cells.

According to the invention, in step 4), the sorting can be performed by a flow analysis method or by a laser cutting capture method, preferably by a flow analysis method.

In one embodiment of the invention, step 4), the fixed cells are collected, permeabilized with PBS containing 0.5% Triton X-100 for 10-15 minutes, incubated with blocking solution, incubated at 35-40 ℃ for 0.5-1.5 hours, then adding a mixture of the rabbit anti-HA monoclonal antibody and the mouse anti-Flag monoclonal antibody for incubation, incubating for 1-3 hours at 35-40 ℃, adding mixture of MINUS (anti-mouse) and PLUS (anti-rabbit) PLA probes, incubating at 35-40 deg.C for 1-2 hr, then using a ligation buffer solution containing ligase to perform ligation, performing ligation for 20-40 minutes at 35-40 ℃, then using an amplification buffer solution containing DNA polymerase to perform amplification for 1-3 hours at 35-40 ℃, the nuclei were then counterstained with DAPI dye, rinsed with rinse buffer, and isPLA positive cells were sorted using a flow analyzer. The rinsing buffer solution is 1% BSA,2mM EDTA, 0.1% NaN₃PBS buffer (9).

According to the invention, step 5) comprises: cracking the ispLA positive cells obtained in the step 4) and then performing PCR amplification by using the cells as a template. In one embodiment of the invention, the cells are lysed by incubating the cells in a bath of non-nucleic acid at 95-105 ℃ for 5-15 minutes. In one embodiment of the invention, the PCR primers are selected from nucleotide sequences complementary to sequences upstream and downstream of the pcDNA3.1 plasmid insertion site. In one embodiment of the present invention, the upstream and downstream primers are: 5'-GCAGAGCTCTCTGGCTAACTAGAGAAC-3', and 5'-TGACACCTACTCAGACAATGCGATGC-3'.

According to the present invention, the method may further comprise the step 6) of constructing a positive cDNA sub-library from the PCR product obtained in the step 5) using a recombinant cloning technique, and repeating the steps 1) to 5) to gradually enrich isPLA-positive cells through multiple rounds of screening.

In another aspect of the present invention, there is provided a detection kit comprising: a first recombinant expression vector, a second recombinant expression vector and a PCR primer pair; the first recombinant expression vector comprises a cDNA library with a first tag; the second recombinant expression vector can express a protein to be researched (or referred to as a decoy protein) with a second label; the PCR primer pair is complementary with the upstream and downstream sequences of the cDNA insertion site with the first label of the first recombinant expression vector; the first label and the second label are different; the starting vectors of the first and second recombinant expression vectors are the same or different.

In one embodiment of the present invention, the starting vector of the first recombinant expression vector and the starting vector of the second recombinant expression vector are both selected from pcdna3.1, the first tag is selected from Flag, and the second tag is selected from HA.

In one embodiment of the present invention, the starting vector of the first recombinant expression vector and the starting vector of the second recombinant expression vector are both selected from pcdna3.1, the first tag is selected from HA, and the second tag is selected from Flag.

In one embodiment of the invention, the starting vector of the first recombinant expression vector is selected from pcDNA3.1, the first tag is selected from Flag, and the starting vector of the second recombinant expression vector is selected from pCMV-HA.

In one embodiment of the present invention, the upstream and downstream primers of the PCR primer pair are: 5'-GCAGAGCTCTCTGGCTAACTAGAGAAC-3', and 5'-TGACACCTACTCAGACAATGCGATGC-3'.

In one embodiment of the invention, the protein to be studied is selected from SQSTM 1.

According to the present invention, the detection kit further comprises reagents for in situ proximity ligation assay (isPLA). The reagents for isPLA may be reagents known in the art for PLA assays, including, for example, antibody PLA probe conjugates directed to a first tag, antibody PLA probe conjugates directed to a second tag, ligase, ligation buffer, DNA polymerase, amplification buffer, and the like.

In one embodiment of the invention, the reagent for isPLA comprises a primary antibody against the first tag, a primary antibody against the second tag, a secondary antibody PLA probe conjugate against the two primary antibodies, respectively, a ligase, a ligation buffer, a DNA polymerase, an amplification buffer, and the like.

In one embodiment of the invention, the detection kit further comprises a primary antibody against the first tag, a primary antibody against the second tag, and the reagents for isPLA may be used in commercially available kits.

According to the invention, the detection kit further comprises cells for recombinant expression. The cell is preferably a mammalian cell.

In still another aspect of the present invention, there is provided the use of the above-described in vitro method for detecting protein-protein interactions and the test kit for high throughput screening of protein molecules that interact with a protein to be studied.

