CN113122478B

CN113122478B - Lactobacillus paracasei capable of relieving gastrointestinal injury caused by capsaicin and application thereof

Info

Publication number: CN113122478B
Application number: CN202110453847.5A
Authority: CN
Inventors: 毛丙永; 项群然; 崔树茂; 唐鑫; 陆文伟; 刘小鸣; 赵建新; 陈卫
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-04-26
Filing date: 2021-04-26
Publication date: 2022-09-06
Anticipated expiration: 2041-04-26
Also published as: CN113122478A

Abstract

The invention discloses lactobacillus paracasei capable of relieving gastrointestinal injury caused by capsaicin and application thereof, and belongs to the technical field of microorganisms. The lactobacillus paracasei CCFM1176 can relieve the mouse liver oxidative stress caused by capsaicin and reduce the serum neuropeptide level of the mouse liver oxidative stress; can improve the damage of capsaicin such as gastric mucosa cell vacuolation, small intestine villus desquamation, colon goblet cell reduction, inflammatory cell infiltration and the like; can reduce the transcription level of the mouse gastrointestinal tissue inflammation marker protein. The lactobacillus paracasei CCFM1176 is used for preparing a medicinal composition and fermented food for relieving piquancy and protecting intestines and stomach, and has very wide application prospect.

Description

Lactobacillus paracasei capable of relieving gastrointestinal injury caused by capsaicin and application thereof

Technical Field

The invention relates to lactobacillus paracasei capable of relieving gastrointestinal injury caused by capsaicin and application thereof, belonging to the technical field of microorganisms.

Background

Chili is a flavor spice, which is widely processed and eaten due to its unique pungent taste. The main source of the pungent taste in the pepper fruits is capsaicin. The molecular formula of capsaicin is C ₁₈ H ₂₇ NO ₃ The chemical formula is trans-8-methyl-N-vanillyl-6-nonenamide, which is an extremely spicy vanillylamide alkaloid.

Because capsaicin has strong irritation, the digestive tract has bad perceptions of burning, heartburn, pain and the like after being ingested, and has certain negative effects on digestive metabolism, gastrointestinal mucosa, intestinal flora and specific functional gastrointestinal diseases. The concrete expression is as follows: the oxidative stress level of the liver is increased, and the activities of antioxidant enzymes such as glutathione peroxidase (GSH-PX) and Catalase (CAT) are reduced; increased serum neuropeptide Substance P (SP), calcitonin gene-related peptide (CGRP) levels; gastric mucosal cells vacuolate, villi in the hollow and ileum fall off with inflammatory cell infiltration, and colonic goblet cells are reduced with inflammatory cell infiltration.

Exploring the possible mechanism of capsaicin-induced gastrointestinal injury, we found that the TRPV1 receptor has a significant association with it. With the continuous and intensive research on the correlation between probiotics and gastrointestinal diseases, part of the research begins to adopt probiotics to intervene in gastrointestinal tract injury diseases, wherein the correlation between probiotics and capsaicin-induced gastrointestinal injury is proved. Lactobacillus reuteri DSM17398 can inhibit the sensation of stomachache of rats, and a specific target channel of the stomachache is related to a capsaicin receptor TRPV 1. Gastrointestinal symbiotic bacterial colony MET-1 capable of reducing TRPV1 agonist capsaicin to Ca ²⁺ The effect of the inflow. The above studies indicate that probiotics have correlation with capsaicin receptor TRPV1 and gastrointestinal pain, suggesting that probiotics are beneficialThe bacteria have great potential in improving gastrointestinal damage caused by capsaicin.

However, probiotics for relieving gastrointestinal injury only interact with capsaicin receptor TRPV1, and the relation of gastrointestinal injury caused by capsaicin is not clear. Therefore, a probiotic preparation or a fermentation product for relieving piquancy and protecting intestines and stomach is also lacking in the market, and a probiotic strain capable of relieving gastrointestinal injury caused by capsaicin is urgently needed to be found so as to expand the application of the probiotic in daily diet matching.

