CN113122537B

CN113122537B - Non-small cell lung cancer pathogenic gene and application thereof

Info

Publication number: CN113122537B
Application number: CN202110400139.5A
Authority: CN
Inventors: 王琛; 陈熹; 周榆
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2021-04-14
Filing date: 2021-04-14
Publication date: 2022-05-13
Anticipated expiration: 2041-04-14
Also published as: CN113122537A

Abstract

The invention discloses a non-small cell lung cancer pathogenic gene and application thereof. A non-small cell lung cancer pathogenic gene, the sequence of which is shown in SEQ ID NO. 1. The specific antisense oligonucleotide is utilized to down regulate the expression of CTD-2245E15.3, and the growth of lung cancer cells can be obviously inhibited in vitro and in vivo. By constructing an in-situ lung cancer model and observing the in-vivo cancer promotion effect of lncRNA, experiments show that the over-expression of CTD-2245E15.3 obviously increases the lung tumor load. CTD-2245E15.3 plays an important role as a proto-oncogene lncRNA in anabolic processes. Therefore, CTD-2245E15.3 can be used as a therapeutic target to be applied to preparation and screening of medicaments for treating NSCLC. Substances capable of inhibiting CTD-2245E15.3 or down-regulating CTD-2245E15.3 expression can also be used for preparing medicaments for treating NSCLC.

Description

Non-small cell lung cancer pathogenic gene and application thereof

Technical Field

The invention belongs to the field of biological medicine, and relates to a non-small cell lung cancer pathogenic gene and application thereof.

Background

Non-small cell lung cancer (NSCLC) is the leading cause of death in malignant tumors worldwide in recent years. Early stage NSCLC patients have no obvious symptoms, and most of them have been diagnosed with locally advanced stages or developed tumor metastasis. Clinically, the treatment principle mainly based on operation is adopted for early patients; patients with advanced NSCLC mostly adopt radiotherapy, chemotherapy, targeted drugs and immunotherapy, however, the prognosis of patients is poor, the 5-year survival rate of the patients is less than 15%, and most patients finally develop drug resistance to chemotherapeutic drugs. Therefore, the research aiming at the early diagnosis and pathogenesis of lung cancer is a great problem to be solved urgently.

Long non-coding rnas (lncrnas) are long transcripts of greater than 200 bases that have essentially no protein-coding potential. There is increasing evidence that lncRNA plays a key regulatory role in the development of human cancer. Deep sequencing results show that thousands of lncrnas are abnormally expressed in different types of cancers. Currently, researchers have identified lncRNAs with oncogenic or cancer-inhibitory functions that can drive a number of important cancer phenotypes, including proliferation, migration, metastasis and genomic instability. LncRNA is widely involved in multiple levels of gene expression networks through interactions with other cellular macromolecules including DNA, proteins and RNA.

Currently, although several incrnas have been reported to play a role in NSCLC, there are still considerable functional unknowns of incrnas, including complete sequence, pro-or anti-cancer, mechanism of action, and the like.

Disclosure of Invention

The invention aims to provide a pathogenic gene of non-small cell lung cancer, aiming at the defects of the prior art.

Another purpose of the invention is to provide the application of the gene.

The purpose of the invention can be realized by the following technical scheme:

a non-small cell lung cancer pathogenic gene LncRNA CTD-2245E15.3, the sequence is shown in SEQ ID NO. 1.

An LncRNA CTD-2245E15.3 shown in SEQ ID NO.1 is used as a therapeutic target for preparing a non-small cell lung cancer therapeutic drug.

An LncRNA CTD-2245E15.3 shown in SEQ ID NO.1 is used as a pathogenic gene to screen non-small cell lung cancer treatment drugs.

The LncRNA CTD-2245E15.3 shown in SEQ ID NO.1 or the substance for reducing the expression thereof in the preparation of the non-small cell lung cancer treatment medicine.

Preferably, the substance for down-regulating the expression of LncRNA CTD-2245E15.3 is specific antisense oligonucleotide of LncRNA CTD-2245E15.3, siRNA/shRNA, zinc finger nuclease (ZNF), transcription activator-like effector nuclease (TALENs), CRISPR/Cas9 gene editing system, small molecule inhibitor or adenovirus and lentivirus.

