CN113122620A

CN113122620A - Lip cleft palate related SNP marker and application thereof

Info

Publication number: CN113122620A
Application number: CN201911393213.4A
Authority: CN
Inventors: 牛振民; 陈振琦; 彭莉; 黄薇
Original assignee: Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine; Shanghai Human Genome Research Center
Current assignee: Shanghai Institute Of Biomedical Technology; Ninth Peoples Hospital Shanghai Jiaotong University School of Medicine
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2021-07-16

Abstract

The invention provides SNP markers rs7078160 and rs4791774 related to cleft lip and palate and application thereof in evaluating the risk of cleft lip and palate. The invention provides an isolated nucleic acid molecule from mammals, which comprises SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, rs4791774 is G or A, preferably rs7078160 is 104 th nucleotide from 5' end of an amplification product obtained by PCR amplification by taking genome DNA of the mammals as a template and SEQ ID NO 7 and 8 as primers, and the nucleotide is A or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers. The invention also provides application of a reagent for detecting the SNP markers rs7078160 and rs4791774 in preparation of a kit for evaluating the risk of cleft lip and palate.

Description

Lip cleft palate related SNP marker and application thereof

Technical Field

The invention relates to a cleft lip and palate related SNP marker and application thereof.

Background

Cleft lip and palate is a congenital developmental deformity formed by fusion disorder of various protrusions on the face in the process of embryo development and is one of the most common congenital diseases. In general, the incidence is about 1/800. The incidence rate varies according to the species, ethnicity, geographical location and environment. Asian and american indians have the highest prevalence, usually 1/500, caucasian prevalence of about 1/1000, and african population the lowest prevalence, about 1/2500, indicating that the relative contribution of susceptibility genes varies between different ethnicities. The morbidity of China is as high as 1.82 per mill in the high incidence of cleft lip and palate, and the total incidence accounts for 14.01 percent of the birth defects of China. The risk of the disease of the offspring of cleft lip and palate patients is 20-30 times of that of the ordinary people.

Development of the oromaxillofacial region begins the third week of embryonic development. In the seventh week of the embryo, the olfactory fossa bottom is ruptured to form nostrils, the left and right lateral maxillary processes are connected with the lateral nasal process to form the nasal foramen bottom and the upper lip, the inner nasal processes on the two sides are connected to form the columella nasalis, the human middle jaw and the front jaw, and the two lateral mandibular processes also grow towards the midline and are connected to form the lower jaw and the lower lip. In the 12 th week of embryo development, the part of the front end connected with the nasal septum is ossified to form a hard palate, and the part of the rear end not connected with the nasal septum has no sclerotin generation, namely a soft palate. The mouth and nose of the fetus gradually take on the form of an adult.

During the 4 th to 10 th week of pregnancy, when the normal development and fusion of the facial process is hindered due to certain factors, the corresponding cleft lip and palate malformation of the fetus can occur. The possible etiologic agents currently considered by medicine are: 1. genetic factors: similar malformations occur in some orthotopic or collateral relatives of children. 2. Environmental factors: including infection and injury: mothers in the early stage of pregnancy (about 2 months) are infected with viruses, such as influenza and rubella; the mother suffers from chronic diseases such as anemia, diabetes, serious dystrophy, etc. during pregnancy; some medicines such as sedatives, antiepileptics, hormones and the like are taken during pregnancy; the mother receives excessive X-ray radiation during pregnancy.

Cleft lip and palate is generally divided into the complex (30%) and non-complex (70%). The complex cleft lip and palate is caused by chromosomal abnormalities or single gene mutations and generally appears as a complex of multiple abnormalities. The non-syndromic cleft lip and palate shows independent deformity, is caused by the interaction of susceptibility of genetic background and environmental factors, is a polygenic genetic disease and is also the key point of cleft lip and palate gene research. The detection of the gene level can efficiently and quickly estimate the morbidity probability of the disease, but the relationship between the non-syndromic cleft lip and palate and the genotype does not exist in the prior art. Therefore, there is a need in the art for an effective method of estimating the incidence of cleft lip and palate.

Disclosure of Invention

The invention provides an SNP marker which is related to cleft lip and palate risk and can be effectively used for cleft lip and palate risk evaluation, and a primer and a probe are designed by utilizing the SNP marker to detect sample DNA, so that the cleft lip and palate risk evaluation is realized, and the difficult problem of cleft lip and palate evaluation before pregnancy and before delivery is effectively solved.

Specifically, the invention provides an isolated nucleic acid molecule from a mammal, wherein the nucleic acid molecule comprises SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A.

In one or more embodiments, rs7078160 is nucleotide 104 from the 5' end of an amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NOs 7 and 8 as primers, which is a or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers.

Preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is SEQ ID NO. 2 nucleotide 179, which is G or A.

In one or more embodiments, the mammal is a human.