The isPLA technique recognizes proteins that bind to each other by antibodies, and maintains a transient conformation while the cells are immobilized because the interacting proteins are cross-linked by a cell fixative. When two antibodies are respectively bound to the labels connected with the two interacting proteins, the DNA oligonucleotide coupled on the antibodies starts the amplification reaction of the single-stranded DNA under the action of T4 ligase and the single-stranded DNA polymerase, and after the two interacting proteins are hybridized with the fluorescent labeled oligonucleotide probe, the combination of the two interacting proteins can be seen as a fluorescent spot under a microscope.

The invention establishes a cDNA library screening method (isPLA-Seq) based on the isPLA technology, which can identify the protein interaction at the single cell level with high sensitivity; the protein with interaction can be screened with high flux, the cost is low, and the efficiency is high; the protein interaction information can be reflected by the sequence information of the cDNAs, so that the protein interaction information is richer and more comprehensive.

Advantages of the isPLA-Seq method of the present invention include: 1) the cDNA library can be screened at high flux, the sensitivity is high, and the background is low; 2) the interacting protein can be identified by cDNA sequence information; 3) visualization of subcellular localization of interacting proteins; 4) the function of the interaction is easy to verify and evaluate; 5) the signal of the interacting protein can be quantified; 6) an ultrahigh-resolution microscope is not needed, the operation process is simpler and more convenient, and the cost is lower; 7) there is no need to physically separate cellular components.

Drawings

FIG. 1: working flow chart of ISPLA-Seq technique for screening cDNA library.

FIG. 2A: agarose gel electrophoresis images of PCR amplification products using pcDNA3.1(+) DNA, HEK293T cell and nucleic acid-free water as negative templates, respectively.

FIG. 2B FACS sorting of cells containing a positive signal for ispLA (light colored cell population in the figure, red fluorescence in the color picture), the upper panel is the control and the lower panel is the experimental group.

FIG. 2C: isPLA positive signal in HEK293T cells. The ISPLA test was performed 48 hours after HEK293 cells were cotransfected with the recombinant expression vector of the Flag-tagged cDNA library and the recombinant expression vector of the HA-tagged protein to be studied. Cells to which the anti-HA antibody coupled with the PLA probe was added alone were used as a control group, and cells to which the anti-HA and anti-Flag antibodies coupled with the PLA probe were added at the same time were used as an experimental group. The first line of PLA positive signals is light color in black-and-white picture, red dots in color picture, the second line of DAPI lines the nucleus, light color in black-and-white picture, blue color in color picture, and the third line is the picture after overlapping and fusing the first line picture and the second line picture. Scale, 10 μm.

FIG. 2D: agarose gel electrophoresis of PCR amplification products of cDNA candidate genes.

FIG. 3A: domain schematic of SQSTM1 and SQSTM1 Δ LIR. PB1, Phox-BEM1 domain; ZZ, ZZ type zinc finger domains; TB, TRAF6 binding domain; LIR, LC3 interaction region; KIR, KEAP1 interaction region; UBA, ubiquitination-related domain; PEST, protein degradation signal.

FIG. 3B: co-immunoprecipitation profile of SQSTM1 and LC3B bound to each other.

FIG. 3C: colocalization of immunofluorescent staining of SQSTM1 and LC3B binding to each other. Scale, 10 μm.

FIG. 3D: graph of isPLA analysis of SQSTM1 and LC3B binding to each other. Scale, 10 μm. In which the left panel is isPLA to verify the mutual binding of SQSTM1 and LC3B, and the right panel is a quantitative analysis by the number of red fluorescent spots. SQSTM1 deleted the LC3 interaction domain (Δ LIR) as a negative control for interaction with LC 3B. Treatment with 100mM Trehalose (Trehalose) enhances the autophagy process. Similar results were obtained in three replicates. The isPLA negative control was the addition of anti-LC 3B antibody alone.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

Unless otherwise indicated, the conventional raw materials and reagents used in the following examples are all commercially available products or may be prepared by known methods; the manipulations performed are all known in the art or performed according to the user's manual of commercially available products.

Example 1: establishment of protein interaction high-throughput screening experiments by single cell in situ proximity ligation assay (isPLA).

Materials and methods:

DAPI (D9542, Sigma-Aldrich); trehalose (T0167, Sigma-Aldrich); ECL detection reagent (32106, Thermo Fisher Scientific); IgG (AC011, murine, Abclonal).

Flag (F7425, murine monoclonal antibody, Sigma-Aldrich); HA (#7695, rabbit monoclonal antibody, Cell Signaling Technology); LC3B (L7543, rabbit polyclonal antibody, Sigma-Aldrich); SQSTM1/p62(ab56416, murine polyclonal antibody, Abcam).