As a further preferred aspect of the present invention, the specific antisense oligonucleotide sequence of LncRNA CTD-2245E15.3 is shown as SEQ ID NO.2 or SEQ ID NO. 3.

Has the advantages that:

the present invention reports for the first time a novel lncRNA, CTD-2245E15.3, which promotes lung cancer cell growth by promoting the anabolic enzymes acetyl-CoA carboxylase 1(ACC1) and Pyruvate Carboxylase (PC). First, based on the application of lncRNA chips, we identified a set of differentially expressed lncrnas in NSCLC and verified using quantitative real-time polymerase chain reaction (qRT-PCR). Of the 10 lncRNAs validated, CTD-2245E15.3 was upregulated most fold in NSCLC. Subsequently, we identified the full-length sequence of this lncRNA-685 bp using RACE technology. The specific antisense oligonucleotide (ASO) is used for reducing the expression of CTD-2245E15.3, and the lung cancer cell growth can be obviously inhibited in vitro and in vivo. Through injecting lung cancer cell A549 to lung, an in-situ lung cancer model is constructed, the cancer promotion effect of lncRNA in vivo is observed, and experiments show that the over-expression of CTD-2245E15.3 obviously increases the lung tumor load. By RNA pull-down combined mass spectrometry detection, we found that CTD-2245E15.3 exerts its oncogenic function by binding to ACC1 and PC; ACC1 and PC are key metabolic factors for biomolecule synthesis in rapidly proliferating tumor cells. These findings reveal an important role for CTD-2245E15.3 as the oncogene lncRNA in anabolic processes. Therefore, CTD-2245E15.3 can be used as a therapeutic target to be applied to preparation and screening of medicaments for treating NSCLC. And substances capable of inhibiting CTD-2245E15.3 or reducing the expression of CTD-2245E15.3 can also be used for preparing medicaments for treating NSCLC.

Drawings

FIG. 1, chip analysis of Arraystar IncRNA, B.qRT-PCR validation of differentially expressed IncRNA from 10 chips obtained by chip analysis, and C.qRT-PCR analysis of CTD-2245E15.3 expression in 15 NSCLC tumors and their matched non-tumor tissues

FIG. 2 shows the electrophoretic patterns of CTD-2245E 15.35 'end, 3' end and full-length sequence obtained by RACE technique, B.CTD-2245E15.3 on chromosome, C.human CTD-2245E15.3 complete full-length sequence, and D.CTD-2245E15.3 coding capacity analysis

FIG. 3, A. Using specific ASO to silence CTD-2245E15.3 in lung cancer cells, B.CCK8 experiment analysis shows that CTD-2245E15.3 down-regulates and inhibits lung cancer cell growth, C.A549 stable transgenic cell strain shows that CTD-2245E15.3 over-expresses and D.CCK8 experiment analysis shows that CTD-2245E15.3 over-expresses and promotes lung cancer cell growth

FIG. 4 shows a subcutaneous tumor implantation model, wherein the tumor size is measured every three days from the 14 th day of tumor implantation, and the tumor is dissected and weighed after five weeks

FIG. 5, in situ Lung cancer model, A. the expression level of CTD-2245E15.3 of lung tumor, B.CTD-2245E15.3 overexpression can significantly increase lung tumor burden, and the lung tumor volume of C.CTD-2245E15.3 overexpression group is significantly larger than that of the control group

FIG. 6 silver staining of lncRNA pull-down protein

Detailed Description

Example 1 screening for differentially expressed lncRNAs in NSCLC

1.1 Arraystar LncRNA Gene chip analysis:

IncRNA chip analysis was performed by Aksimics (Shanghai, China). Briefly, samples (five NSCLC tissues and five corresponding non-tumor tissues) were used to synthesize double-stranded complementary DNA, which was further labeled and hybridized to a human LncRNA expression microarray (Arraystar, Rockville, MD). After hybridization and washing, the treated slides were scanned with an agilent DNA microarray scanner. Acquired array images were analyzed using agilent feature extraction software. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v12.1 software package (Agilent Technologies). Statistically significant differentially expressed lncRNA between the two groups was identified by P-value/FDR filtration. The threshold settings for up and down regulated genes were fold change > -2.0 and P-value < -0.05. The results are shown in FIG. 1A, from which it can be seen that: CTD-2245E15.3 is up-regulated in NSCLC.

