CN113122657B

CN113122657B - Detection method for multiple AAV (adeno-associated virus) titer

Info

Publication number: CN113122657B
Application number: CN201911408708.XA
Authority: CN
Inventors: 吴涛; 韩芳婷; 刘武青; 曾立; 焦彦明; 陈建儒; 陈琛
Original assignee: Shanghai Jikai Gene Medical Technology Co ltd
Current assignee: Shanghai Jikai Gene Medical Technology Co ltd
Priority date: 2019-12-31
Filing date: 2019-12-31
Publication date: 2022-07-29
Anticipated expiration: 2039-12-31
Also published as: CN113122657A

Abstract

The invention relates to the technical field of biology, in particular to a method for detecting multiple AAV (adeno-associated virus) titers. The invention provides a method for detecting the titer of multiple AAV viruses, which comprises a first adeno-associated virus and a second adeno-associated virus; the detection method comprises the following steps: and obtaining the titer of the second adeno-associated virus based on the titer of the first adeno-associated virus according to the ratio of the detection signal intensities of the two viruses. In the method for detecting the titer of the multiple AAV viruses, the titer calibration fragments in different adeno-associated viruses are adopted, the first titer calibration fragment and the second titer calibration fragment can have the same polynucleotide sequence, so that the dosage and the proportion of the multiple adeno-associated viruses can be accurately adjusted and optimized, the splicing efficiency of the exogenous sequence is improved, and the expression of the target gene is maximally realized.

Description

Detection method for multiple AAV (adeno-associated virus) titer

Technical Field

The invention relates to the technical field of biology, in particular to a method for detecting multiple AAV (adeno-associated virus) titer.

Background

AAV is a DNA parvovirus, and consists of a single-stranded DNA genome of 4.7kb in length. Between ITRs at two ends of naturally existing AAV viral genome, an open reading frame containing capsid protein Rep gene and replication associated protein Cap gene is contained, Rep and Cap gene sequences are cut out from the modified AAV expression vector to insert other target gene expression frames, HEK-293T containing E1 gene is cotransfected with packaging plasmid coding Cap/Rep gene, and then virus particles with infectivity (containing DNA and capsid) can be packaged and released.

Since AAV viruses are parvoviruses, the expression vector of recombinant adeno-associated virus (rAAV), which is an effective exogenous DNA delivery vector, has the sequence encoding viral proteins between ITRs at both ends completely deleted, in addition to ITR sequences that direct the replication of the genome and assembly of the viral vector, and replaced with exogenous transgene (transgene) sequences. In addition to reducing immunogenicity and cytotoxicity associated with transgene delivery in vivo, the greatest advantage of deleting the genes encoding the viral proteins is to maximize the capacity of the recombinant AAV to carry the transgene.

However, the natural AAV viral genome is only 4.7kb, the length of the DNA sequence loaded by the modified AAV viral vector is limited to about 5kb, and the modified AAV viral vector also comprises some regulatory elements, so the AAV viral vector cannot bear the influence of some larger genes, and the application of AAV in delivering the large genes is limited due to the small packaging capacity (less than 5 kb).

The smaller packaging capacity (less than 5kb) makes AAV applications limited. The current strategy is to split the large insert into two parts and construct them separately on two separate AAV vectors. After the target cells are infected at the same time, splicing into a complete monocistron by ITR recombination, mRNA splicing or DNA homologous recombination in the target cells by utilizing a shearing signal or a homologous sequence, breaking through the bottleneck of packaging an exogenous segment of an AAV virus vector, and realizing the expression of a target protein.

Disclosure of Invention

In view of the above-described drawbacks of the prior art, it is an object of the present invention to provide a method for detecting multiple AAV virus titers, which solves the problems of the prior art.

To achieve the above and other related objects, one aspect of the present invention provides a method for detecting titers of multiple AAV viruses, the multiple AAV viruses including a first adeno-associated virus and a second adeno-associated virus;

the first adeno-associated virus comprises a first gene expression frame positioned between two ITR sequences, the first gene expression frame sequentially comprises a transcription initiation element, a first target gene segment, a first splicing donor signal segment and a first titer calibration segment in a 5 ' to 3 ' direction, and the first target gene segment is a 5 ' end segment of a target gene;

the second adeno-associated virus comprises a second gene expression frame positioned between two ITR sequences, and the second gene expression frame sequentially comprises a second titer calibration fragment, a first splice acceptor signal fragment and a second target gene fragment in the 5 'to 3' direction;

the detection method comprises the following steps:

providing a titer of a first adeno-associated virus;

and acquiring the detection signal intensity of the first adeno-associated virus and the second adeno-associated virus based on the first titer calibration fragment and the second titer calibration fragment, and acquiring the titer of the second adeno-associated virus based on the titer of the first adeno-associated virus according to the ratio of the detection signal intensities of the first adeno-associated virus and the second adeno-associated virus.

In some embodiments of the invention, the titer of the first adeno-associated virus is provided based on the transcription initiation element, and preferably, the titer of the first adeno-associated virus is obtained by primers specific for the transcription initiation element.

In some embodiments of the invention, the detection signal intensity of the adeno-associated virus is obtained by primers specific to the titer calibration fragment;

and/or, the first titer calibration fragment and/or the second titer calibration fragment is selected from the group consisting of an alkaline phosphatase gene fragment;

and/or the polynucleotide sequence of the first titer calibration fragment and/or the second titer calibration fragment comprises:

a) a polynucleotide sequence as shown in SEQ ID NO. 5; or the like, or a combination thereof,

b) a polynucleotide sequence having a sequence similarity of more than 95% to SEQ ID No.5 and having the function of the polynucleotide sequence defined in a).

In some embodiments of the invention, the multiple AAV viruses include first through N-th adeno-associated viruses, wherein N is a positive integer of not less than 3, second through N-1 adeno-associated viruses, each including an nth gene expression cassette between two ITR sequences, the nth gene expression cassette including, in a 5 ' to 3 ' direction, a 2N-2 titer calibration fragment, an N-1 splice acceptor signal fragment, an nth gene fragment of interest, an nth splice donor signal fragment, a 2N-1 titer calibration fragment, the N-associated viruses including, in a 5 ' to 3 ' direction, an nth gene expression cassette between two ITR sequences, the nth gene expression cassette including, in a 5 ' to 3 ' direction, a 2N-2 titer calibration fragment, an N-1 acceptor signal fragment, a 3 ' end fragment of the gene of interest, A transcription termination element, wherein N is a positive integer no greater than N-1 and N is not 1;

Optionally, the method further includes: acquiring the detection signal intensity of the nth adeno-associated virus and the adeno-associated virus in the previous cis position based on the nth titer calibration fragment and the titer calibration fragment in the previous cis position, and acquiring the titer of the nth adeno-associated virus based on the titer of the adeno-associated virus in the previous cis position according to the ratio of the detection signal intensity of the nth adeno-associated virus to the detection signal intensity of the previous cis position;

optionally, the method further includes: and obtaining the detection signal intensity of the N-th adeno-associated virus and the adeno-associated virus in the previous cis position based on the 2N-2 titer calibration fragment and the titer calibration fragment in the previous cis position, and obtaining the titer of the N-th adeno-associated virus based on the titer of the adeno-associated virus in the previous cis position according to the ratio of the detection signal intensities of the N-th adeno-associated virus and the adeno-associated virus in the previous cis position.

In some embodiments of the invention, the nth gene expression cassette comprises, in order from 5 'to 3', a 2 nth-2 titer calibration fragment, an nth-1 splice acceptor signal fragment, an nth gene fragment of interest, an nth splice donor signal fragment, and a 2 nth-1 titer calibration fragment;

and/or, the 2n-2 titer calibration fragment is matched with the titer calibration fragment of the previous cis position;

and/or the Nth gene expression frame sequentially comprises a 2N-2 titer calibration fragment, an N-1 splice acceptor signal fragment, a target gene 3 ' end fragment and a transcription termination element from 5 ' to 3 ';

And/or, the 2N-2 titer calibration fragment is matched to the titer calibration fragment of the previous cis.