Disclosure of Invention

The invention provides a strain of lactobacillus paracaseiLactobacillus paracasei) CCFM1176, which has been deposited in Guangdong province culture Collection on 19.3.2021, with the deposit number of GDMCC No: 61573.

the lactobacillus paracasei of the invention has the following characteristics:

(1) morphological characteristics of the microorganisms: the cells were slightly irregular, rounded-ended Campylobacter, non-motile, non-sporulating.

(2) Culture properties: the colony cultured on the MRS culture medium for 48 hours is generally milky white, smooth and convex, and does not produce pigments.

The invention also provides a composition containing the lactobacillus paracasei.

In one embodiment, the composition contains Lactobacillus paracasei in an amount of 1X 10 or more ⁵ CFU/g or 1X 10 ⁵ CFU/mL。

In one embodiment, the composition is a leaven, the leaven is a powder prepared from a bacterial liquid containing the lactobacillus paracasei CCFM1176, and the powder contains 10 ⁶ CFU/g above active Lactobacillus paracasei CCFM 1176.

In one embodiment, the powder is prepared by a conventional freeze drying process or other processes of a bacterial liquid containing the lactobacillus paracasei CCFM 1176.

In one embodiment, the starter is prepared by the following steps:

(1) preparation of a culture medium: peptone 10g/L, beef extract 10g/L, acetic acid2g/L of sodium, 5g/L of yeast powder and 2g/L, K of diammonium hydrogen citrate ₂ PO ₄ ·3H ₂ O2.6g/L、MgSO ₄ ·7H ₂ O0.1g/L、MnSO ₄ 0.05g/L, Tween 801mL/L, agar 20g/L, cysteine hydrochloride 0.5g/L, pH = 6.8.

(2) Preparation of the protective agent: mixing water and protective agent raw materials to prepare a protective agent containing 100g/L of skimmed milk powder, 30mL/L of glycerin, 100g/L of maltodextrin, 150g/L of trehalose and 10 g/LL-sodium glutamate;

(3) inoculating lactobacillus paracasei CCFM1176 into the culture medium prepared in the step (1) according to the inoculation amount of 2-4% of the weight of the culture medium, culturing for 18h at the temperature of 37 ℃, centrifugally collecting thalli, washing the thalli for 2-4 times by using phosphate buffer solution with the pH =7.2, and re-suspending by using the protective agent until the concentration reaches 10 ¹⁰ CFU/mL; then pre-culturing the suspension at 37 deg.C for 60min, and freeze drying to obtain the starter.

In one embodiment, the starter culture further comprises a microorganism useful in food products; alternatively, one or both of Streptococcus thermophilus and Lactobacillus bulgaricus are included, but not limited to.

The invention also provides application of the lactobacillus paracasei CCFM 1176.

In one embodiment, the use is as a fermenting microorganism for the preparation of a fermented food or a fermented beverage product.

In one embodiment, the fermented food product is a dairy product, a soy product, or a fruit and vegetable product. Optionally, the dairy product is milk, sour cream or cheese. Optionally, the soy product is soy milk, fermented soya beans or soy paste. Optionally, the fruit and vegetable product is a cucumber, carrot, beet, celery or cabbage product.

In one embodiment, the use is for the preparation of a pharmaceutical composition for preventing and/or ameliorating gastrointestinal damage caused by capsaicin.

In one embodiment, the preventing and/or ameliorating capsaicin-induced gastrointestinal damage comprises at least one of:

(1) relieving liver oxidative stress caused by capsaicin;

(2) reducing serum neuropeptide levels;

(3) improving at least one injury of gastric mucosa cell vacuolation, small intestine villus desquamation, colon goblet cell reduction and inflammatory cell infiltration caused by capsaicin;

(4) reduce the transcription level of the mouse gastrointestinal tissue inflammation marker protein.