1.2 qRT-PCR detection of differentially expressed lncRNAs between NSCLC and paired non-tumor tissues

To verify the chip findings, we selected 10 lncRNAs with large differential expression and analyzed the same batch of chips (total RNA of five NSCLC tissues and five corresponding non-tumor tissues) using real-time quantitative reverse transcription PCR (qRT-PCR) (fig. 1B), where CTD-2245E15.3 was the highest relative expression level in NSCLC tumors (fold change of tumor versus normal > 10). Primers shown in Table 1 were designed and prepared by Nanjing Kinsrui Biotechnology Ltd:

TABLE 1 primer sequence information

(1) Reverse transcription reaction

The lncRNA and mRNA reverse transcription reaction systems are shown in tables 2 and 3 below:

TABLE 2 IncRNA reverse transcription reaction System

TABLE 3 mRNA reverse transcription reaction System

Wherein, before reverse transcription, lncRNA needs to be mixed with oligo (dT), Random Primer (N9) and a proper amount of DEPC water uniformly, heated for 10min at 70 ℃ to destroy the secondary structure, and then mixed with mother liquor to carry out the following reverse transcription reaction.

The lncRNA or mRNA reverse transcription reaction program is shown in table 4:

TABLE 4 reverse transcription reaction procedure for lncRNA or mRNA

The reverse transcribed samples can be stored at-20 ℃ or subjected to subsequent qRT-PCR experiments.

(2) PCR reaction

The PCR reaction system for lncRNA or mRNA is shown in table 5:

TABLE 5 PCR reaction System for IncRNA or mRNA

PCR reaction procedure for lncRNA or mRNA is shown in table 6:

TABLE 6 PCR reaction procedure for IncRNA or mRNA

All reactions in the PCR experiment are performed in triplicate, after the reaction is finished, a proper threshold value is selected according to an amplification curve to obtain a Ct value of each duplicate well, and the expression level of lncRNA is normalized relative to GAPDH mRNA.

The results are shown in FIG. 1B, from which it can be seen that CTD-2245E15.3 is significantly upregulated in NSCLC in 10 lncRNA compared to normal lung tissue, and the fold of upregulation is highest.

1.3 expansion of sample size to verify that CTD-2245E15.3 is up-regulated in NSCLC

Another batch of NSCLC tumors and their matched non-tumor tissues (n ═ 15) were collected and tested for CTD-2245E15.3 expression using qRT-PCR, and the results are shown in fig. 1C, which further confirmed that CTD-2245E15.3 was up-regulated in NSCLC tumor tissues.

Example 2 identification of the complete full-length sequence-RACE technique:

the exact location of the 15.3 end of CTD-2245E was identified by 5'RACE and 3' RACE using the 5 'or 3' RACE kit (Clontech) to rapidly amplify the cDNA ends.

5' RACE: designing and synthesizing specific primers 5' RACE-GSP1 and 5' RACE-GSP2 according to the predicted sequence of the database, amplifying a 5' end sequence according to the instruction method of the kit, and sequencing;

3' RACE: designing and synthesizing specific primers 3' RACE-GSP1 and 3' RACE-GSP2 according to the predicted sequence of the database, amplifying a 3' terminal sequence according to the instruction method of the kit, and sequencing;

full-length amplification: according to the sequences of 5 'and 3' RACE, the complete full length is amplified by PCR by using primers at two ends and sequenced.

TABLE 7 primers for RACE

RACE primers	Sequence
		5'RACE-GSP1	GAACACGCGGGAAATTTTGGGGTG
5'RACE-GSP2	GCTGGCATCTGAGTGTCACAGGGAT
		3'RACE-GSP1	CCGCAGGACTCCAGGGAACAAG
3'RACE-GSP2	GATGGAATGAGAATTGAGAAGCAG

The results are shown in FIG. 2A, agarose gel electrophoresis of 5'-RACE (left), 3' -RACE (center) and full-length CTD-2245E15.3 (right) PCR products. Molecular weights (base pairs) are shown on the left, and the major bands of the PCR product are marked by the arrows on the right.