In some embodiments of the invention, the multiplex AAV virus is a duplex AAV virus, the second gene expression cassette further comprises a transcription termination element, and the second gene segment of interest is a 3' segment of the gene of interest.

In some embodiments of the invention, the polynucleotide sequences of the first titer calibration fragment and the second titer calibration fragment are matched;

and/or the second gene expression frame sequentially comprises a second titer calibration fragment, a splicing acceptor signal fragment, a target gene 3 ' end fragment and a transcription termination element in the 5 ' to 3 ' direction.

In some embodiments of the invention, the transcription initiation element comprises a promoter and/or an enhancer, preferably, the promoter is selected from the group consisting of CMV promoters and the enhancer is selected from the group consisting of CMV enhancers.

In some embodiments of the invention, the transcription termination element is selected from polyA, preferably SV40 polyA.

In some embodiments of the invention, the first gene expression cassette further comprises a reporter gene, preferably the reporter gene is selected from EGFP.

In another aspect, the present invention provides a method for constructing a multiple AAV viral expression system, comprising:

1) Providing virus titers by the multiplex AAV virus titer detection method;

2) infecting the host cell with the adeno-associated virus according to the virus titer provided in step 1).

In some embodiments of the invention, the multiplex AAV virus is a duplex AAV virus, and the ratio of the viral load of the first adeno-associated virus to the viral load of the second adeno-associated virus is 1:1 to 1: 2.

The invention also provides an expression system, which is prepared by the construction method of the expression system.

In another aspect, the present invention provides a method for expressing a target gene, comprising: culturing the expression system under appropriate conditions to allow the expression of the target gene.

Drawings

FIG. 1 is a schematic diagram showing the construction of adeno-associated virus HD1 and adeno-associated virus HD2 according to example 1 of the present invention.

FIG. 2 is a schematic diagram showing the expression of luciferase produced by infecting HEK-293T with dual AAV in different ratios according to example 4 of the present invention.

FIG. 3A is a schematic diagram showing EGFP expression analysis of HEK-293T cells infected with the double AAV viruses of the invention.

FIG. 3B is a schematic diagram of luciferase in vivo imaging analysis of the double AAV virus caudal IV injected C57BL/6 mouse.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments, and other advantages and effects of the present invention will be apparent to those skilled in the art from the disclosure of the present specification.

Although the loading capacity of the AAV vector can be increased to 8kb and even higher by using a double AAV vector system in the prior art, when the titer of a multiple AAV vector is difficult to accurately determine and the primer for detecting the titer of the multiple AAV vector, especially the double AAV virus, the respective titers of two viruses are respectively from the primer specific to CMV and the primer specific to SV40 polyA, the primer used for detecting is close to a special structural element ITR due to the short sequence of SV40 polyA, the amplification is easy to interfere, the measurement of the titers of the two viruses is inaccurate, the ratio of the virus amount is difficult to determine, and the relative titers of the two viruses are not accurate due to the inconsistent amplification efficiency of different primers and standard products. These ultimately affect the protein expression of the gene of interest reconstituted by the splice donor signal fragment and the splice acceptor signal fragment. The inventor of the invention has completed the invention on the basis of a great deal of research and the principle of a multiple AAV vector expression system, and creatively adjusts the titer of the double viruses by calibrating the titer calibration fragment, thereby performing a series of optimization on the usage amount and the ratio of the viruses, obviously improving the splicing efficiency of foreign genes in the multiple AAV vector expression system, and realizing the effective expression of target proteins.

In a first aspect, the invention provides a method for detecting titers of multiple AAV viruses, which comprise a first adeno-associated virus and a second adeno-associated virus;

the detection method comprises the following steps:

providing a titer of a first adeno-associated virus;

In the present application, the ITR sequence (inverted terminal repeat) is generally the origin of viral DNA replication and the signal that triggers viral packaging, and is crucial for viral replication and packaging. The modified AAV expression vector has Rep and Cap gene sequence eliminated and other target gene expression cassette inserted between the ITRs in two ends of naturally existing AAV virus genome. In a specific embodiment of the invention, the first adeno-associated virus can include a first ITR sequence and a second ITR sequence, the second adeno-associated virus can include a third ITR sequence and a fourth ITR sequence, and the polynucleotide sequences of the first ITR sequence, the second ITR sequence, the third ITR sequence, and the fourth ITR sequence can each be independently selected from the group consisting of:

a) A polynucleotide sequence as shown in SEQ ID NO. 1; or the like, or a combination thereof,

b) a polynucleotide sequence having a sequence similarity of more than 95% to SEQ ID NO.1 and having the function of the polynucleotide sequence defined in a). Specifically, the polynucleotide sequence in b) specifically refers to: the polynucleotide fragment having the function of the DNA fragment represented by the polynucleotide SEQ ID No.1, for example, a function as an origin of viral DNA replication and a signal triggering viral packaging, which is obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the polynucleotide sequence represented by SEQ ID No.1, or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the N-terminus and/or C-terminus. The polynucleotide sequence in b) may have more than 80%, 85%, 90%, 93%, 95%, 97%, or 99% similarity to SEQ ID No. 1.

In the present application, suitable methods for dividing the target gene into different adeno-associated viruses for expression in the multiple AAV viruses are known to those skilled in the art, and are generally considered in terms of viral envelope size, split site in two adjacent exons, etc.

In the method for detecting the titer of the multiple AAV viruses provided by the present invention, the multiple AAV viruses may generally include a plurality of adeno-associated viruses, and specifically, may be, for example, two adeno-associated viruses, i.e., constitute a dual AAV virus, each adeno-associated virus in the multiple AAV viruses may generally include different segments of a target gene, and may reconstruct the entire target gene by splicing the donor signal segment and the acceptor signal segment after infecting a suitable host cell and forming a suitable expression system, and may further express a related protein. When the multiple AAV virus is a dual AAV virus, the dual AAV virus includes the above-mentioned first adeno-associated virus and second adeno-associated virus, the second gene expression cassette may further include a transcription termination element, the second target gene segment may be a 3 ' segment of the target gene, and the 5 ' segment of the target gene and the 3 ' segment of the target gene may form a complete target gene. In one embodiment of the invention, the polynucleotide sequences of the first titer calibration fragment and the second titer calibration fragment are matched. In the present invention, the match between titer calibration fragments generally means that the polynucleotide sequences of the titer calibration fragments are identical or substantially identical and are the same or similar distance from the ITS sequences. In a specific embodiment of the present invention, the second gene expression cassette sequentially comprises a second titer calibration fragment, a splice acceptor signal fragment, a 3 ' end fragment of the target gene, and a transcription termination element in a 5 ' to 3 ' direction.