In one embodiment, the pharmaceutical composition is comprised of lactobacillus paracasei CCFM1176 and a pharmaceutically acceptable carrier.

In one embodiment, the pharmaceutically acceptable carrier is one or more carriers selected from the group consisting of fillers, binders, wetting agents, disintegrants, lubricants, and flavoring agents, which are generally used in pharmacy. Optionally, the pharmaceutical composition is in the form of granules, capsules, tablets, pills or oral liquid.

The invention has the following beneficial effects and advantages: the lactobacillus paracasei CCFM1176 can relieve the oxidative stress of the mouse liver caused by capsaicin and reduce the serum neuropeptide level of the mouse liver; can improve the damage caused by capsaicin, such as gastric mucosal cell vacuolation, small intestine villus desquamation, colon goblet cell reduction, inflammatory cell infiltration, etc.; can reduce the transcription level of the mouse gastrointestinal tissue inflammation marker protein. The lactobacillus paracasei CCFM1176 is used for preparing a medicinal composition and fermented food for relieving piquancy and protecting intestines and stomach, and has very wide application prospect.

Biological material preservation

Lactobacillus paracasei: (Lactobacillus paracasei) CCFM1176, classified and namedLactobacillus paracaseiAnd has been preserved in Guangdong province culture Collection, 3.19.2021, with the preservation number GDMCC No: 61573.

drawings

FIG. 1 shows the glutathione peroxidase activity of the livers of mice of different treatment groups.

FIG. 2 shows the catalase activity of the livers of mice of different treatment groups.

FIG. 3 shows the glutathione content of the liver of mice of different treatment groups.

FIG. 4 is the malondialdehyde content of the liver of mice of different treatment groups.

FIG. 5 shows the serum content of substance P in mice of different treatment groups.

FIG. 6 shows the content of calcitonin gene-related peptide in serum of mice of different treatment groups.

FIG. 7 is the gastric tissue morphology (HE staining) of mice from different treatment groups.

FIG. 8 is jejunal tissue morphology (HE staining) of mice of different treatment groups.

Figure 9 is ileal tissue morphology (HE staining) of mice of different treatment groups.

FIG. 10 is colon histomorphology (HE staining) of mice of different treatment groups.

FIG. 11 shows the levels of inflammation-associated protein transcription in gastric tissue of mice from different treatment groups.

FIG. 12 shows the level of inflammation-associated protein transcription in colon tissue of mice of different treatment groups.

Detailed Description

The following examples relate to SPF grade 6 week old male C57BL/J mice purchased from Witongliwa laboratory animals, Inc.; the ELISA kits referred to in the following examples were purchased from Shanghai enzyme-linked Biotechnology, Inc.; the skim milk powder, trehalose, sucrose and paraformaldehyde referred to in the examples were purchased from national chemical group, ltd; the aliskiren blue and the nuclear fast red staining solution referred to in the following examples were purchased from Wuhan Seville Biotech Ltd.

The media involved in the following examples are as follows:

MRS solid medium (g/L): 10g/L of peptone, 10g/L of beef extract, 20g/L of glucose, 2g/L of sodium acetate, 5g/L of yeast powder and 2g/L, K of diammonium hydrogen citrate ₂ PO ₄ ·3H ₂ O2.6g/L、MgSO ₄ ·7H ₂ O0.1g/L、MnSO ₄ 0.05g/L, Tween 801mL/L, agar 20g/L, cysteine hydrochloride 0.5g/L, and pH 6.8.

MRS liquid medium (g/L): 10g/L of peptone, 10g/L of beef extract, 20g/L of glucose and 2g/L of sodium acetateL, 5g/L of yeast powder and 2g/L, K g of diammonium hydrogen citrate ₂ PO ₄ ·3H ₂ O2.6g/L、MgSO ₄ ·7H ₂ O0.1g/L、MnSO ₄ 0.05g/L, Tween 801mL/L, cysteine salt 0.5g/L, pH 6.8.