FIG. 2B shows the location of CTD-2245E15.3 on the chromosome with the 5 'and 3' ends marked; FIG. 2C shows the complete full-length sequence (685bp, SEQ ID NO.1) of human CTD-2245E 15.3.

FIG. 2D the coding potency of CTD-2245E15.3 was evaluated using the coding potency assessment tool (http:// lilab. research. bcm. edu/cpat/index. php), and the results showed that the coding potency was very low, comparable to the well-known incRNA MALAT1, FENDRR and lincRNA-p21, suggesting that the CTD-2245E15.3 transcript does not encode protein.

Example 3 specific down-regulation of lncRNA expression using antisense oligonucleotides (ASOs):

3.1 design and sequence information of ASO

The ASO used in the present invention was designed and synthesized by the cantonese biotechnology, and the sequence information is shown in table 8.

TABLE 8 ASO sequence information

3.2 transfection of cells

Cell transfection procedure was as follows:

A. inoculating the cells in a 6-well plate one day before transfection, and enabling the density of adherent cells to reach 70-80% after 24 hours;

B. diluting ASO-1, ASO-2, ncRNA (200 pmol/hole) and Lipofectamine 2000(5 μ l/hole) with an appropriate amount of opti-MEM medium, blowing and mixing uniformly by using a pipette gun, and incubating for 15min at room temperature;

C. taking the 6-hole plate out of the cell culture box, sucking out original cell culture solution, rinsing the cell surface with PBS, and sucking out cell surface liquid;

D. adding the incubated transfection working solution into a 6-well plate, filling the volume to 2 ml/well by using opti-MEM, gently shaking up, and placing the plate in a 37 ℃ cell culture box for cell transfection;

E. after 4-6h of transfection, the original culture solution is aspirated and replaced by new serum-containing DMEM medium or subjected to the next experimental treatment.

F. And extracting total RNA of the cells 24h after liquid change.

3.3 detection of CTD-2245E15.3 expression level

The silencing efficiency of CTD-2245E15.3 in A549, H358 and PC-9 cells is detected as follows:

A. after 24h of cell transfection procedure as described above, cells were harvested and total RNA was extracted using Trizol reagent;

B. the expression level of CTD-2245E15.3 in the cells was determined by using the qRT-PCR method.

The results are shown in FIG. 3A, from which it can be seen that: two ASOs were able to significantly down-regulate CTD-2245E15.3 expression levels compared to the negative control rna (ncrna).

3.4 CCK8 experiments:

after silencing CTD-2245E15.3 in A549, H358, PC-9 cells by means of cell transfection, the growth of the cells is analyzed by using a CCK-8 experiment, and the specific steps are as follows:

A. performing cell transfection operation as described above, after 4h of transfection, digesting and collecting cells in 1.5ml EP tube, centrifuging at room temperature for 3min at 800g, removing supernatant by aspiration, and adding 1ml of new serum-containing DMEM medium to each tube to resuspend cells;

B. taking 10 μ l of cell suspension, and using a blood cell counting plate to count cells;

C. cells were treated at 5X 10³The density of each well is inoculated in a 96-well plate, and the plates are respectively cultured for 0/24/48/72h in a cell culture box at 37 ℃;

D. taking out the 96-well plate in the above step, preparing CCK-8 working solution (DMEM culture medium containing 10% CCK-8 stock solution) under the condition of keeping out of the sun, removing the culture solution in the 96-well plate by using a suction pump, and adding the prepared CCK-8 working solution, wherein each well is 100 mu l;

E. after incubation at 37 ℃ for 1h, the OD at 450nm was measured using a microplate reader.

The results are shown in fig. 3B, and it can be seen from the figure that the down-regulation of CTD-2245E15.3 expression by specific antisense oligonucleotide (ASO) can significantly inhibit the growth of lung cancer cells in vitro.