In one or more embodiments, the nucleic acid molecule is 20bp to 1000bp in length; preferably, the nucleotide sequence of the nucleic acid molecule comprises at least nucleotides 94 to 114 of SEQ ID NO. 1 and nucleotides 169 and 189 of SEQ ID NO. 2.

The invention also provides a primer for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A.

In one or more embodiments, the mammal is a human.

In one or more embodiments, the amplification product of the primer comprises at least nucleotides 94-114 of SEQ ID NO. 1 and nucleotides 169-189 of SEQ ID NO. 2,

in one or more embodiments, the primer is selected from the group consisting of:

(1) 7 and 8 or a sequence having at least 90% identity thereto;

(2) 9 and 10 or a sequence having at least 90% identity thereto; and

(3) a mixture of the sequences of (1) and (2).

The invention also provides a probe for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A.

In one or more embodiments, the mammal is a human.

In one or more embodiments, the probe recognizes at least nucleotides 94-114 of SEQ ID NO. 1 and nucleotides 169-189 of SEQ ID NO. 2.

The invention also provides a kit which contains a reagent for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A.

In one or more embodiments, the mammal is a human.

In one or more embodiments, the agent comprises one or more selected from the group consisting of: the nucleic acid molecule of any one of claims 1 to 3, the primer of claim 4 or 5, the probe of claim 6.

The invention also provides application of a reagent for detecting SNP markers rs7078160 and rs4791774 in preparation of a kit for evaluating the risk of cleft lip and palate.

In one or more embodiments, the agent detects SNP markers rs7078160 and rs4791774 in the genome of a mammal, wherein rs7078160 is a or G and rs4791774 is G or a, thereby assessing the risk of cleft lip and palate in an offspring of the mammal.

In one or more embodiments, the agent detects SNP markers rs7078160 and rs4791774 in the genome of a mammalian fetus, wherein rs7078160 is a or G and rs4791774 is G or a, thereby assessing the risk of the fetus to suffer from cleft lip and palate.

In one or more embodiments, the mammal is a human.

In one or more embodiments, the agent comprises one or more selected from the group consisting of: a nucleic acid molecule as described herein, a primer as described herein, a probe as described herein.

The invention also provides application of a reagent for detecting the SNP markers rs7078160 and rs4791774 in preparation of a kit for evaluating the risk of cleft lip and palate, wherein the nucleic acid molecules or the primers are used for detecting the SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A.

In one or more embodiments, the mammal is a human.

Detailed Description

The inventor discovers that the specific genotype of the SNP markers rs7078160 and rs4791774 is related to cleft lip and palate through screening, so that the risk of cleft lip and palate of offspring can be evaluated before pregnancy and before delivery by detecting rs7078160 and rs 4791774.

In particular, the invention relates to SNP markers related to cleft lip and palate, primers and a kit for detecting the SNP markers, application of the SNP markers, the primers and the kit in evaluating the risk of cleft lip and palate, and a method for evaluating the risk of cleft lip and palate.

The inventors found the following SNP markers associated with cleft lip and palate: (1) rs7078160 is located in the VAX1 gene at a chromosomal location chr10:117068049(GRCh38.p12) with G and A alleles; (2) rs7078160 is located in the NTN1 gene at a chromosomal location chr17:9028802(GRCh38.p12) with A and G allelic forms. Meanwhile, the inventor finds that the A allele type of the rs7078160 site and/or the G allele type of the rs4791774 site are risk allele types. In one or more embodiments, rs7078160 is nucleotide 104 from the 5' end of an amplification product obtained by PCR amplification using a mammalian (e.g., human) genomic DNA as a template and SEQ ID NOS: 7 and 8 as primers, which is A or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers. Preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is SEQ ID NO. 2 nucleotide 179, which is G or A.

Herein, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphism caused by variation of single nucleotide on genome level. SNPs typically exhibit polymorphisms that involve only single base variations, such as transitions, transversions, insertions and deletions.

RS naming is currently the most common SNP naming method, which is RS + arabic numbers, including front and back sequences, location information, distribution frequency, etc. According to the rs number of the known SNP, related information and the position of the related information in a genome can be searched in a SNP database of GenBank.

Herein, cleft lip and palate is non-syndromic cleft lip and palate. The inventor finds that compared with individuals with GG or AA of rs7078160 genotype or AA of rs4791774 genotype, individuals with both rs7078160 allele A and rs4791774 allele G have 1.88 times higher risk of cleft lip and palate. Therefore, by detecting the above-mentioned SNPs in the parental sample, the risk of cleft lip and palate in the offspring or fetus can be effectively evaluated.