In the method for detecting the titer of the multiple AAV viruses provided by the present invention, the multiple AAV viruses may generally include a plurality of adeno-associated viruses, and specifically may be, for example, three, four, five, or more adeno-associated viruses, each adeno-associated virus in the multiple AAV viruses may generally include different segments of the target gene, and may reconstruct the entire target gene by splicing the donor signal segment and the acceptor signal segment after infecting a suitable host cell and forming a suitable expression system, and may further express the related proteins. Specifically, the multiple AAV viruses may include a first adeno-associated virus to an nth adeno-associated virus, where N is a positive integer not less than 3, and the second adeno-associated virus to the N-1 adeno-associated virus may each include an nth gene expression cassette located between two ITR sequences, where N is a value corresponding to the sequence number of the adeno-associated virus, and the nth gene expression cassette includes a 2N-2 titer calibration fragment, an N-1 splice acceptor signal fragment, an nth target gene fragment, an nth splice donor signal fragment, and a 2N-1 titer calibration fragment in a 5 'to 3' direction. For example, when N ═ 3, the multiplex AAV virus may comprise a second adeno-associated virus comprising a 2 nd titer calibrator, a 1 st splice acceptor signal, a 2 nd gene of interest fragment, a 2 nd splice donor signal, a 3 rd titer calibrator; as another example, when N ═ 4, the multiplex AAV virus may comprise a third adeno-associated virus comprising a 4 th titer calibrator, a 2 nd splice acceptor signal, a 3 rd gene of interest, an nth splice donor signal, a 5 th titer calibrator. The Nth adeno-associated virus comprises an Nth gene expression cassette positioned between two ITR sequences, wherein the Nth gene expression cassette comprises a 2N-2 titer calibration fragment, an N-1 splicing acceptor signal fragment, a 3 ' end fragment of a target gene and a transcription termination element according to the 5 ' to 3 ' direction, wherein N is a positive integer not more than N-1, and N is not 1. For example, when N ═ 3, the multiplex AAV virus can include a 3 rd adeno-associated virus, the 3 rd gene expression cassette comprising in the 5 ' to 3 ' direction a 4 th titer calibrator fragment, a 2 nd splice acceptor signal fragment, a 3 ' end fragment of the gene of interest, a transcription termination element; as another example, when N-4, the multiplex AAV virus may comprise a 4 th adeno-associated virus, the 4 th gene expression cassette comprising in the 5 ' to 3 ' direction a 6 th titer calibrator, a 3 rd splice acceptor signal, a 3 ' end segment of the gene of interest, a transcription termination element. For the second adeno-associated virus to the N-1 adeno-associated virus, the 2N-2 titer calibration fragment can be matched with the titer calibration fragment of the previous cis position, so that the detection signal intensity of the nth adeno-associated virus and the adeno-associated virus of the previous cis position can be obtained based on the 2N-2 titer calibration fragment and the titer calibration fragment of the previous cis position, and the titer of the nth adeno-associated virus can be obtained based on the titer of the adeno-associated virus of the previous cis position according to the ratio of the detection signal intensity of the nth adeno-associated virus to the titer calibration fragment of the previous cis position. In a specific embodiment of the invention, the nth gene expression cassette comprises a 2 nth-2 titer calibration fragment, an nth-1 splice acceptor signal fragment, an nth target gene fragment, an nth splice donor signal fragment and a 2 nth-1 titer calibration fragment in sequence from 5 'to 3'. For the N adeno-associated virus, the 2N-2 titer calibration fragment is matched with the titer calibration fragment of the previous cis position, so that the detection signal intensity of the N adeno-associated virus and the adeno-associated virus of the previous cis position can be obtained based on the 2N-2 titer calibration fragment and the titer calibration fragment of the previous cis position, and the titer of the N adeno-associated virus is obtained based on the titer of the adeno-associated virus of the previous cis position according to the ratio of the detection signal intensity of the N adeno-associated virus and the detection signal intensity of the 2N-2 titer calibration fragment. In a specific embodiment of the invention, the Nth gene expression cassette sequentially comprises a 2N-2 titer calibration fragment, an N-1 splice acceptor signal fragment, a 3 ' end fragment of a target gene and a transcription termination element in a 5 ' to 3 ' direction.

In the method for detecting the titer of the multiple AAV viruses provided by the invention, each adeno-associated virus generally comprises an AAV expression vector, so that multiple AAV viruses can be constructed to infect host cells to construct an expression system. One skilled in the art can select an appropriate method for constructing adeno-associated virus comprising an AAV expression vector by AAV expression vector, respectively. For example, a first adeno-associated virus comprising a first AAV expression vector, which typically includes sequences between two ITRs that are identical to the first adeno-associated virus (including ITR sequences), and a second adeno-associated virus comprising a second AAV expression vector, which typically includes sequences between two ITRs that are identical to the second adeno-associated virus (including ITR sequences), can be constructed from the first AAV expression vector and the second AAV expression vector, respectively. For another example, the AAV expression vector can be used in conjunction with a helper plasmid to co-transfect a packaging cell, thereby obtaining an adeno-associated viral packaging system comprising the AAV expression vector. The helper plasmid may include pHelper plasmid (adenovirus helper plasmid pheelper), RC plasmid (plasmid including cap gene and rep gene), and the like. The packaging cells may be various types of packaging cells suitable for packaging of adeno-associated viruses, and in general, these packaging cells are of a type susceptible to infection by baculovirus, and the packaging cells used may be insect cells and the like, more specifically, Highfive, Sf9, Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, BM-N, Ha2302, 2302 Hz2E5, and Ao38, and the like, and the packaging cells used may be mammalian cells, more specifically, HEK293, HeLa, CHO, NS0, SP2/0, PER. C6, Vero, RD, BHK, HT1080, A549, Cos-7, ARPE-19, C-5 cells, and the like.

Further, the AAV is obtained by culturing the AAV packaging system under suitable conditions to express the desired protein and packaging, followed by isolation and purification to provide the first AAV or the second AAV. The first and/or second adeno-associated virus can be a serotype of adeno-associated virus, e.g., the serotype of the first and second adeno-associated virus can each be independently selected from AAV1, AAV2, AAV3b, AAV3b-st, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAVrh74, AAVAnc80L65, aav2.7m8, AAVDJ, retro AAV, aavphp.eb, aavphp.s, aaven, and AAVMG, and the like.

In the method for detecting the titer of a multiple AAV provided by the invention, the method for providing the titer of a first adeno-associated virus is known to those skilled in the art, for example, the first gene expression cassette of the first adeno-associated virus can generally comprise a fragment for detecting the titer of a virus, and the fragment for detecting the titer of a virus is generally a longer fragment and is further away from the ITR sequence, so that the amplification process is not easily interfered by the surrounding sequences, and the titer of the first adeno-associated virus obtained by a primer specific to a transcription initiation element generally has better accuracy. For example, a fragment for detecting viral titer can be a transcription initiation element, i.e., the titer of the first adeno-associated virus can be obtained based on the transcription initiation element; as another example, the titer of the first adeno-associated virus can be obtained by primers specific for the transcription initiation element. The method for obtaining the titer of the first adeno-associated virus by means of primers specific for the transcription initiation element should be known to the person skilled in the art, for example, the method used can be quantitative fluorescence PCR or the like.

In the method for detecting multiple AAV virus titers provided by the present invention, the first titer calibration fragment is generally used to obtain the detection signal intensity of the first adeno-associated virus, i.e. the detection signal intensity of the first adeno-associated virus is obtained based on the first titer calibration fragment, and the detection signal intensity generally reflects the viral load of the first adeno-associated virus. In particular, the intensity of the detection signal of the first adeno-associated virus can be obtained by calibrating the fragment specifically for the first titer, which methods should be known to the person skilled in the art, e.g. the method used can be fluorescence quantitative PCR or the like, and for example the intensity of the detection signal obtained can generally be fluorescence intensity or the like. In one embodiment of the present invention, the first titer calibration fragment and the second titer calibration fragment may have the same polynucleotide sequence, and the titer calibration fragment is the same or similar to the nearest ITR in each adeno-associated virus, so as to ensure that the two experimental conditions are consistent during the acquisition of the detection signal intensity, for example, the polynucleotide sequence of the first titer calibration fragment may include the sequence shown in SEQ ID No. 5.

In the method for detecting the titer of the multiplex AAV virus provided by the present invention, the second titer calibration fragment is generally used to obtain the detection signal intensity of the second adeno-associated virus, i.e. the detection signal intensity of the second adeno-associated virus is obtained based on the second titer calibration fragment, and the detection signal intensity generally reflects the viral load of the second adeno-associated virus. In particular, the detection signal intensity of the second adeno-associated virus can be obtained by primers specific for the second titer calibration fragment, and such methods should be known to those skilled in the art, for example, the method used can be fluorescence quantitative PCR or the like, and for example, the obtained detection signal intensity can generally be fluorescence intensity or the like. In an embodiment of the present invention, the second titer calibration fragment is matched with the first titer calibration fragment to ensure that the two experimental conditions are as consistent as possible during the process of obtaining the detection signal intensity. In another embodiment of the invention, the polynucleotide sequence of the second titer calibration fragment can comprise the sequence shown in SEQ ID No. 5.