Example 4 construction of lncRNA-over-expressed a549 stable transgenic cell line:

4.1 cell culture and passage of A549 cell line

Cell culture: a549 cell line was purchased from Shanghai Biochemical and cell biology institute of Chinese academy of sciences, and cultured in DMEM (10% fetal bovine serum, 100U/ml penicillin and streptomycin) at 37 deg.C and CO₂Cell culture was performed in a cell culture chamber with a concentration of 5%.

Cell passage: a549 is an adherent growth type cell, when the cell density reaches 80-90%, passage is carried out, the original cell culture solution is poured off, PBS is used for rinsing the cell and then absorbing cell surface liquid, a proper amount of pancreatin preheated at 37 ℃ is added, the cell surface liquid is digested for 3min in a cell culture box at 37 ℃, the side wall of a culture dish is tapped until the cell falls off, a proper amount of the cell culture medium is immediately added to stop digestion, a liquid transfer gun is used for blowing and evenly mixing the cell, the cell surface liquid is transferred to a 15ml centrifuge tube, 800g is centrifuged for 3min at normal temperature, supernatant liquid is absorbed, the cell culture medium is used for resuspending the cell, and the cell surface liquid is transferred to a new cell culture dish for cell culture.

4.2 construction of stably transfected cell lines

For the overexpression of CTD-2245E15.3, the GenePharma company (Shanghai, China) synthesized the human full-length CTD-2245E15.3 cDNA obtained according to the RACE technique.

GenePharma corporation was entrusted with the production of CTD-2245E 15.3-expressing lentivirus and Negative Control (NC) lentivirus:

viral and viral packaging

1.293T cells were cultured in 10cm dishes to 80-90% confluency and then plated on 15cm dishes.

2. The culture medium was decanted and the cells were washed twice with 1ml of D-Hank's solution.

3. Adding 1ml of Trypsin-EDTA solution, mixing uniformly, and standing at 37 ℃ for 2-3 minutes.

4. The pancreatin solution was aspirated, 2ml of DMEM medium containing 10% FBS was added, and the cells were blown up to form a single cell suspension.

5. The cell suspension was inoculated into a 15cm dish, 18ml of DMEM medium containing 10% FBS was added thereto, mixed well and cultured overnight at 37 ℃ in 5% CO 2.

6. Adding 1.5ml of serum-free DMEM into one sterile 5ml centrifuge tube, adding the shuttle plasmid A8180 and the packaging plasmid (pGag/Pol, pRev and pVSV-G) according to a proportion, uniformly mixing, taking the other sterile 5ml centrifuge tube, adding 1.5ml of serum-free DMEM, adding 300 mu l of RNAi-mate, uniformly mixing, standing at room temperature for 5 minutes, mixing the two tubes, and standing at room temperature for 20-25 minutes.

7. The medium was removed from the 15cm dish and 8ml of serum-free DMEM medium was added.

8. The transfection mixture was added dropwise to a 15cm petri dish, the dish was gently shaken back and forth to mix the complex, and incubated at 37 ℃ in a 5% CO2 incubator for 4-6 hours.

9. The transfection solution was discarded and 18ml of DMEM medium containing 10% FBS was added. The culture was continued at 37 ℃ for 72 hours with 5% CO 2.

Second, lentivirus Collection

1. The cell supernatant in the dish was pipetted into a 50ml centrifuge tube at 4 ℃ and 4000rpm for 4 min.

2. After low speed centrifugation, the tube supernatant was poured into a 50ml syringe and filtered through a 0.45um filter.

3. The filtrate was ultracentrifuged in a centrifuge at 4 ℃ and 20000rpm for 2 h.

4. And collecting the concentrated solution and subpackaging into a delivery pipe.

5. Labeling the packaged virus liquid, and storing in a refrigerator at-80 deg.C.

Third, lentivirus titer detection

1.293T cells were cultured in 10cm dish to 80-90% confluence, the medium was decanted and the cells were washed twice with 3ml D-Hank's solution.

2. Adding 1ml of Trypsin-EDTA solution, mixing uniformly, absorbing the pancreatin solution, and standing at 37 ℃ for 3-5 minutes.

3. The cells were then made into a single cell suspension by adding 2ml of DMEM medium containing 10% FBS and pipetting.

4. 96-well plates were seeded at a concentration of 3X 104 cells/well, mixed well and cultured at 37 ℃ for 24h in 5% CO 2.