The invention provides an isolated nucleic acid molecule, which comprises SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A. In one or more embodiments, rs7078160 is nucleotide 104 from the 5' end of an amplification product obtained by PCR amplification using a mammalian (e.g., human) genomic DNA as a template and SEQ ID NOS: 7 and 8 as primers, which is A or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers. Preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is SEQ ID NO. 2 nucleotide 179, which is G or A. Typically, the nucleic acid molecules of the invention are 20bp to 1000bp in length. Preferably, the nucleotide sequence of the nucleic acid molecule comprises at least nucleotides 94 to 114 of SEQ ID NO. 1 and nucleotides 169 and 189 of SEQ ID NO. 2. In one or more embodiments, the nucleic acid molecule is SEQ ID NO 1 and SEQ ID NO 2. In one or more embodiments, the nucleic acid molecules are used to detect standards and/or controls for the genotype of a SNP site in a sample.

The term "isolated" refers to a material, such as a nucleic acid molecule and/or protein, that is substantially free of, or removed from, components that normally accompany or interact with the material in a naturally occurring environment. Isolated polynucleotides may be purified from host cells in which they naturally occur. Conventional nucleic acid purification methods known to those skilled in the art can be used to obtain isolated polynucleotides.

The term "amplification" product refers to a nucleic acid fragment produced during a primer directed amplification reaction. Typical methods for primer directed amplification include Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR) or Strand Displacement Amplification (SDA). If a PCR method is chosen, the replication composition may comprise components for nucleic acid replication, such as: nucleotide triphosphates, two (or more) primers with appropriate sequences, thermostable polymerase, buffers, solutes, and proteins. In one or more embodiments, the amplification product is at least 200bp, at least 500bp, at least 1kb, at least 2kb, at least 3kb, at least 4kb, at least 5kb, at least 6kb, at least 7kb, at least 8kb, at least 9kb, at least 10kb or at least 12 kb.

The terms "nucleic acid," "nucleic acid molecule," "polynucleotide sequence," "nucleic acid sequence," and "nucleic acid fragment" are used interchangeably herein to refer to a Deoxyribonucleotide (DNA) or ribonucleotide polymer (RNA) in either single-or double-stranded form, and the complements thereof. Nucleic acids contain synthetic, non-natural or altered nucleotide bases. The nucleotide may be a ribonucleotide, a deoxyribonucleotide, or a modified form thereof. Examples of polynucleotides contemplated herein include single-and double-stranded DNA, single-and double-stranded RNA, and hybrid molecules having a mixture of single-and double-stranded DNA and RNA. The DNA may be the coding strand or the non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining genomic DNA and fragmenting are well known in the art. In one or more embodiments, the sample comprises cfDNA. The nucleic acids of the invention may comprise a combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. The nucleic acids of the invention can be synthesized to include unnatural amino acid modifications. The nucleic acids of the invention can be obtained by chemical synthesis methods or by recombinant methods.

The basic unit of DNA is deoxyribonucleotide, which is condensed by phosphodiester bond to form a long chain molecule. Each deoxyribonucleotide consists of a phosphate, a deoxyribose, and a base. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). In the double-helix structure of double-stranded DNA, A is hydrogen-bonded to T, and G is hydrogen-bonded to C. The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be of any length, such as 50-500bp, 100-400bp, 150-300bp or 200-250 bp.

As used herein, a "primer" refers to a nucleic acid molecule having a specific nucleotide sequence that directs the synthesis at the initiation of nucleotide polymerization. The primers are typically two oligonucleotide sequences synthesized by man, one primer complementary to one DNA template strand at one end of the target region and the other primer complementary to the other DNA template strand at the other end of the target region, which functions as the initiation point for nucleotide polymerization. Primers designed artificially in vitro are widely used in Polymerase Chain Reaction (PCR), qPCR, sequencing, probe synthesis, and the like. The primer may be of any length, for example 5-200bp, 10-100bp, 20-800bp or 25-50 bp.

The primer of the invention is used for detecting SNP. Specifically, the primer is used for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, and rs4791774 is G or A. Preferably, rs7078160 is nucleotide 104 from 5' end of an amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NO 7 and 8 as primers, which is A or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers. More preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is SEQ ID NO. 2 nucleotide 179, which is G or A. The amplification product of the primer at least comprises nucleotides 94-114 of SEQ ID NO. 1 and nucleotides 169-189 of SEQ ID NO. 42.

In some embodiments, the primer is selected from the group consisting of (1) a nucleotide sequence set forth in SEQ ID NO. 7 or 8 or a mutant having at least 90% sequence identity thereto, (2) a nucleotide sequence set forth in SEQ ID NO. 9 or 10 or a mutant having at least 90% sequence identity thereto, and (3) a complementary sequence of (1) or (2).

The present invention may also employ probes to detect SNPs described herein. A "probe" as used herein is a nucleic acid sequence (DNA or RNA) that recognizes a sequence of interest (complementary to the sequence of interest). The probe is combined with the target gene through molecular hybridization to generate a hybridization signal, thereby displaying the target gene. The probe may include the entire sequence of interest or may be a fragment of the sequence of interest. The probe may be DNA or RNA transcribed therefrom. Typically, the probe carries a detectable label, such as a fluorescent label. Such fluorescent labels include, but are not limited to FAM, CY5, and VIC. Fluorescent labels suitable for use with the probes herein and methods of attaching them to the probes are known in the art.