Basic Seamless Cloning and Assembly Kit (CU201, total gold biotechnology limited), restriction enzymes and DNA sequencing were used to construct and validate plasmids.

Plus IIDNA Markers ((BM121, all-purpose gold Biotech Co., Ltd.), PageRuler^TMPrestained Protein Ladder (2661, Thermo Scientific) was used to show the molecular weight of DNA and Protein, respectively.

1) Constructing a first recombinant expression vector of a cDNA library with a first tag

Human H1 embryonic stem cells (ES) were supplied by Zhou Jia xi researchers (blood institute and hematology hospital, Tianjin, 300020), and extracted mRNA was synthesized into Flag-tagged cDNAs library by reverse transcription and PCR, and constructed into expression vector pcDNA3.1 plasmid by homologous recombination technique with an insertion site between BamHI/EcoRI. Wherein the DNA sequence encoding the Flag tag is: 5'-GACTACAAGGATGACGATGACAAG-3' (encoding amino acid sequence: DYKDDDDK), the connection sequence between Flag and cDNA sequence is: GGAGGCTCAGGAGGC (encoding amino acid sequence: GGSGG). Plasmid DNA was extracted after amplification in E.coli, extracted and purified using a Plasmid Midi kit (12145, Qiagen).

2) Construction of a second recombinant expression vector for expression of a protein to be investigated with a second tag

SQSTM1 cDNA (NM-003900) and SQSTM 1. DELTA. LIR cDNA (FIG. 3A) lacking the LIR domain were cloned between EcoRI/XhoI cleavage sites on pCMV-HA Plasmid, respectively, in which HA tag sequence (DNA sequence: TACCCATACGACGTCCCAGACTACGCT, coding amino acid sequence: YPYDVPDYA) was located upstream of the multiple cloning site, and Plasmid DNA was extracted after amplification in E.coli, extracted with Plasmid Midi kits (12145, Qiagen) and purified.

3) Cell transfection and fixation

HEK293T cells were purchased from the American Type Culture Collection (Manassas, Va., USA) and cultured according to the method recommended therefor. The recombinant expression vector containing the Flag-tagged cDNAs library was co-transfected with HEK293T cells with the recombinant expression vector containing HA-tagged SQSTM 1. After 48 hours of culture, HEK293T was trypsinized and fixed with 1% paraformaldehyde and used for ispa experiments.

4) isPLA experiments and flow sorting of positive cells

The isPLA experiments were performed according to the method provided In the product description, Duolink In site Red Starter Kit Mouse/rabbitt Kit (DUO92101, Sigma-Aldrich). Briefly, fixed HEK293T cells were harvested, permeabilized with PBS containing 0.5% Triton X-100 for 10 minutes, and incubated in a 1.5mL centrifuge tube with blocking solution at 37 ℃ for 1 hour. This was followed by incubation in a mixture of rabbit anti-HA monoclonal antibody and mouse anti-Flag monoclonal antibody for 1 hour at 37 ℃ followed by incubation in a mixture of MINUS (anti-mouse) and PLUS (anti-rabbit) PLA probes for 1 hour at 37 ℃. The hybridized probes were ligated with ligase-containing ligation buffer at 37 ℃ for 30 minutes, then amplified with DNA polymerase-containing amplification buffer at 37 ℃ for 100 minutes, and DAPI stained nuclei.

After ispLA, HEK293T cells were plated with 1% BSA,2mM EDTA, 0.1% NaN₃The PBS buffer (5 min. at 4 ℃ C. at 1500 rpm) was washed twice, immediately sorted using a BD FACS Aria II flow cytometer, and the data analyzed using FlowJo V10.0.7 software (Tree Star). The positive cells obtained by sorting were collected in nucleic acid-free water for PCR amplification.

5) PCR amplification and sequencing identification

The positive cells collected by flow sorting were incubated in a nucleic acid-free water at 100 ℃ for 10 minutes in a metal bath and then lysed as a template for PCR. PCR primers (5'-GCAGAGCTCTCTGGCTAACTAGAGAAC-3' and 5'-TGACACCTACTCAGACAATGCGATGC-3') complementary to sequences upstream and downstream of the pcDNA3.1 plasmid insertion site were synthesized by Invitrogen. This pair of primers can amplify a specific 404bp fragment from pcDNA3.1 plasmid (positive control), the optimal annealing temperature is 62 ℃, and the primers are verified in HEK293T cells (negative control) and nuclease-free water (blank control) (FIG. 2A). Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific) was used according to the instructions. In a 50. mu.L reaction, 500 cells were selected as templates, and the final concentration of each primer was 0.5. mu.M. The PCR step comprises: pre-denaturation at 98 ℃ for 2 minutes; amplification for 50 cycles, including denaturation at 98 ℃ for 30 seconds, annealing at 62 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute; finally, extension was continued at 72 ℃ for 10 minutes.