In the method for detecting the titer of the multiple AAV viruses provided by the present invention, the method may further include: and obtaining the titer of the second adeno-associated virus based on the titer of the first adeno-associated virus according to the ratio of the detection signal intensity of the first adeno-associated virus and the second adeno-associated virus. As described above, the method for obtaining the detection signal intensities of the first and second adeno-associated viruses by using the primers specific to the first and second titer calibration fragments should be known to those skilled in the art, and the experimental conditions should be as consistent as possible during the process of obtaining the detection signal intensities of the first and second titer calibration fragments, so as to ensure that there is a correlation between the titer of the first adeno-associated virus and the titer of the second adeno-associated virus reflected by the first and second titer calibration fragments, for example, the titer of the first adeno-associated virus and the titer of the second adeno-associated virus should be substantially equal under the condition that the detection signal intensities of the two titer calibration fragments are substantially the same. Since the titer of the first adeno-associated virus is accurate, the titer of the second adeno-associated virus can be obtained based on the titer of the first adeno-associated virus based on the relationship between the detection signal intensity reflected by the titer of the first adeno-associated virus and the detection signal intensity reflected by the titer of the second adeno-associated virus.

In the method for detecting the titer of the multiple AAV viruses provided by the invention, in the multiple AAV viruses, the 2n-2 titer calibration fragment is usually used for obtaining the detection signal intensity of the nth adeno-associated virus, i.e. the detection signal intensity of the nth adeno-associated virus is obtained based on the 2n-2 titer calibration fragment, and the detection signal intensity can usually reflect the viral load of the nth adeno-associated virus; the 2N-2 titer calibration fragment is generally used to obtain the detection signal intensity of the N-th adeno-associated virus, i.e., the detection signal intensity of the N-th adeno-associated virus is obtained based on the 2N-2 titer calibration fragment, and the detection signal intensity generally reflects the virus amount of the N-th adeno-associated virus. Specifically, the detection signal intensity of the nth adeno-associated virus or the nth adeno-associated virus can be obtained by primers specific for the 2N-2 titer calibration fragment or the 2N-2 titer calibration fragment, which should be known to those skilled in the art, for example, the method used can be fluorescence quantitative PCR or the like, and for example, the obtained detection signal intensity can be generally fluorescence intensity or the like. In a specific embodiment of the invention, the 2n-2 titer calibration fragment is matched with the titer calibration fragment of the previous cis position to ensure that the two experimental conditions are as consistent as possible in the process of obtaining the detection signal intensity. In another embodiment of the present invention, the 2N-2 titer calibration fragment is matched with the titer calibration fragment of the previous cis position to ensure that the two experimental conditions are as consistent as possible during the process of obtaining the detection signal intensity. In another embodiment of the invention, the polynucleotide sequence of the second titer calibration fragment can comprise the sequence shown in SEQ ID No. 5.

In the method for detecting titer of multiple AAV viruses provided by the present invention, the multiple AAV viruses may further include: and obtaining the titer of the nth adeno-associated virus or the titer of the nth adeno-associated virus based on the titer of the adeno-associated viruses of the previous cis position according to the ratio of the intensity of the detection signals of the 2N-2 adeno-associated virus to the intensity of the detection signals of the adeno-associated viruses of the previous cis position and the 2N-2 adeno-associated virus to the intensity of the detection signals of the adeno-associated viruses of the previous cis position. As described above, the method for obtaining the detection signal intensity of the 2N-2 adeno-associated virus and the adeno-associated virus in the previous cis position, or the detection signal intensity of the 2N-2 adeno-associated virus and the adeno-associated virus in the previous cis position, respectively, by specifically targeting the primer of the 2N-2 titer calibration fragment and the titer calibration fragment in the previous cis position, or the primer of the 2N-2 titer calibration fragment and the titer calibration fragment in the previous cis position, should be known to those skilled in the art, and the experimental conditions should be as consistent as possible during the process of obtaining the detection signal intensity of the two, so as to ensure the correlation between the titer of the nth adeno-associated virus reflected by the 2N-2 titer calibration fragment and the titer calibration fragment in the previous cis position and the titer of the adeno-associated virus in the previous cis position, or, there is a correlation between the titer of the N adeno-associated virus reflected by the 2N-2 titer calibration fragment and the titer calibration fragment of the previous cis position and the titer of the adeno-associated virus of the previous cis position. For example, in the case that the signal intensity of the two detection signals is substantially the same, the titer of the nth adeno-associated virus and the titer of the adeno-associated virus in the immediately preceding cis position should be substantially equal; for another example, the titer of the nth adeno-associated virus and the titer of the adeno-associated virus immediately preceding the nth adeno-associated virus should be substantially equal to each other when the detection signal strength is substantially the same. Since the titer of the adeno-associated virus in the previous cis position is accurately measured, the titer of the nth adeno-associated virus or the nth adeno-associated virus can be obtained based on the titer of the adeno-associated virus in the previous cis position on the basis of knowing the relationship between the detection signal strength reflected by the titer of the adeno-associated virus in the previous cis position and the detection signal strength reflected by the titer of the nth adeno-associated virus or the relationship between the detection signal strength reflected by the titer of the adeno-associated virus in the previous cis position and the detection signal strength reflected by the titer of the nth adeno-associated virus.

In the method for detecting the titer of multiple AAV viruses provided by the present invention, in the first adeno-associated virus, the transcription initiation element is usually a DNA fragment of a foreign gene for RNA polymerase to recognize, bind and initiate transcription, or a fragment for enhancing the expression of a target gene. The transcription initiation element may be any of various transcription initiation elements that can be adapted to the adeno-associated virus technology, for example, the transcription initiation element may include an enhancer, and the like, and specifically may be a CMV enhancer, and the like; as another example, the transcription initiation element may include a promoter and the like, and specifically may be a CMV promoter and the like. In a specific embodiment of the present invention, the transcription initiation element may sequentially comprise an enhancer and a promoter in a 5 'to 3' direction, the polynucleotide sequence of the enhancer comprises the sequence shown in SEQ ID NO.2, and the polynucleotide sequence of the promoter comprises the sequence shown in SEQ ID NO. 3.

In the present application, the splice donor signal fragment generally refers to sequences on both sides of the cleavage site and the splicing site of the target gene, and is referred to as a splice donor signal fragment on the right side (3' end) of the intron. The splice donor signal fragment is typically used to mate with a splice acceptor signal fragment of the same order in which it is positioned, such that the gene of interest is reconstituted by the splice donor and the splice acceptor signals. In one embodiment of the present invention, the polynucleotide sequence of the splice donor signal fragment includes the sequence shown in SEQ ID NO. 4.

In the present application, the splice acceptor signal fragment generally refers to sequences on both sides of the cleavage site and the splicing site of the target gene, and the junction on the left side (5' end) of the intron is referred to as a splice acceptor signal fragment. The splice acceptor signal fragment is typically used in conjunction with a splice donor signal fragment that is co-located with the splice acceptor signal fragment such that the gene of interest is reconstituted by the splice donor and the splice acceptor signals. In one embodiment of the present invention, the polynucleotide sequence of the splice acceptor signal fragment includes the sequence shown in SEQ ID No. 6.

In the present application, the transcription termination element is generally used for termination of transcription after the target gene and tag. The transcription termination element may be any suitable transcription termination element for adeno-associated viruses, for example, the transcription termination element may be generally selected from hGH polyA, SV40 polyA, HSVtk polyA, and the like. In one embodiment of the invention, the polynucleotide sequence of the transcription termination element comprises the sequence shown in SEQ ID NO. 7.