Here, the probe recognizes a fragment of SEQ ID NO. 1 or 2 comprising nucleotide 104 of SEQ ID NO. 1 and nucleotide 179 of SEQ ID NO. 2. Preferably, the probe recognizes at least the fragment of SEQ ID NO:1 comprising nucleotides 94 to 114 and the fragment of SEQ ID NO:2 comprising nucleotides 169 and 189. Illustratively, the probe is selected from one or more of the following: (1) a probe recognizing a fragment of SEQ ID NO. 1 comprising nucleotide 104 of SEQ ID NO. 1 and the base is A or G, (2) a probe recognizing a fragment of SEQ ID NO. 2 comprising nucleotide 179 of SEQ ID NO. 2 and the base is G or A, and (3) a complementary sequence of (1) or (2). Preferably, the probe is selected from one or more of the following: (1) a probe recognizing a fragment of SEQ ID NO. 3 comprising nucleotide 104 of SEQ ID NO. 3 and the base is A, (2) a probe recognizing a fragment of SEQ ID NO. 4 comprising nucleotide 179 of SEQ ID NO. 4 and the base is G, a complementary sequence of (3) (1) or (2).

The term "variant" or "mutant" as used herein refers to a polynucleotide that has a nucleic acid sequence altered by insertion, deletion or substitution of one or more nucleotides compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. A mutant according to any of the embodiments herein comprises a nucleotide sequence having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn from NCBI. Mutants also include nucleotide sequences that have one or more mutations (insertions, deletions, or substitutions) in the reference sequence and in the nucleotide sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations typically means within 1 to 8, such as 1 to 5 or 1 to 3. The substitution may be a substitution between purine nucleotides and pyrimidine nucleotides, or a substitution between purine nucleotides or between pyrimidine nucleotides. The substitution is preferably a conservative substitution. For example, conservative substitutions with nucleotides of similar or analogous properties are not typically made in the art to alter the stability and function of the polynucleotide. Conservative substitutions are, for example, exchanges between purine nucleotides (A and G), exchanges between pyrimidine nucleotides (T or U and C). Thus, substitution of one or more sites with residues from the same in the polynucleotides of the invention will not substantially affect their activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% sequence identity to a primer (e.g.SEQ ID NO:7-10) or probe according to the invention, preferably such mutants will hybridize under high stringency conditions to the corresponding DNA sequence comprising SEQ ID NO: 1-6. The high stringency conditions can be hybridization and membrane washing in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

Provided herein are assessments of the risk of an offspring or fetus to suffer from cleft lip and palate pre-pregnancy and prenatally. Pre-pregnancy diagnosis or pre-pregnancy test refers to a physical examination performed during pregnancy to assess the likelihood of giving a healthy infant, thereby achieving a good birth. Pre-pregnancy diagnosis is mainly aimed at the assessment of diseases caused by the reproductive system and genetic factors. The optimal time for pre-pregnancy examination is 3-6 months before pregnancy. Prenatal diagnosis refers to the examination and diagnosis of the developmental state of an embryo or fetus before birth, whether or not the embryo or fetus has a disease, and the like.

The method for evaluating the risk of cleft lip and palate comprises the step of detecting SNP markers rs7078160 and rs4791774 in the genome of a mammal, wherein rs7078160 is A or G, and rs4791774 is G or A, so that the risk of cleft lip and palate of the offspring of the mammal is evaluated. The method further comprises: (1) extracting DNA of a sample to be detected; (2) determining or quantifying the genotype of the SNP markers described herein in the DNA using the primers described herein; and (3) assessing the risk of cleft lip and palate in the offspring of said mammal based on the results of (2). For example, by detecting the genotype of the SNP marker of a parent, the genotype of the marker is obtained in the offspring, and then the offspring is presumed to have the risk of cleft lip and palate. For example, the parents are rs7078160AA homozygote and rs4791774GG homozygote, respectively, and the offspring will have both risk alleles at the same time, so that the risk of cleft lip and palate occurring is greatly increased.

Another aspect of the present invention provides a method for assessing the risk of cleft lip and palate, comprising detecting SNP markers rs7078160 and rs4791774 in the genome of a mammal, wherein rs7078160 is a or G and rs4791774 is G or a, thereby assessing the risk of said mammal suffering from cleft lip and palate. In one or more embodiments, the mammal is an animal fetus. The method further comprises: (1) extracting DNA of a sample to be detected; (2) determining or quantifying the genotype of the SNP markers described herein in the DNA using the primers described herein; and (3) assessing the risk of the animal fetus to suffer from cleft lip and palate based on the results of (2). For example, an individual with both rs7078160 allele type a and rs4791774 allele type G at site is at significantly increased risk of having cleft lip and palate.