DNA agarose gel electrophoresis was performed according to standard methods described previously. TAE running buffer (40mM Tris-acetate, 1mM EDTA, pH 8.5) was used. Ethidium bromide (EtBr, Bio-Rad) was added to the gel at a final concentration of 0.5. mu.g/mL prior to electrophoresis, and the DNA samples were separated in the gel wells at 80V for 1.5 hours. Photographs were then taken under uv illumination in a gel imaging system. Finally, the PCR product was recovered with a gel recovery kit for DNA sequencing.

The purified PCR product was randomly fragmented using a Covaris sonicator, and then the double stranded DNA 3' end was repaired, phosphorylated, and a polyA tail was added. Subsequently, all DNA fragments were added with a sequencing linker and amplified by PCR. Sequencing is carried out on an Illumina sequencing platform, the measured data is read by Base Calling, and clean reads are obtained by screening with Fastp software.

6) Confocal microscopy analysis

HEK293T cells transiently overexpressing SQSTM1 and other genes were seeded onto poly-lysine (P4707, Sigma-Aldrich) coated coverslips in 12-well plates and after overnight incubation, the cells on the coverslips were fixed with 1% paraformaldehyde (15812, Sigma-Aldrich) for 10 minutes, washed twice with PBS buffer, and then subjected to ISPLA experiments, and finally mounted with DAPI-containing mounting media, analyzed with a Leica SP8 laser scanning confocal microscope and photographed to record the results.

7) Co-IP and Western blotting

Whole Cell lysates were lysed in a protein inhibitors cocktail table (4693132001, Roche, Basel, Switzerland) RIPA buffer (#9806, Cell Signaling Technology) using a portable tip homogenizer. The lysate was centrifuged at 12000rpm for 15 minutes to remove insoluble material. Protein concentrations were determined using the BCA protein assay kit (23250, Thermo Scientific). The supernatant was incubated with a given amount of protein G-Sepharose CL-4B beads (17-0618-01, GE Healthcare) at 4 ℃ for 30 minutes to remove non-specifically bound proteins, and then centrifuged at 12000rpm for 10 minutes to remove the protein G-Sepharose CL-4 Bbeads. The resulting supernatant was incubated overnight at 4 ℃ with the addition of a specific primary or control IgG (AC011, mouse, Abclonal) followed by 2 hours at 4 ℃ with the addition of protein G-Sepharose CL-4B beads. After 3 subsequent washes with RIPA lysate containing protease inhibitors, protein G beads were collected by centrifugation, separated by SDS-PAGE, and transferred to nitrocellulose membrane. Immunoblot analysis Western blotting with the corresponding antibodies was followed by development with an ECL detection system (32106, Thermo Scientific), exposure to x-ray film and scanning to record the exposed bands.

8) Results of the experiment

SQSTM1 is an autophagy substrate receptor that shuttles between the cytoplasm and nucleus. In cytoplasm, LIR domain (LC3-interacting region, LIR) of SQSTM1 mediates the interaction with LC3B-II, and the formed SQSTM1-LC3B-II complex mediates autophagosomal pathway degradation, provides an action platform for recycling of intracellular autophagy substrates, and is a classical autophagosomal degradation pathway. This degradation process can be enhanced by trehalose (Tre), which is commonly used as an autophagy activator. The LIR deletion mutant of SQSTM1 (DeltaLIR, 321-342aa) lost the interaction activity with LC3B and was unable to mediate autophagosomal degradation maintained by the SQSTM1-LC3B-II complex.