In the method for detecting the titer of the multiple AAV viruses provided by the invention, in the first adeno-associated virus, the first gene expression cassette further comprises a reporter gene, and the reporter gene generally refers to a type of gene which can be expressed under specific conditions of cells, tissues/organs or individuals and enables the cells, the tissues/organs or the individuals to generate characters which are easy to detect and cannot be generated by experimental materials. The reporter gene may be any of various reporter genes suitable for adeno-associated virus, for example, the reporter gene may be selected from a combination of one or more of EGFP and the like. The reporter gene may be located generally between the transcription initiation element and the 5' segment of the gene of interest. In a specific embodiment of the present invention, the polynucleotide sequence of the reporter gene comprises the sequence shown in SEQ ID NO. 8.

The second aspect of the invention provides a method for constructing a multiple AAV virus expression system, which comprises the following steps:

1) providing a titer of a virus by the method for detecting a titer of a multiplex AAV virus provided by the first aspect of the invention;

2) infecting the host cells with the adeno-associated virus according to the virus titer provided in step 1). After obtaining the titer of at least part of the adeno-associated virus in the multiple AAV system, the adeno-associated virus can be infected into the host cell in a proper ratio. The target gene is reconstituted in the cell by the splice donor signal fragment and the splice acceptor signal fragment. In a specific embodiment of the invention, the multiple AAV virus is a dual AAV virus, and the ratio of the viral load of the first adeno-associated virus to the viral load of the second adeno-associated virus is 1: 1-1: 2, 1: 1-1: 1.2, 1: 1.2-1: 1.4, 1: 1.4-1: 1.6, 1: 1.6-1: 1.8, or 1: 1.8-1: 2.0. Suitable transfection methods will be known to those skilled in the art, for example, the host cells used may generally be eukaryotic cells, more specifically mammalian cells and the like, and more specifically HEK293, CHO and the like.

The third aspect of the invention provides an expression system, which is prepared by the construction method of the expression system provided by the first aspect of the invention.

The fourth aspect of the present invention provides a method for expressing a target gene, comprising: culturing the expression system provided by the second aspect of the invention under suitable conditions to allow expression of the gene of interest. Suitable methods for expressing a target gene by the above expression system will be known to those skilled in the art, and for example, the above expression system may be cultured at 37 ℃ under 5% carbon dioxide to express a protein corresponding to the target gene, followed by isolation and purification to provide the protein corresponding to the target gene.

Primers for detecting respective titers of two viruses in a multiple AAV vector expression system are respectively from primers specifically aiming at CMV and SV40 polyA, the position of the primer used for detection is close to a special structural element ITR due to the short sequence of SV40 polyA, amplification is easily interfered, and the relative titers of the two viruses are possibly not accurate due to the fact that the theoretical viral load of a double virus system is 1:1 and the amplification efficiencies of different primers and standard products are not consistent. In the method for detecting the titer of the multiple AAV viruses, the titer calibration fragments in different adeno-associated viruses can have the same polynucleotide sequence, and the titer calibration fragments have the same or similar distance to the ITR in each adeno-associated virus, so that the accurate adjustment and optimization of the dosage and proportion of the multiple adeno-associated viruses can be realized, the splicing efficiency of an exogenous sequence is improved, and the expression of a target gene is realized to the maximum extent. The method for detecting the titer of the multiple AAV vectors can be used for systems of double viruses, triple virus Hybrid AAV and the like, and has good industrialization prospect.

The invention of the present application is further illustrated by the following examples, which are not intended to limit the scope of the present application.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring Harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, SanDiego, 1998; (iii) METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

Example 1

Construction of adeno-associated Virus HD1 and adeno-associated Virus HD2

For exogenous DNA sequences that are to be delivered by AAV and have a sequence length of more than 5kb, appropriate splicing sites are selected, artificially divided into two parts, a 5 'end part and a 3' end part, and constructed into a double AAV viral vector (Stratagene) according to the principle of the arrangement of 5 '-ITR-promoter-5' end insertion DNA (5 'CDS) -splicing signal (AP) -3' -ITR and 5 '-ITR-splicing signal-3' end insertion DNA (3 'CDS) -poly A-3' -ITR, respectively.

Packaging AAV virus: HEK-293T cells were co-transfected using a three plasmid vector system to generate AAV viruses, the three plasmids including the vector plasmid pHelper, the RC plasmid and shuttle vector HD1 (element sequence CMV-EGFP-5 'CDS-SD-AP, corresponding to virus HD1, SEQ ID NO.9), or shuttle plasmid HD2 (AP-SA-3' CDS-SV40 polyA, corresponding to virus HD2, SEQ ID NO.10), the two shuttle plasmid element sequence diagram being shown in FIG. 1. And respectively preparing the double AAV viral vectors comprising a 5 ' end part and a 3 ' end part, wherein the EGFP fluorescence intensity of the hd 15 ' end is used for observing the cell level, the splicing generation efficiency is on the level, and after correct splicing, the luciferase sequence is completely spliced and can be detected and analyzed by the luciferase activity.

Example 2

Production of AAV Virus

The AAV virus packaging process includes the following steps:

1) HEK-293T cell culture:

HEK293T cells were thawed to 100mm dishes and cultured in DMEM containing 10% FBS at 37 ℃ in a 5% CO2 incubator. When the cell confluency reaches 90%, the cells can be passaged according to the specific experimental arrangement according to the proportion of 1:3 or 1: 6-1: 8, and plasmid transfection can be carried out when the cell confluency reaches 70-80%.

2) Transfection of HEK-293T cells:

preparing a transfection system: to a 50mL centrifuge tube was added OMEM medium (750. mu.L/dish), followed by Vector target plasmid (5. mu.g/dish), pHelper Vector plasmid KL4195 (5. mu.g/dish) and "RC" Vector plasmid (5. mu.g/dish), gently mixed using a vortex shaker, after mixing, 1 XPEI solution (PEI: DNA ═ 3: 1) was added, and gently mixed again on a vortex shaker. Standing at room temperature for 15 min. Checking the cells to be transfected before transfection, wherein the confluence needs to reach 70-80%; the prepared transfection system is added into a culture dish drop by drop according to the amount of 1 mL/dish, and the mixture is placed into an incubator at 37 ℃ and 5% CO2 for culture after being fully and uniformly mixed. 6h after transfection, the medium in the dish was replaced with 10ml of fresh medium; the dish was returned to the incubator and incubated for an additional 66-72 hours.

3) And (3) toxin collection:

viral particles are present in both the packaging cells and the culture supernatant. Both cells and culture supernatant were collected for best yield. After transfection for 48h, the medium supernatant was collected by an electronic pipette into a 50mL centrifuge tube and stored temporarily at 4 ℃.

After 96h of transfection, the mixture of medium supernatant and cells was collected by an electropipettor into a 50mL centrifuge tube.

And (II) purifying AAV virus particles, namely purifying and concentrating AAV virus stock solution obtained after transfection by using a method combining iodixanol density gradient centrifugation and ultrafiltration, wherein the specific process is as follows:

1) concentration of AAV viruses

1. 40% PEG8000 was added to the supernatant to a final concentration of 8%, and after standing on ice for 2 hours (mixed every 15 minutes), centrifuged at 2,500 Xg for 30 minutes. Removing the supernatant, resuspending the precipitate with PBS, and mixing with cell lysis supernatant;

2.3,000 Xg for 30 minutes, the supernatant was transferred to another clean tube. At this point, there should be visible cell debris in the supernatant. If partial debris still exists, centrifuging again;

3. residual plasmid DNA (final concentration of 50U/ml) was removed by digestion with Benzonase nuclease. Invert several times to mix well. Incubation at 37 ℃ for 30 min;

4. The mixture was filtered through a 0.45 μm filter head, and the filtrate was taken out.

2) Purification of AAV

1. Adding solid CsCl into the virus concentrated solution until the density is 1.41g/ml (the refractive index is 1.372), adding 6.5g CsCl into about 10ml virus solution, and shaking to dissolve the CsCl, wherein the dissolved CsCl absorbs heat and cools;

2. adding the sample into an ultracentrifuge tube, and filling the residual space of the centrifuge tube with a pre-prepared 1.41g/ml CsCl solution;

3. centrifugation was carried out at 175,000g for 24 hours to form a density gradient. Samples of different densities were collected in sequential fractions, and titers were determined in - lines. Collecting the fraction enriched in AAV particles;

4. the above process is repeated once.