The detection methods referred to in the following examples are as follows:

the detection method of viable count comprises the following steps: the national standard GB4789.35-2016 food safety national standard food microbiology detection of lactobacillus is adopted.

The preparation of the lactobacillus suspensions referred to in the following examples is as follows:

streaking lactobacillus on MRS solid culture medium, and culturing at 37 deg.C for 48 hr to obtain single colony; selecting a single colony, inoculating the single colony in an MRS liquid culture medium, culturing for 18h at 37 ℃ for activation, and continuously activating for two generations to obtain an activation solution; inoculating the activated solution into an MRS liquid culture medium according to the inoculation amount of 2% (v/v), and culturing for 18h at 37 ℃ to obtain a bacterial solution; centrifuging the bacterial solution at 4 deg.C and 6000 Xg for 10min to obtain Lactobacillus thallus; washing Lactobacillus thallus with normal saline for 3 times, and suspending in 300g/L sucrose solution to obtain lactobacillus with concentration of 1 × 10 ⁹ CFU/mL to obtain bacterial suspension, and storing the bacterial suspension at 80 ℃ for later use.

Example 1: screening and identification of lactobacillus paracasei CCFM1176

1. Screening

Taking a dairy product from Renbell, inner Mongolia province as a sample, pretreating the sample, storing the pretreated sample in 30% glycerol in a refrigerator at the temperature of-80 ℃, taking out the sample for thawing, uniformly mixing the sample, sucking 0.5mL of the sample, adding the sample into 4.5mL of 0.9% physiological saline for gradient dilution, selecting a proper gradient dilution liquid, coating the gradient dilution liquid on an MRS solid culture medium, culturing for 48 hours at the temperature of 37 ℃, selecting a typical bacterial colony to an MRS plate, streaking and purifying, selecting a single bacterial colony, transferring the single bacterial colony to a liquid MRS liquid culture medium for enrichment, and storing the single bacterial colony in 30% glycerol to obtain a strain CCFM 1176.

2. Identification

Extracting the whole genome DNA of the strain CCFM1176 for 16SrDNA amplification, collecting the amplified DNA fragment for sequencing (by Jinzhi Biotechnology, Suzhou)Limited company), and the results show that the strain is lactobacillus paracasei named as lactobacillus paracasei (after sequencing analysis)Lactobacillusparacasei)CCFM1176。

Example 2: culture of Lactobacillus paracasei CCFM1176

The lactobacillus paracasei CCFM1176 is inoculated into an MRS solid culture medium and cultured for 48 hours at 37 ℃, and then the bacterial colony is observed and the thallus is observed under a microscope, so that the bacterial colony is in a milky semicircular bulge, the surface is smooth and moist, and the edge is neat.

The lactobacillus paracasei CCFM1176 is inoculated into an MRS liquid culture medium and cultured for 48h at 37 ℃, and the pH of the culture solution is measured by a pH meter at intervals in the culture process, so that the lactobacillus paracasei CCFM1176 produces acid in the culture process.

Inoculating lactobacillus paracasei CCFM1176 into MRS liquid culture medium, respectively culturing at 10-50 deg.C for 48h, and measuring OD of culture solution by enzyme labeling instrument at intervals during culture ₆₀₀ The lactobacillus casei CCFM1176 is found to grow optimally at the temperature of 30-37 ℃, and the growth stationary phase is reached after the lactobacillus casei CCFM1176 is cultured for 18-24 hours.