Herein, the method for extracting DNA in a sample is not particularly limited, and DNA extraction methods suitable for use herein are well known in the art. The term "sample" as used herein refers to any tissue or fluid from a subject that is suitable for enrichment of nucleic acids. The object may be any living or non-living organism, including but not limited to a human, non-human animal, plant, bacteria, fungus, or protist. Any human or non-human animal can be selected, including, but not limited to, mammals, reptiles, birds, amphibians, fish, ungulates, ruminants, bovines (e.g., cattle), equines (e.g., horses), goats, and ovines (e.g., sheep, goats), porcines (e.g., pigs), alpacas (e.g., camels, llamas, alpacas), monkeys, apes (e.g., gorilla, chimpanzees), felidaes (e.g., bears), poultry, dogs, cats, mice, rats, fish, dolphins, whales, and sharks. The subject may be male or female (e.g., woman, pregnant woman). The subject may be of any age (e.g., embryo, fetus, infant, child, adult).

Nucleic acids can be isolated from any type of suitable biological sample or specimen. The sample or test sample may be any specimen isolated or obtained from a subject or portion thereof. Non-limiting examples of test samples include fluids or tissues of a subject including, but not limited to, blood or blood products, cord blood, down hairs, amniotic fluid, cerebrospinal fluid, spinal fluid, washing fluid, biopsy sample, interstitial fluid sample, cells or parts thereof, female genital tract wash, urine, stool, sputum, saliva, nasal mucosa, prostatic fluid, lavage fluid, semen, lymph fluid, bile, tears, sweat, breast milk, breast fluid, and the like, or combinations thereof. In some embodiments, the biological sample may be blood, and sometimes plasma or serum. Other suitable biological samples will be familiar to those of ordinary skill in the relevant art. Biological samples can be obtained using techniques well within the ordinary knowledge of clinical practitioners.

In some embodiments, the nucleic acid is fragmented or cleaved before, during, or after the methods of the invention. As used herein, "fragmenting" or "cleaving" refers to a method or conditions under which a nucleic acid molecule (e.g., a nucleic acid template gene molecule or an amplification product thereof) can be separated into two or more smaller nucleic acid molecules. Nucleic acid fragments may contain overlapping nucleotide sequences, such overlapping sequences may facilitate the construction of nucleotide sequences of corresponding nucleic acids or segments thereof that are not fragmented. In certain embodiments, the nucleic acid may be partially fragmented (e.g., from an incomplete or aborted specific cleavage reaction) or completely fragmented. Such fragmentation or cleavage can be sequence specific, base specific or non-specific and can be accomplished by any of a variety of methods, reagents or conditions including, for example, chemical, enzymatic, physical fragmentation.

SNP marker detection methods suitable for use herein are well known in the art and include, but are not limited to: sequencing, single strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time fluorescence quantitative PCR and high resolution melting curve analysis (HRM), fluorescent probe quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-restriction fragment length polymorphism, PCR-RFLP), flight time mass spectrum and the like. Other reagents than primers are known in the art as required in SNP marker detection methods.

According to some specific examples of the present invention, the method for assessing a risk of having cleft lip and palate by performing the detection of the SNP marker described herein on a sample to be tested, further comprises: extracting DNA in a sample; performing fluorescent quantitative PCR of DNA by using a primer SEQ ID NO. 7-10 to obtain an amplification product; sequencing the amplification product to obtain the genotype of the SNP marker in the DNA; and assessing the risk of cleft lip and palate based on the genotype of the SNP marker.

According to some specific examples of the present invention, the method for assessing a risk of having cleft lip and palate by performing the detection of the SNP marker described herein on a sample to be tested, further comprises: extracting DNA in a sample; performing fluorescent quantitative PCR of DNA by using primers SEQ ID NO. 7-10, a probe for identifying an amplification product, and a primer and a probe for referring to a gene to obtain an amplification product; analyzing the PCR result to obtain the genotype of the SNP marker in the DNA; and assessing the risk of cleft lip and palate based on the genotype of the SNP marker.

The invention also provides a kit which contains a reagent for detecting the SNP markers rs7078160 and rs4791774 in the genome of the mammal, wherein rs7078160 is A or G, and rs4791774 is G or A. rs7078160 is nucleotide 104 from 5' end of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 7 and 8 as primers, and is A or G. Preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G. rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers. Preferably, rs4791774 is nucleotide 179 of SEQ ID NO. 2, which is G or A. The reagent may be a primer and/or a probe as described in any embodiment herein. Optionally, the kit further comprises a nucleic acid molecule (i.e., amplification product) of the invention, which can be used as an internal standard or positive control. Preferably, the primer is selected from: (1) 7 and 8 or a sequence having at least 90% identity thereto; (2) 9 and 10 or a sequence having at least 90% identity thereto; and (3) mixtures of the sequences described in (1) and (2). The kit may further contain various reagents required for performing PCR, such as buffers, enzymes, dNTPs, and the like. In a preferred embodiment, the kit of the invention comprises the primer sequences shown in SEQ ID NO 7-10.