5. Lentiviral stocks (10-20ul) were diluted ten-fold for 3-5 gradients in 10% FBS DMEM (Polybrene was added to a final concentration of 5ug/ul, if necessary, depending on cell status).

6. The culture medium was aspirated from the 96-well plate, 100. mu.l of diluted virus solution was added to each well, and a blank control was set and cultured at 37 ℃ for 24 hours with 5% CO 2.

7. The diluted virus solution in the 96-well plate was discarded, and 100. mu.l of 10% FBS-containing DMEM medium was added to each well (1/3-1/5 was separated if necessary depending on the cell status) and the culture was continued at 37 ℃ for 72 hours with 5% CO 2.

8. The fluorescent cells were counted by fluorescence microscopy or FACS, and the virus titer was calculated in combination with the dilution factor. Lentivirus-infected cells: a549 cells at 1x10 per well⁵Was inoculated on a 6-well plate, and then 10. mu.l of lentivirus was added to 1ml of DMEM medium supplemented with 2% inactivated FBS and 5. mu.g/ml ofPolybrene. After 24 hours, 1ml of DMEM medium containing 2% inactivated FBS was added to the 6-well plate and transduced cells were selected with 1. mu.g/ml puromycin 48h post infection. Stable cell lines were established by culturing for 3 passages with 1. mu.g/ml puromycin in the medium. The over-expression efficiency of CTD-2245E15.3 in the stably transformed A549 cells is verified by qRT-PCR, and the result is shown in figure 3C, and the expression level of CTD-2245E15.3 in the stably transformed A549 cells is obviously higher than that of a negative control.

4.3 CCK8 experiment

The growth condition of the stably transformed A549 cells is analyzed by adopting a CCK-8 experiment, the result is shown in figure 3D, and the result shows that the over-expression of CTD-2245E15.3 can promote the growth of the lung cancer cells.

Example 5 Down-Regulation of CTD-2245E15.3 expression significantly inhibits growth of Lung cancer cells in vivo

5.1 subcutaneous tumor implantation

ncRNA and CTD-2245E15.3 ASO-treated PC-9 cell suspensions were prepared separately and injected subcutaneously into the ventral side of nude mice to assess the effect of CTD-2245E15.3 knockdown on xenograft tumor formation. The results are shown in FIG. 4, in which PC-9 cells xenografted after CTD-2245E15.3 knockdown grew significantly slower than the ncRNA control (FIG. 4A), and the dissected tumor weight was also lighter than the control (FIG. 4B).

Example 6

6.1 in situ Lung cancer model:

BALB/c nude mice were anesthetized by intraperitoneal injection of 1% pentobarbital, and then fixed in supine position on sterile gauze. Removing hair from the operation part, disinfecting skin with iodophor, and deiodinating with 95% alcohol. A5 mm skin incision is made at about 1.5cm above the anterior line of the left axillary arch, the skin and subcutaneous tissue are separated layer by layer, the chest wall is exposed, and the left lung is observed to move up and down with breathing. 100 μ L of cell suspension (50ul 5X 10) was withdrawn with an insulin syringe⁶A549 cells mixed with 50ul Matrigel), and injected into the left lung with a needle insertion depth of about 3mm, and after a few seconds of stay after injection, the needle is slowly pulled out to prevent the liquid from flowing out. The incision is sutured layer by layer. After operation, the wound part is disinfected by iodophor, and the breeding is continued, and the people can freely take food and drink water. Lung tissue was dissected at day 37 post inoculation and the results are shown in figure 5.

Fig. 5A confirmed by qRT-PCR that the expression level of CTD-2245E15.3 was significantly higher in lung tumors of the over-expressed group than that of the NC control group (n ═ 3). Fig. 5B-C analyzed the mean lung tumor area per mouse per group (n-8) and calculated tumor area as a percentage of total lung area, showing that overexpression of CTD-2245E15.3 resulted in a significant increase in total tumor burden (fig. 5B) and mean tumor size (fig. 5C) compared to NC.