Example 3: effect of Lactobacillus paracasei CCFM1176 on capsaicin induced gastrointestinal injury mouse liver oxidative stress

30 SPF-grade 6-week-old male C57BL/6 mice were housed in a constant temperature and humidity animal house, strictly following the 12 h day and 12 h night cycle standard, fed on a standard commercial formula, and fed freely. After 7 days of adaptive feeding, the animals were randomly divided into 3 groups of 10 animals, 3 groups were: control group, capsaicin group, and strain intervention group (Lactobacillus paracasei CCFM1176 group, Lactobacillus paracasei LC01 group, and Lactobacillus paracasei LC02 group). Wherein, the lactobacillus paracasei LC01 and LC02 are two other strains of lactobacillus paracasei screened in the same batch with the lactobacillus paracasei CCFM 1176.

The expected intragastric administration dryness is 14 days on 8-21 days, the intragastric administration dosage is 0.2 mL/patient, and the intragastric administration time is kept consistent every day. Wherein the control group and capsaicin group are infused with normal saline, and the strain intervention group is infused with different lactobacillus paracasei (10) ⁹ CFU/only).

Capsaicin molding is carried out on days 15-21, i.e., the last 7 days of the intervention period. After the gavage of the normal saline/bacterial suspension for two hours, a 60mg/kg · bw capsaicin solution (dissolved in 3% ethanol, 10% tween 80 and 87% normal saline, v/v) was gavage, and a control group was gavage of a solution prepared from 3% ethanol, 10% tween 80 and 87% normal saline by volume.

After fasting for 12 hours, the mice after the completion of gavage were anesthetized and quickly bled from the eyeballs and sacrificed by cervical dislocation. Dissecting the sacrificed mouse, cutting a small opening on the left side of the abdominal midline by scissors, advancing to the sternal process, and making transverse incisions along the back edge of the rib to two sides to expose the abdominal cavity. Observing the normal position of organs in the abdominal cavity, picking the liver, slightly rinsing with normal saline, and quickly freezing with liquid nitrogen.

Adding precooled physiological saline 9 times the weight of the tissue block into the mouse liver quick-frozen by liquid nitrogen, fully grinding to homogenize the tissue, centrifuging at 6000rpm at 4 ℃ for 15 minutes, collecting supernatant to obtain tissue homogenate, and measuring the enzyme activity level of glutathione peroxidase (GSH-px), Catalase (CAT) and the content of Glutathione (GSH) and Malondialdehyde (MDA) in the liver homogenate of each group of mice by adopting Nanjing construction kit.

The organism has a defense mechanism of oxidative stress injury, and when the organism is stimulated, the expression of downstream antioxidant enzymes such as GSH-PX, CAT and the like can be regulated, so that inflammation and apoptosis reaction are inhibited, and the function of protecting cells is exerted. GSH is the most important non-enzymatic antioxidant in the body, and the decrease in this substance results in impairment of mitochondrial function, further leading to excessive increase in Reactive Oxygen Species (ROS), and thus oxidative damage. While MDA is considered as an important product and indicator of body lipid peroxidation, the change of MDA content reflects the degree of body oxidative damage.

The results of measuring the content of GSH-PX, CAT, GSH and MDA in liver homogenates of each group of mice are shown in figures 1-4.

Compared with a control group, the capsaicin gavage causes that the activity of GSH-PX enzyme in the liver of a mouse is reduced by 32.5%, the activity of CAT enzyme is reduced by 24.9%, the content of GSH is reduced by 64.0%, and the content of an injury marker MDA is increased by 32.3%. After the lactobacillus paracasei CCFM1176 is perfused, the oxidation damage degree in the liver homogenate of the mouse is reduced, which shows that the activity of GSH-PX and CAT enzymes is recovered to the level of a control group, compared with a capsaicin group, the GSH content is increased by 17.8 percent, and the damage marker MDA content is reduced by 51.3 percent. After the lactobacillus paracasei LC01 is perfused, the GSH-PX, CAT, GSH and levels in the mouse liver are respectively reduced by 27.6 percent, 29.2 percent and 49.8 percent compared with the control group, the MDA level is increased by 24.8 percent, and the result is similar to the result of the capsaicin group; after the lactobacillus paracasei LC02 is perfused into the stomach, the GSH-PX, CAT, GSH and the levels in the mouse liver are respectively reduced by 26.1 percent, 20.3 percent and 70.34 percent compared with a control group, the MDA level is increased by 55.3 percent, and the result is similar to the result of a capsaicin group. The result shows that the gavage CCFM1176 can effectively recover the mouse liver oxidative damage caused by capsaicin, and the recovery degree is obviously higher than that of the gavage lactobacillus paracasei LC01 and LC 02.