The term "about" or "approximately" means within an acceptable error range for the particular value determined by one of ordinary skill in the art, which will depend on the manner in which the value is measured or determined, e.g., the limits of the measurement system. For example, "about" can mean within 1 or more standard deviation ranges. Alternatively, "about" may represent a range of up to 20%, or up to 10%, or up to 5%, or up to 1% of a given value. Alternatively, especially for biological systems or processes, the term may mean within an order of magnitude, preferably within 5-fold, more preferably within 2-fold, of a value. When a particular value is described in this application and in the claims, unless otherwise stated, the term "about" is assumed to mean within an acceptable error range for the particular value.

All percentages and ratios/ratios are by weight unless explicitly stated otherwise.

All percentages and ratios are calculated based on the total composition, unless otherwise indicated.

Every maximum numerical limitation given throughout this disclosure includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this disclosure includes every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this disclosure includes every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

The values recited herein should not be construed as being strictly limited to the exact numerical values recited. Rather, unless specifically stated otherwise, each stated value is intended to mean both the stated value and a functionally equivalent range surrounding that value. For example, a value disclosed as "20 μ Ι" is intended to mean "about 20 μ Ι".

Each document cited herein, including any cross-reference and related patents or applications, is hereby incorporated by reference unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone, or in any combination with any other reference or references, teaches, suggests or discloses any such invention. Further, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the term in a document incorporated by reference, the meaning or definition assigned to the term in this document shall govern.

The present invention will be illustrated below by way of specific examples. It is to be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. Various other changes and modifications may be made without departing from the spirit and scope of the disclosure. The scope of the appended claims includes all such changes and modifications as fall within the true spirit and scope of the disclosure. The materials, reagents and methods not specifically described in the examples are all conventional in the art.

Examples

Example 1 study object

Case samples were all taken from outpatients and patients were diagnosed with non-syndromic cleft lip and palate. Peripheral blood samples were collected from 226 non-syndromic cleft lip and palate patients and 449 healthy normal control individuals on an informed consent basis.

Example 2 identification of SNPs

1. DNA extraction

DNA was extracted from human peripheral blood samples by the conventional phenol chloroform method (DNA was also extracted using a commercial kit) and corrected to 20 ng/. mu.l for conventional PCR amplification.

2. Primer design for use in PCR and sequencing

About 20 SNPs were selected, and primers were designed and synthesized based on the genomic sequence in GenBank. Wherein, the following primers are designed and synthesized according to the genome sequence of the VAX1 gene rs7078160 in GenBank:

forward primer P1: 5'-GCTTGGAGAGCCATAGGAAG-3' (SEQ ID NO:7)

Reverse primer P2: 5'-CTCCCAAAATGCTGGGATTA-3' (SEQ ID NO: 8).

According to the genome sequence of the gene rs4791774 of NTN1 in GenBank, the following primers are designed and synthesized:

forward primer P1: 5'-TTCAGATGTTCCCTGGAAGG-3' (SEQ ID NO:9)

Reverse primer P2: 5'-TTGGTAAAGGCAGTGTGCAT-3' (SEQ ID NO: 10).

3. PCR amplification of genes

PCR amplification was performed using Taq enzyme on a GeneAmp 9700PCR instrument using the Touchdown program using the extracted DNA as a template. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 2 min, denaturation at 94 ℃ for 30 sec, annealing at 63 ℃ for 40 sec, and extension at 72 ℃ for 40 sec for 10 cycles, wherein the annealing temperature decreases by 0.5 ℃ per cycle; 30 cycles of subsequent denaturation at 94 ℃ for 30 seconds, annealing at 58 ℃ for 40 seconds, and extension at 72 ℃ for 40 seconds; final extension at 72 ℃ for 7 min.

And verifying the PCR amplification product through agarose gel electrophoresis to obtain the amplification product of each gene.

4. SNP discovery and detection

After the PCR product was purified by Resin, it was sequenced by ABI-3730DNA sequencer (Applied Biosystems (ABI) of Applied Biosystems, USA), and sequence discrimination, genotyping and SNP confirmation were performed by Polyphred software.

The following SNPs were found to be associated with cleft lip and palate:

g → A at position 104 (rs7078160) in SEQ ID NO: 5:

GCTTGGAGAGCCATAGGAAGTTGAAGTAGAGACATAAAGAGT

CCAAAGCATCTTTGAGGCCTCCAAGTGGAGCTATGAGAGGTG

AGATAGATACTTGGGTTCAGAGCCCAAGACAGAGGCCTGGTC

AGGCAGACGAGAAATGGGAACCCATTTAAGAGTCATCAGGCC

AGGCACGGTGGCTCACGTCTGTAATCCCAGCATTTTGGGAGG

wherein, the 'G' in the sequence is the SNP locus.