3) Desalination by ultrafiltration

1. Leaching: 4ml of deionized water is added into an Amicon-15 ultrafiltration device;

2. the virus solution obtained by density gradient centrifugation is added into an ultrafiltration device. Adding PBS to make the total volume be 4ml, and covering the cover;

note that if an angular rotator is used, the maximum volume cannot exceed 3.5ml

3.1,500 Xg for about 5 to 10 minutes, every 5 minutes check the remaining volume, until the tissue volume is 200-;

4. collecting the filtrate for sterilization, and returning the filter membrane to the device;

5. the concentrated virus was diluted with 1 XPBS to a volume of 4 ml;

6. Repeating the above process for 3 times;

7. the ultrafiltration tube was centrifuged to a final volume of approximately 0.5 ml.

4) Preservation of viruses

Glycerol was added to the virus concentrate to make the tissue concentration 5%. Subpackaging and storing at-80 ℃.

Example 3

AAV virus titer determination

And (3) performing titer detection on the purified and concentrated AAV virus solution by using a fluorescent quantitative PCR method for guiding subsequent infectivity test. The method comprises the following specific steps:

and (3) establishing a standard curve by using the plasmid as a standard substance, and comparing the sample to be detected with the standard curve to obtain the titer of the sample to be detected.

The specific operation steps are as follows:

1. sample processing 20. mu.L of virus was taken into a clean 1.5mL centrifuge tube, 1. mu.L of totipotent enzyme was added, mixed well and placed in a 37 ℃ water bath for 30 min. Centrifuge at 12000rpm for 10min at 4 ℃. After centrifugation, 10. mu.L of the supernatant was added to another clean centrifuge tube, 90. mu.L of dilution buffer was added, and after mixing, the mixture was placed in a 37 ℃ water bath for 30 min. Naturally cooling, adding 1 mu L of proteinase K, uniformly mixing, and then placing in a water bath at 65 ℃ for incubation for 1 h. The cells were incubated in a water bath at 95 ℃ for 20min to inactivate proteinase K. And taking out the sample tube, and putting the sample tube into a refrigerator at 4 ℃ for cooling.

2. Dilution of the sample: and (3) sucking 10 mu L of AAV sample stock solution to be detected into a first centrifuge tube, uniformly mixing for 2-3s by using a vortex oscillator, taking 10 mu L of AAV sample stock solution out of the first centrifuge tube, adding the AAV sample stock solution into a second centrifuge tube, and repeating the steps to obtain 4 diluted samples, wherein all samples are used as templates and enter quantitative PCR. Aiming at the gradient dilution of the same sample, the mode of sucking the sample each time and the time of shaking, uniformly mixing and centrifuging are ensured to be consistent.

3. Dilution of plasmid standards: in the same dilution mode of the sample, the plasmid standard substance is diluted by 10 times in a gradient manner from 101 times to 109 times, and 8 plasmid samples are taken as templates to enter quantitative PCR. (Standard calculation formula ═ Conc/(MW per bp Vector Size). Avogadro constant/Dilution Factor)

4, preparing a PCR reaction system according to the specification of a SYBR Green kit;

5. putting the sample tubes into a fluorescent quantitative PCR instrument according to a certain sequence by a computer, and setting according to the following program: 10min at 95 ℃; 15S at 95 ℃, 20S at 55 ℃, 20S at 72 ℃ and 40 cycles; 95 ℃ for 1min, 55 ℃ for 30S and 95 ℃ for 30S.

6. And obtaining a standard curve according to the logarithm value of the concentration of the standard substance and the Ct average value after obtaining the Ct value data. The concentration of other samples can be calculated according to a standard curve;

7. the final value of the concentration of the sample to be tested is obtained by dividing the measurement by the dilution and multiplying by 2, where 2 is multiplied because the standard is double stranded and the AAV viral particles are single stranded.

8. And averaging the titers obtained by measuring the viruses with different dilutions to obtain the final concentration of the viruses.

Detection of titer of adeno-associated virus HD 1: QPCR detection was performed with CMV-F and CMV-R primers as described above. The primer sequence is CMV-F: TATTAGTCATCGCTATTACC (SEQ ID NO.11), CMV-R: TGAGTCAAACCGCTATCC (SEQ ID NO. 12).

Dual AAV virus titers were calibrated by AP primers: in this step we simultaneously tested the two virus titers by supplementing the AP primers, resulting in a ratio of the two virus titers. The AP primer sequence is AP-F: ACCCGTCTGTGACCCATCTC (SEQ ID NO.13), AP-R: AGGGCAGCCTCTGTCATCTC (SEQ ID NO. 14).

Then, the titer of the adeno-associated virus HD2 is adjusted based on the titer of the adeno-associated virus HD1, and a more accurate result of the relative titer of the two viruses is obtained. The quantitative calibration titers and the AP corrected titers are shown in Table 1.

The accuracy of AP corrected titers was verified with AAV2 standard (RSM). Performing recombinant virus titer detection by AAV2 standard fluorescent quantitative detection method, wherein the primer sequence is ITR-F: CGGCCTCAGTGAGCGA, ITR-R: GGAACCCCTAGTGATGGAGTT, the probe sequence is: CACTCCCTCTCTGCGCGCTCG are provided. The reaction system was 20ul, the working concentration of primers and probes was 100nM, and the settings were performed according to the following procedure: 10min at 95 ℃; 10S at 95 ℃, 20S at 60 ℃, 25S at 72 ℃ and 40 cycles; 95 ℃ for 1min, 55 ℃ for 30S and 95 ℃ for 30S. The calibration titers are shown in Table 1. From the calibration titer result, the ratio of the ITR primer to the AP primer calibration result is close to that of the two viruses, and compared with the existing detection method using plasmids containing different detection primer templates as standard products, the titer is more accurate after the titer correction is carried out on the consensus sequence AP.

TABLE 1

Example 4

Comparison of foreign Gene splicing efficiency of Dual AAV viruses of different ratios

In a double AAV virus vector constructed based on a homologous recombination/trans-shearing double hybrid system (hybrid-AP), the theoretical ratio of the two viruses is 1:1, in this example, after the two viruses infect HEK-293T cells in different ratios (1 in the ratio represents MOI 5E +5, and the groups are shown in Table 1), the specific method is that HEK-293T cells are paved on a 24-hole plate, the number of the cells in each hole is 1E +5, after the cells are cultured for 24 hours in an adherent manner, the cells are infected by virus according to MOI (the number of the virus infected by each cell) in the table 2 for 72 hours after infection, the luciferase expression was detected according to the Bio-Glo (Promega, G9741) kit instructions, and the splicing efficiency was preliminarily evaluated by the cellular luciferase activity, and the specific results are shown in FIG. 2, and it can be seen from FIG. 2 that the luciferase has the highest expression efficiency when the titer ratio of the two viruses is 1: 2.