Example 4: effect of Lactobacillus paracasei CCFM1176 on capsaicin induced gastrointestinal injury mouse serum neuropeptide

The animal model was established as in example 3, after fasting for 12 hours, the gavage-terminated mice were anesthetized and the eyeballs were quickly removed to collect blood, followed by cervical dislocation for sacrifice. Collecting blood samples of post-mortem mice, standing the blood samples at 4 ℃ for 1h, centrifuging the blood samples at 3000rpm for 15min, carefully collecting upper serum, and determining the contents of Substance P (SP) and Calcitonin Gene Related Peptide (CGRP) in the blood samples of the mice according to the specifications of the Shanghai enzyme linked reagent kit, wherein capsaicin receptor TRPV1 in gastrointestinal tracts can mediate crosstalk between a nervous system and an immune system by regulating the release of the neuropeptides, wherein the two neuropeptides of the Substance P (SP) and the Calcitonin Gene Related Peptide (CGRP) are involved in nociceptive transmission and play an important role in pain and inflammatory responses.

As shown in fig. 5-6, the serum SP levels of mice in the capsaicin group, CCFM1176 group, LC01 group, and LC02 group were increased by 45.8%, 14.3%, 35.9%, and 22.9%, respectively, and the CGRP levels were increased by 37.4%, 5.1%, 38.5%, and 23.8%, respectively, as compared to the control group. The gastric lavage capsaicin is shown to promote the release of neuropeptide substances, thereby increasing pain transmission. The lactobacillus paracasei CCFM1176 for intragastric administration can obviously relieve the phenomenon, thereby relieving gastrointestinal pain transmission and reducing gastrointestinal damage caused by capsaicin, and the relieving degree is obviously superior to that of lactobacillus paracasei LC01 and LC 02.

Example 5: effect of Lactobacillus paracasei CCFM1176 on morphology of gastrointestinal tissue of mice with capsaicin-induced gastrointestinal injury

The animal model was established as in example 3, after fasting for 12 hours, the gavage-terminated mice were anesthetized and the eyeballs were quickly removed to collect blood, followed by cervical dislocation for sacrifice. Dissecting the sacrificed mouse, cutting a small opening on the left side of the abdominal midline by scissors, advancing to the sternal process, and making transverse incisions along the back edge of the rib to two sides to expose the abdominal cavity. Observing the normal position of organs in the abdominal cavity, cutting the whole stomach from the lower end of the cardia to the pylorus, picking the ileum, jejunum and colon, slightly rinsing with normal saline, and fixing in 4% paraformaldehyde fixing solution. After being fixed for 48h, the tissue forms of gastric mucosa, intestinal villi and the like are observed by adopting hematoxylin-eosin (HE) staining.

The morphology of the gastric tissue cells was observed by HE staining, and the results are shown in FIG. 7, in which the gastric mucosa tissue of the control mice was intact and the nuclei were clearly visible. The gastric mucosal tissues of the mice in the capsaicin group, the LC01 group and the LC02 group are slightly damaged, cells are vacuolated, but no obvious phenomenon of cell nucleus contraction is found. The gastric mucosal tissue of mice in the CCFM1176 group is intact, and the cell integrity is restored to the level of the control group.