A → G at position 179 in SEQ ID NO:6 (rs 4791774):

TTCAGATGTTCCCTGGAAGGAATCCCCTCGTTTTCTGCTCAC

AGCTGGTGTCGATATTTCCTTCTTGAGATGAGTTGTGCTTTT

CATTAAGTAAATTTTTTGTCTTGGGATTAAACCAACATTGTA

TTCTTAATAGACTTTCATGTTTACACTTCAAATGTCCACTGG

ATTGTTACTCATGTTATCTTGATGGCTTCTACGGTGTCTGCA

ATGCACACTGCCTTTACCAA

wherein, the 'A' in the sequence is the SNP locus.

Example 3 SNP genotyping and Association analysis

SNP genotyping was performed by direct one-way sequencing. Typing and correlation analyses were performed by sequencing in patients with cleft lip and palate and in normal controls, and the results are shown in the following table.

And carrying out descriptive statistical analysis on the genotyping result, and carrying out chi-square test on the tabulation. Whether the genotypes were different between the patients and the controls was observed, and the analysis results were as follows:

according to the research method of case-contrast correlation analysis, chi-square calculation is carried out on the genotyping result, and the result shows that 72 patients in 226 patients simultaneously carry locus rs7078160 allele type A and locus rs4791774 allele type G (namely, the locus rs7078160 genotype is AG or AA and the locus rs4791774 genotype is GA or GG); in 449 controls, 94 individuals had both locus rs7078160 allele type A and locus rs4791774 allele type G. The two have significant statistical difference compared: chi-square statistic p-0.001871.

Genotype of rs7078160 and rs4791774 and cleft lip and palate Risk

The risk test was performed using Odds Ratio (Odds Ratio), as shown in the table above, compared to individuals with either GG genotype of rs7078160 or AA genotype of rs 4791774:

the risk of cleft lip and palate occurrence of Odds Ratio of individuals with an rs7078160 site homozygous AA and an rs4791774 site homozygous GG is improved by 4.05 times (95% confidence interval is 1.00-16.4);

the rs7078160 site is homozygous AA and the individual with rs4791774 allele G has 1.88 times higher risk of cleft lip and palate (95% confidence interval 1.01-3.49);

individuals with rs7078160 allele type a and homozygous GG at rs4791774 site have a 2.95-fold increase in risk of cleft lip and palate (95% confidence interval 1.18-7.31);

in individuals with both rs7078160 allele type A and rs4791774 allele type G, the risk of cleft lip and palate, Odds Ratio, was increased by 1.88 times (95% confidence interval 1.18-3.00).

The above results show that: simultaneously, the gene carries rs7078160 allele type A and rs4791774 allele type G, and increases the susceptibility of cleft lip and palate.

The sequences referred to herein are as follows

Sequence of	Description of the invention
		SEQ ID NO:1	rs7078160
SEQ ID NO:2	rs4791774
		SEQ ID NO:3	rs7078160 Risk type
SEQ ID NO:4	rs4791774 Risk type
		SEQ ID NO:5	rs7078160 non-risk form
SEQ ID NO:6	rs4791774 non-risk type
		SEQ ID NO:7	Exemplary primer 1 of rs7078160
SEQ ID NO:8	Exemplary primer 2 of rs7078160
		SEQ ID NO:9	Exemplary primer 1 of rs4791774
SEQ ID NO:10	Exemplary primer 2 of rs4791774

Sequence listing

<110> Shanghai human genome research center

The Ninth People's Hospital Affiliated to medical school of Shanghai Jiaotong University