TABLE 2

Then two viruses re-infect HEK-293T cells at 1:1(HD1: HD2, 5E +5:5E +5) and 1:2(HD1: HD2, 5E +5:1E +6) respectively to verify EGFP fluorescent protein expression after shearing, HEK-293T is plated in 24-well cell plates, 1E +5 is cultured in a carbon dioxide incubator at 37 ℃ for 24h, the corresponding virus amount is added to different cell wells at different MOI for each virus, EGFP expression is recorded by photographing through fluorescent microscope observation at 72h after infection. The specific results are shown in FIG. 3A. As can be seen from FIG. 3, after the double AAV viral vectors infect host cells, the EGFP fluorescent protein expression is significantly enhanced.

Example 5

A C57BL/6 mouse was infected at the animal level by tail vein injection at a virus ratio of 1:1(HD1: HD2, 3.5E +11:3.5E +11) and a virus ratio of 1:2(HD1: HD2, 3.5E +11:7E +11), and luciferase in vivo tests were carried out 7 days (Day7) and 14 days (Day14) after administration, respectively, and the results showed that luciferase had a higher expression amount in the case of the virus ratio of 1:2, as shown in FIG. 3B.

Therefore, when the ratio of the adeno-associated virus HD1 to the adeno-associated virus HD2 is 1:2, the splicing efficiency of the foreign genes in the double AAV vectors can be obviously improved, and the expression of the target protein is maximally realized.

In conclusion, the present invention effectively overcomes various disadvantages of the prior art and has high industrial utilization value.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Shanghai Jikai GeneChemicals Co., Ltd

<120> detection method for multiple AAV virus titers

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 143

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120

gagcgcgcag agagggagtg gcc 143

<210> 2

<211> 304

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 120

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 180

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 240

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 300

catg 304

<210> 3

<211> 204

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt 60

ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa tcaacgggac 120

tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg 180

tgggaggtct atataagcag agct 204

<210> 4

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtaagtatca aggttacaag acaggtttaa ggagaccaat agaaactggg cttgtcgaga 60

cagagaagac tcttgcgttt ct 82

<210> 5

<211> 278

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggaatggctg gcgaagcgcc agggtgcccg gtatgtgtgg aaccgcactg agctcatgca 60

ggcttccctg gacccgtctg tgacccatct catgggtctc tttgagcctg gagacatgaa 120

atacgagatc caccgagact ccacactgga cccctccctg atggagatga cagaggctgc 180

cctgcgcctg ctgagcagga acccccgcgg cttcttcctc ttcgtggagg gtggtcgcat 240

cgaccatggt catcatgaaa gcagggctta ccgggcac 278

<210> 6

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gataggcacc tattggtctt actgacatcc actttgcctt tctctccaca g 51

<210> 7

<211> 239

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggccgcttcg agcagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa 60

tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca 120

ttataagctg caataaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc 180

agggggagat gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt ggtaaaatc 239

<210> 8

<211> 717

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag 717

<210> 9

<211> 3482

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120

gagcgcgcag agagggagtg gccgcggccg cacgcgtgtg tctagaacgc gtggagctag 180

ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg agttccgcgt 240

tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc gcccattgac 300

gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt gacgtcaatg 360

ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag 420

tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg cccagtacat 480

gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat 540

ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact cacggggatt 600

tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa atcaacggga 660

ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta ggcgtgtacg 720

gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcgcct ggagacgcca 780

tccacgctgt tttgacctcc atagaagaca ccgggaccga tccagcctcc gcggattcga 840

atcccggccg ggaacggtgc attggaacgc ggattccccg tgccaagagt gacgtaagta 900

ccgcctatag agtctatagg cccacaaaaa atgctttctt cttttaatat acttttttgt 960

ttatcttatt tctaatactt tccctaatct ctttctttca gggcaataat gatacaatgt 1020

atcatgcctc tttgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata 1080

gcaatatttc tgcatataaa tatttctgca tataaattgt aactgatgta agaggtttca 1140

tattgctaat agcagctaca atccagctac cattctgctt ttattttatg gttgggataa 1200

ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 1260

ttcctcccac agctcctggg caacgtgctg gtctgtgtgc tggcccatca ctttggcaaa 1320

gaattgggat tcgaacatcg attgaattcg gtaccggaat tcggaactgg aggtggaggt 1380

agtggaaagg atccatggtg agcaagggcg aggagctgtt caccggggtg gtgcccatcc 1440

tggtcgagct ggacggcgac gtaaacggcc acaagttcag cgtgtccggc gagggcgagg 1500

gcgatgccac ctacggcaag ctgaccctga agttcatctg caccaccggc aagctgcccg 1560

tgccctggcc caccctcgtg accaccctga cctacggcgt gcagtgcttc agccgctacc 1620

ccgaccacat gaagcagcac gacttcttca agtccgccat gcccgaaggc tacgtccagg 1680

agcgcaccat cttcttcaag gacgacggca actacaagac ccgcgccgag gtgaagttcg 1740

agggcgacac cctggtgaac cgcatcgagc tgaagggcat cgacttcaag gaggacggca 1800

acatcctggg gcacaagctg gagtacaact acaacagcca caacgtctat atcatggccg 1860

acaagcagaa gaacggcatc aaggtgaact tcaagatccg ccacaacatc gaggacggca 1920

gcgtgcagct cgccgaccac taccagcaga acacccccat cggcgacggc cccgtgctgc 1980

tgcccgacaa ccactacctg agcacccagt ccgccctgag caaagacccc aacgagaagc 2040

gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg gatcactctc ggcatggacg 2100