Example 7 binding proteins to lncRNA were found by RNA pull-down:

incubating biotinylated CTD-2245E15.3 or EGFP RNA with a549 whole cell lysate; cell lysate preparation: 1000 ten thousand cells were resuspended in 1ml of IP buffer (20mM Tris pH 7.4, 150mM NaCl, 1% NP-40, 1mM EDTA, 0.5mM DTT, 1mM NaF, protease inhibitor and RNase inhibitor) and briefly sonicated. After incubation, the RNA-protein complexes were recovered by streptavidin magnetic beads, washed five times in IP buffer and eluted in SDS loading buffer. The binding proteins were separated by SDS-PAGE and visualized by silver staining. The results are shown in FIG. 6, in which the arrows indicate the presence of a specific protein band only in the CTD-2245E15.3 sample, compared to the negative control EGFP RNA. These five bands were cut out for mass spectrometry, and ACC1 (acetyl-CoA carboxylase 1) and PC (pyruvate carboxylase) were identified as the most abundant proteins.

The invention discloses a discovery that LncRNA CTD-2245E15.3 is a non-small cell lung cancer pathogenic gene, all substances capable of reducing expression of LncRNA CTD-2245E15.3 can be used for preparing non-small cell lung cancer therapeutic drugs, such as specific antisense oligonucleotides, siRNA/shRNA, zinc finger nuclease (ZNF), Transcription Activator Like Effector Nuclease (TALENs), CRISPR/Cas9 gene editing system, small molecule inhibitors or adenovirus, lentivirus and the like, in the embodiment, only two different specific antisense oligonucleotides are taken as an example to reduce expression quantity of LncRNA CTD-2245E15.3, the relation between LncRNA CTD-2245E15.3 and non-small cell lung cancer is explored, the scope of the present invention is not limited thereby, and is not limited thereby to the use of only two specific antisense oligonucleotides described in the examples for the preparation of a non-small cell lung cancer therapeutic agent.

Sequence listing

<110> Nanjing university

<120> non-small cell lung cancer pathogenic gene and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 685

<212> DNA

<213> human (Homo sapiens)

<400> 1

accaaagaag agacaacatc cagcagcagc cactcccgca ggactccagg gaacaaggat 60

ggaatgagaa ttgagaagca gagctgagct gtgactcaag caccgggctg gctgccacac 120

agcatccctg tgacactcag atgccagcta acgtgttcta ataaaactaa ccagtcacat 180

cggtcaaacc ctaccttgat ccggtgatgg gcccctgccc accccaaaat ttcccgcgtg 240

ttcatgaaag acgactaact ccagaacgga acatgacgca cgtgccgaga catcagcatt 300

gagtaagcac ccgctgtggg ccaggcccgg tctcaggaca gctgcgcgcc ctccagactc 360

cacggtccta cagacaatga atattatgca accaaaatgt cctgggaatt cagagccaaa 420

ggcagcattc ttaggaaatg cctcccactc tcctgccatg gcatagagct ctgctgggct 480

ctggacctgc agagaagatg ctggggcttg tgggaggcca ggaaaggaag aggccctcgt 540

cacaatgctc ctgagacggt gaggcagggg tttcccttac actccctgtt cccaagtatg 600

tgaagataat tccacgcagc atttttcaaa gccaactgga acgagttact gtaagcagtc 660

tttccataaa agatcactct ttgag 685

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtcctgggaa ttcagagcca 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagaagcaga gctgagctgt 20

Claims

An LncRNA CTD-2245E15.3 shown in SEQ ID NO.1 is used as a pathogenic gene to screen non-small cell lung cancer treatment drugs.
2. The LncRNA CTD-2245E15.3 shown in SEQ ID NO.1 or the substance for reducing the expression thereof in the preparation of the non-small cell lung cancer treatment medicine.
3. The use according to claim 2, characterized in that said substance which down-regulates the expression of LncRNA CTD-2245E15.3 is an antisense oligonucleotide specific for LncRNA CTD-2245E 15.3.
4. The use according to claim 3, wherein said specific antisense oligonucleotide sequence of LncRNA CTD-2245E15.3 is as shown in SEQ ID No.2 or SEQ ID No. 3.