<120> cleft lip and palate related SNP marker and application thereof

<130> 199912

<141> 2019-12-25

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 210

<212> DNA

<213> Artificial Sequence

<400> 1

gcttggagag ccataggaag ttgaagtaga gacataaaga gtccaaagca tctttgaggc 60

ctccaagtgg agctatgaga ggtgagatag atacttgggt tcaragccca agacagaggc 120

ctggtcaggc agacgagaaa tgggaaccca tttaagagtc atcaggccag gcacggtggc 180

tcacgtctgt aatcccagca ttttgggagg 210

<210> 2

<211> 230

<212> DNA

<213> Artificial Sequence

<400> 2

ttcagatgtt ccctggaagg aatcccctcg ttttctgctc acagctggtg tcgatatttc 60

cttcttgaga tgagttgtgc ttttcattaa gtaaattttt tgtcttggga ttaaaccaac 120

attgtattct taatagactt tcatgtttac acttcaaatg tccactggat tgttactcgt 180

gttatcttga tggcttctac ggtgtctgca atgcacactg cctttaccaa 230

<210> 3

<211> 210

<212> DNA

<213> Homo sapiens

<400> 3

gcttggagag ccataggaag ttgaagtaga gacataaaga gtccaaagca tctttgaggc 60

ctccaagtgg agctatgaga ggtgagatag atacttgggt tcaaagccca agacagaggc 120

ctggtcaggc agacgagaaa tgggaaccca tttaagagtc atcaggccag gcacggtggc 180

tcacgtctgt aatcccagca ttttgggagg 210

<210> 4

<211> 230

<212> DNA

<213> Homo sapiens

<400> 4

ttcagatgtt ccctggaagg aatcccctcg ttttctgctc acagctggtg tcgatatttc 60

cttcttgaga tgagttgtgc ttttcattaa gtaaattttt tgtcttggga ttaaaccaac 120

attgtattct taatagactt tcatgtttac acttcaaatg tccactggat tgttactcgt 180

gttatcttga tggcttctac ggtgtctgca atgcacactg cctttaccaa 230

<210> 5

<211> 210

<212> DNA

<213> Homo sapiens

<400> 5

gcttggagag ccataggaag ttgaagtaga gacataaaga gtccaaagca tctttgaggc 60

ctccaagtgg agctatgaga ggtgagatag atacttgggt tcagagccca agacagaggc 120

ctggtcaggc agacgagaaa tgggaaccca tttaagagtc atcaggccag gcacggtggc 180

tcacgtctgt aatcccagca ttttgggagg 210

<210> 6

<211> 230

<212> DNA

<213> Homo sapiens

<400> 6

ttcagatgtt ccctggaagg aatcccctcg ttttctgctc acagctggtg tcgatatttc 60

cttcttgaga tgagttgtgc ttttcattaa gtaaattttt tgtcttggga ttaaaccaac 120

attgtattct taatagactt tcatgtttac acttcaaatg tccactggat tgttactcat 180

gttatcttga tggcttctac ggtgtctgca atgcacactg cctttaccaa 230

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

gcttggagag ccataggaag 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

ctcccaaaat gctgggatta 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

ttcagatgtt ccctggaagg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

ttggtaaagg cagtgtgcat 20

Claims

1. An isolated nucleic acid molecule from a mammal comprising SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G and rs4791774 is G or A,

preferably, rs7078160 is nucleotide 104 from 5' end of an amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NO 7 and 8 as primers, which is A or G; rs4791774 is G or A from 5' end of 179 th nucleotide of amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers,

more preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is SEQ ID NO. 2 nucleotide 179, which is G or A.

2. The nucleic acid molecule of claim 1, wherein said nucleic acid molecule is 20bp to 1000bp in length.

3. The nucleic acid molecule as claimed in claim 1 or 2, wherein the nucleotide sequence of the nucleic acid molecule comprises at least nucleotides 94 to 114 of SEQ ID NO. 1 and nucleotides 169 and 189 of SEQ ID NO. 2.

4. Primers for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, rs4791774 is G or A,

more preferably, rs7078160 is nucleotide 104 of SEQ ID NO:1, which is A or G; rs4791774 is 179 th nucleotide of SEQ ID NO. 2, which is G or A,

more preferably, the amplification product of the primer comprises at least nucleotides 94-114 of SEQ ID NO. 1 and nucleotides 169-189 of SEQ ID NO. 2.

5. The primer of claim 4, wherein the primer is selected from the group consisting of:

(1) 7 and 8 or a sequence having at least 90% identity thereto;

(2) 9 and 10 or a sequence having at least 90% identity thereto; and

(3) a mixture of the sequences of (1) and (2).

6. A probe for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, rs4791774 is G or A,

preferably, rs7078160 is nucleotide 104 from 5' end of an amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NO 7 and 8 as primers, which is A or G; rs4791774 is the 179 th nucleotide from the 5' end of the amplification product obtained by PCR amplification with mammalian genome DNA as template and SEQ ID NO 9 and 10 as primers, which is G or A, more preferably rs7078160 is the 104 th nucleotide of SEQ ID NO 1, which is A or G; rs4791774 is 179 th nucleotide of SEQ ID NO. 2, which is G or A,

preferably, the probe recognizes at least nucleotides 94-114 of SEQ ID NO. 1 and nucleotides 169-189 of SEQ ID NO. 2.

7. A kit comprises a reagent for detecting SNP markers rs7078160 and rs4791774, wherein rs7078160 is A or G, rs4791774 is G or A,

8. The kit of claim 7, wherein the reagents comprise one or more selected from the group consisting of: the nucleic acid molecule of any one of claims 1 to 3, the primer of claim 4 or 5, the probe of claim 6.

9. Use of a reagent for detecting SNP markers rs7078160 and rs4791774 in the preparation of a kit for assessing the risk of cleft lip and palate, wherein rs7078160 is A or G, rs4791774 is G or A,

preferably, the agent detects SNP markers rs7078160 and rs4791774 in the genome of a mammal, thereby assessing the risk of cleft lip and palate in the offspring of said mammal, or

The agent detects SNP markers rs7078160 and rs4791774 in the genome of a mammalian fetus, wherein the fetus is thereby assessed for risk of cleft lip and palate.

10. The use of claim 8, wherein the agent comprises one or more selected from the group consisting of: the nucleic acid molecule of any one of claims 1 to 3, the primer of claim 4 or 5, the probe of claim 6.