agctgtacaa gggaggtgga ggatcaatgg aagacgccaa aaacataaag aaaggcccgg 2160

cgccattcta tccgctggaa gatggaaccg ctggagagca actgcataag gctatgaaga 2220

gatacgccct ggttcctgga acaattgctt ttacagatgc acatatcgag gtggacatca 2280

cttacgctga gtacttcgaa atgtccgttc ggttggcaga agctatgaaa cgatatgggc 2340

tgaatacaaa tcacagaatc gtcgtatgca gtgaaaactc tcttcaattc tttatgccgg 2400

tgttgggcgc gttatttatc ggagttgcag ttgcgcccgc gaacgacatt tataatgaac 2460

gtgaattgct caacagtatg ggcatttcgc agcctaccgt ggtgttcgtt tccaaaaagg 2520

ggttgcaaaa aattttgaac gtgcaaaaaa agctcccaat catccaaaaa attattatca 2580

tggattctaa aacggattac cagggatttc agtcgatgta cacgttcgtc acatctcatc 2640

tacctcccgg ttttaatgaa tacgattttg tgccagagtc cttcgatagg gacaagacaa 2700

ttgcactgat catgaactcc tctggatcta ctggtctgcc taaaggtgtc gctctgcctc 2760

atagaactgc ctgcgtgaga ttctcgcatg ccagagatcc tatttttggc aatcaaatca 2820

ttccggatac tgcgatttta agtgttgttc cattccatca cggttttgga atgtttacta 2880

cactcggata tttgatatgt ggatttcgag tcgtcttaat gtatagattt gaagaagagc 2940

tgtttctgag gagccttcag gtaagtatca aggttacaag acaggtttaa ggagaccaat 3000

agaaactggg cttgtcgaga cagagaagac tcttgcgttt ctggaatggc tggcgaagcg 3060

ccagggtgcc cggtatgtgt ggaaccgcac tgagctcatg caggcttccc tggacccgtc 3120

tgtgacccat ctcatgggtc tctttgagcc tggagacatg aaatacgaga tccaccgaga 3180

ctccacactg gacccctccc tgatggagat gacagaggct gccctgcgcc tgctgagcag 3240

gaacccccgc ggcttcttcc tcttcgtgga gggtggtcgc atcgaccatg gtcatcatga 3300

aagcagggct taccgggcac gtgcggaccg agcggccgcg gccactccct ctctgcgcgc 3360

tcgctcgctc actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc 3420

ggcctcagtg agcgagcgag cgcgcagaga gggagtggcc aactccatca ctaggggttc 3480

ct 3482

<210> 10

<211> 1744

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120

gagcgcgcag agagggagtg gccgcggccg cacgcgtgtg tctagaacgc gtggaggtag 180

tggaaaggat ccggaatggc tggcgaagcg ccagggtgcc cggtatgtgt ggaaccgcac 240

tgagctcatg caggcttccc tggacccgtc tgtgacccat ctcatgggtc tctttgagcc 300

tggagacatg aaatacgaga tccaccgaga ctccacactg gacccctccc tgatggagat 360

gacagaggct gccctgcgcc tgctgagcag gaacccccgc ggcttcttcc tcttcgtgga 420

gggtggtcgc atcgaccatg gtcatcatga aagcagggct taccgggcac gataggcacc 480

tattggtctt actgacatcc actttgcctt tctctccaca ggattacaag attcaaagtg 540

cgctgctggt gccaacccta ttctccttct tcgccaaaag cactctgatt gacaaatacg 600

atttatctaa tttacacgaa attgcttctg gtggcgctcc cctctctaag gaagtcgggg 660

aagcggttgc caagaggttc catctgccag gtatcaggca aggatatggg ctcactgaga 720

ctacatcagc tattctgatt acacccgagg gggatgataa accgggcgcg gtcggtaaag 780

ttgttccatt ttttgaagcg aaggttgtgg atctggatac cgggaaaacg ctgggcgtta 840

atcaaagagg cgaactgtgt gtgagaggtc ctatgattat gtccggttat gtaaacaatc 900

cggaagcgac caacgccttg attgacaagg atggatggct acattctgga gacatagctt 960

actgggacga agacgaacac ttcttcatcg ttgaccgcct gaagtctctg attaagtaca 1020

aaggctatca ggtggctccc gctgaattgg aatccatctt gctccaacac cccaacatct 1080

tcgacgcagg tgtcgcaggt cttcccgacg atgacgccgg tgaacttccc gccgccgttg 1140

ttgttttgga gcacggaaag acgatgacgg aaaaagagat cgtggattac gtcgccagtc 1200

aagtaacaac cgcgaaaaag ttgcgcggag gagttgtgtt tgtggacgaa gtaccgaaag 1260

gtcttaccgg aaaactcgac gcaagaaaaa tcagagagat cctcataaag gccaagaagg 1320

gcggaaagat cgccgtgtaa ggccgcttcg agcagacatg ataagataca ttgatgagtt 1380

tggacaaacc acaactagaa tgcagtgaaa aaaatgcttt atttgtgaaa tttgtgatgc 1440

tattgcttta tttgtaacca ttataagctg caataaacaa gttaacaaca acaattgcat 1500

tcattttatg tttcaggttc agggggagat gtgggaggtt ttttaaagca agtaaaacct 1560

ctacaaatgt ggtaaaatcc acgtgcggac cgagcggccg cggccactcc ctctctgcgc 1620

gctcgctcgc tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg 1680

gcggcctcag tgagcgagcg agcgcgcaga gagggagtgg ccaactccat cactaggggt 1740

tcct 1744

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tattagtcat cgctattacc 20

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgagtcaaac cgctatcc 18

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acccgtctgt gacccatctc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agggcagcct ctgtcatctc 20

<210> 15

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cggcctcagt gagcga 16

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggaaccccta gtgatggagt t 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cactccctct ctgcgcgctc g 21

Claims

1. A method of detecting titers of a plurality of AAV viruses, the plurality of AAV viruses comprising a first adeno-associated virus and a second adeno-associated virus;

the polynucleotide sequences of the first titer calibration fragment and the second titer calibration fragment are shown as SEQ ID number 5;

the detection method comprises the following steps:

providing a titer of a first adeno-associated virus;

2. The method of claim 1, wherein the titer of the first adeno-associated virus is provided based on a transcription initiation element.

3. The method of claim 1, wherein the titer of the first adeno-associated virus is obtained by primers specific for the transcription initiation element.

4. The method of claim 1, wherein the detection signal intensity for the adeno-associated virus is obtained by primers specific for the titer calibration fragment.

5. The method of claim 1, wherein the plurality of AAV viruses comprises a first through N-th adeno-associated virus, wherein N is a positive integer of at least 3, a second through N-1 adeno-associated virus each comprising an nth gene expression cassette between two ITR sequences, wherein the nth gene expression cassette comprises a 2N-2 th titer calibrator, an N-1 th splice acceptor signal, an nth gene segment of interest, an nth splice donor signal, a 2N-1 th titer calibrator in the 5 'to 3' direction, wherein the nth gene expression cassette comprises a 2N-2 th titer calibrator, an N-1 th splice acceptor signal, and a second through N-1 th titer calibrator in the 5 'to 3' direction, A 3' end segment of a target gene and a transcription termination element, wherein N is a positive integer not more than N-1 and N is not 1.

6. The method for detecting multiple AAV viral titers according to claim 5, wherein the method further comprises: and acquiring the detection signal intensity of the nth adeno-associated virus and the adeno-associated virus in the previous cis position based on the 2n-2 titer calibration fragment and the titer calibration fragment in the previous cis position, and acquiring the titer of the nth adeno-associated virus based on the titer of the adeno-associated virus in the previous cis position according to the ratio of the detection signal intensities of the nth adeno-associated virus and the adeno-associated virus in the previous cis position.

7. The method of detecting multiple AAV viral titers according to claim 5, wherein the method further comprises: and obtaining the detection signal intensity of the N-th adeno-associated virus and the adeno-associated virus in the previous cis position based on the 2N-2 titer calibration fragment and the titer calibration fragment in the previous cis position, and obtaining the titer of the N-th adeno-associated virus based on the titer of the adeno-associated virus in the previous cis position according to the ratio of the detection signal intensities of the N-th adeno-associated virus and the adeno-associated virus in the previous cis position.

8. The method of claim 5, wherein the nth gene expression cassette comprises, in order from 5 'to 3', a 2n-2 th titer calibration fragment, an n-1 th splice acceptor signal fragment, an nth gene fragment of interest, an nth splice donor signal fragment, and a 2n-1 th titer calibration fragment;

and/or, the 2N-2 titer calibration fragment is matched to the titer calibration fragment of the previous cis position.

9. The method of claim 1, wherein the AAV virus is a dual AAV virus, the second gene expression cassette further comprises a transcription termination element, and the second gene segment of interest is a 3' segment of a gene of interest.

10. The method of claim 9, wherein the polynucleotide sequences of the first titer calibration fragment and the second titer calibration fragment are matched;

11. The method of claim 1 or 2, wherein the transcription initiation element comprises a promoter and/or an enhancer.

12. The method of claim 11, wherein the promoter is selected from the group consisting of CMV promoters and the enhancer is selected from the group consisting of CMV enhancers.

13. The method of detecting multiple AAV viral titers according to any one of claims 5-10, wherein the transcription termination element is selected from polyA.

14. The method of claim 13, wherein the transcription termination element is SV40 polyA.

15. The method of detecting multiple AAV viral titers according to claim 1, wherein the first gene expression cassette further comprises a reporter gene.

16. The method of detecting multiple AAV viral titers according to claim 15, wherein said reporter gene is selected from the group consisting of EGFP.

17. A method of constructing a multiplex AAV viral expression system, comprising:

1) providing viral titers by a method of detecting the titer of a multiplex AAV virus according to any one of claims 1 to 16;

18. The method for constructing a multiple AAV virus expression system according to claim 17, wherein the multiple AAV viruses are dual AAV viruses, and the ratio of the viral load of the first adeno-associated virus to the viral load of the second adeno-associated virus is 1:1 to 1: 2.

19. An expression system prepared by the method for constructing an expression system according to any one of claims 17 to 18.

20. A method of expressing a gene of interest comprising: culturing the expression system of claim 19 under suitable conditions to allow expression of the gene of interest.