When the autophagy receptor protein molecule Sequestosome 1(SQSTM1)/p62 is used as a bait protein, the invention screens a Flag-tagged cDNA library from human H1 stem cells for protein molecules interacting with SQSTM1 in HEK293T cells. The present invention screened 1758 isPLA positive cells from 1000 ten thousand cells by FACS sorting and observed red fluorescent spots in the positive cells under a fluorescence microscope (fig. 2B and 2C). These molecules were co-transfected with HA-tagged SQSTM1 and transiently expressed, and the primary antibody added was antibody to both tagged proteins, respectively, so that the final result was independent of the interaction of the intracellular self-endogenous proteins. Among the co-transfected HEK293T cells, only the cells to which the anti-HA antibody coupled with the PLA probe was added were a negative control group, and did not show a positive red fluorescence signal, confirming the specificity of the result containing a red fluorescence spot isPLA positive signal (fig. 2C). The corresponding cDNA fragments were amplified with enriched isPLA positive cells and analyzed by agarose gel electrophoresis (fig. 2D), followed by DNA sequencing and bioinformatics analysis of the amplified fragments. As expected, many of the cDNAs obtained encoded known interacting proteins with SQSTM1, including MAP1LC3B (LC3B), nuclear transcription factor E2-related factor 2(NRF2 or NFE2L2), HSPA5/BiP/GRP78, SQSTM1 itself (SQSTM1 may form aggregates at some stage in the autophagy process) and some unreported cDNAs that may interact with SQSTM1, but are not functionally known (Table 1). These candidate cDNAs may provide clues and research directions for the in-depth study of SQSTM1 biological functions.

TABLE 1 candidate cDNAs that interact with SQSTM1 after ispLA-Seq screening and enrichment

The invention also verified the interaction of SQSTM1 and LC3B using three experimental methods of Co-IP, cell Co-localization and ispLA, respectively (FIGS. 3B-D). Among them, SQSTM1 lacking LIR was confirmed to completely lose binding ability to LC3B using isPLA experiments (fig. 3D), which is consistent with the experimental results known in the past. This indicates that these sequences selected from cDNAs can verify the authenticity and reliability of the interacting proteins.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting in vitro protein-protein interactions, comprising:

2) constructing a second recombinant expression vector capable of expressing a protein to be researched containing a second label, wherein the second label is different from the first label, and a starting vector of the second recombinant expression vector is the same as or different from a starting vector of the first recombinant expression vector;

4) performing an in situ proximity ligation assay (isPLA) on the fixed cells prepared in the step 3), and then sorting isPLA positive cells;

5) cracking the ispLA positive cells obtained in the step 4) and then using the cells as a PCR template, designing primers according to upstream and downstream sequences of an exogenous gene insertion site of a first recombinant expression vector for PCR amplification, and then sequencing PCR products to identify proteins possibly interacting with proteins to be researched;

preferably, the method further comprises the step 6) of constructing a positive cDNA sub-library containing the first tag using the PCR product obtained in step 5) using recombinant cloning techniques, and repeating the steps 1) to 5) to gradually enrich isPLA positive cells through multiple rounds of screening.

2. The method according to claim 1, wherein in step 1), the starting vector of the first recombinant expression vector is a eukaryotic expression vector, preferably pcDNA3.1, and the first tag is preferably Flag or HA.

3. The method according to claim 1 or 2, wherein in step 2) the starting vector of the second recombinant expression vector is a eukaryotic expression vector, preferably pcDNA3.1 or pCMV-HA, and the second tag is preferably HA or Flag.

4. The method according to any one of claims 1 to 3, wherein in step 5), the upstream and downstream primers are: 5'-GCAGAGCTCTCTGGCTAACTAGAGAAC-3', and 5'-TGACACCTACTCAGACAATGCGATGC-3'.

5. The method according to any one of claims 1 to 4, wherein in step 3) the co-transfected cells are selected from mammalian cells, preferably HEK293T cells.

6. The method according to any one of claims 1 to 5, wherein in step 4), the sorting is performed by a flow analysis method or a laser cutting capture method.

7. A kit for detecting an interaction between proteins, comprising: a first recombinant expression vector, a second recombinant expression vector and a PCR primer pair; the first recombinant expression vector comprises a cDNA library with a first tag; the second recombinant expression vector can express a protein to be researched with a second label; the PCR primer pair is complementary with the upstream and downstream sequences of the cDNA insertion site with the first label of the first recombinant expression vector; the first label and the second label are different; the starting vectors of the first and second recombinant expression vectors are the same or different;

preferably, the starting vector of the first recombinant expression vector is pcDNA3.1, and the upstream and downstream primers of the corresponding PCR primer pair are respectively: 5'-GCAGAGCTCTCTGGCTAACTAGAGAAC-3', and 5'-TGACACCTACTCAGACAATGCGATGC-3'.

8. The kit of claim 7, further comprising reagents for in situ proximity ligation assays (isplas);

preferably, the reagent for isPLA comprises a primary antibody against the first tag, a primary antibody against the second tag, a secondary antibody PLA probe conjugate against the two primary antibodies, ligase, ligation buffer, DNA polymerase, and amplification buffer.

9. Use of the method of any one of claims 1 to 6 for high throughput screening of active protein molecules interacting with a protein of interest.

10. Use of the kit of claims 7-8 for high throughput screening of active protein molecules interacting with a target protein.