The cell morphology of jejunum tissue was observed by HE staining, and the results are shown in fig. 8, in which jejunum villi structure of control group was intact and aligned. The capsaicin group villi are irregularly arranged, along with local villi breakage and shedding, and the phenomenon of crypt hyperplasia appears, but a large amount of inflammatory cell infiltration does not exist. The ileum villi of the mice of LC01 and LC02 were damaged and shed, while the structure and morphology of the jejunum villi of the CCFM1176 group were recovered to some extent, and the morphology was similar to that of the control group, and the same results were observed in the ileum tissue morphology (FIG. 9).

The morphology of colon tissue cells was observed by HE staining and the results are shown in fig. 10. The colon structure of the control group mouse is complete, the mucosa and the villi are regularly arranged, the control group mouse has a healthy crypt structure, is rich in goblet cells, and has no inflammatory cell infiltration or mucosal injury, while the capsaicin group mouse has the phenomena of goblet cell reduction and a small amount of inflammatory cell infiltration. The mice in the group LC01 are partially infiltrated by inflammatory cells, while the colon tissues of the mice in the group CCFM1176 and the group LC02 are remarkably relieved from inflammatory lesions and are restored to the similar level as the control group, wherein the colon tissues of the mice in the group CCFM1176 have more goblet cell content than the colon tissues of the group LC 02.

By combining the tissue morphology results of the stomach, the jejunum, the ileum and the colon of mice in different treatment groups, the inventor finds that the ingestion of 60mg/kg/day of capsaicin can cause the vacuolation of gastric mucosa cells of the mice, the falling and damage of villi of the jejunum and the ileum, the infiltration of inflammatory cells and the reduction of goblet cells in the colon, and the gastrointestinal injury of the mice is caused to a certain extent. And the paracasei milk rod CCFM1176 for intragastric administration can obviously improve the morphological damage of gastrointestinal tissues caused by capsaicin, and the remission degree is obviously higher than that of lactobacillus paracasei LC01 and lactobacillus paracasei LC 02.

Example 6: effect of Lactobacillus paracasei CCFM1176 on capsaicin-induced gastrointestinal injury mouse gastrointestinal inflammation

The animal model was established as in example 3, after fasting for 12 hours, the gavage-terminated mice were anesthetized and the eyeballs were quickly removed to collect blood, followed by cervical dislocation for sacrifice. Blood samples from post-mortem mice were collected, allowed to stand at 4 ℃ for 1h, centrifuged at 3000rpm for 15min, and the supernatant serum was carefully collected. Dissect the sacrificed mouse, cut a small opening on the left side of the abdominal midline slightly with scissors, go forward to the sternal process, and make transverse incisions along the posterior edge of the rib to both sides to expose the abdominal cavity. Observing the normal position of organs in the abdominal cavity, picking the stomach and the colon, slightly rinsing with normal saline, and quickly freezing part of tissues by liquid nitrogen.

RNA in the tissue of the liquid nitrogen quick-frozen mouse is extracted according to a Trizol method, and the concentration and the purity of the RNA are measured by a Nanodrop type nucleic acid quantifier. RNA is inverted into cDNA according to the Kangji century reverse transcription kit specification, and real-time quantitative PCR is carried out by a CFX96TM real-time system to detect the mRNA expression level of the inflammation-related protein gene. Mouse-derived primers are shown in Table 1, using beta-actin as an internal reference, 2 ^-△△Ct And calculating the relative expression quantity of the gene.

TABLE 1RT-PCR primer sequences

Name of Gene	Forward primer (5 '→ 3')	Reverse primer (5 '→ 3')
			β-actin	CCTAAGAGGAGGATGGTCGC	CTCAACACCTCAACCCCCTC
INOS	ACATCGACCCGTCCACAGTAT	ACATCGACCCGTCCACAGTAT
			COX-2	TTCCAATCCATGTCAAAACCGT	TTCCAATCCATGTCAAAACCGT

Inflammation is a defense-oriented reaction generated when organism tissues respond to various endogenous and exogenous injuries, and researches show that the transcription levels of inflammation marker proteins COX-2 and iNOS are in positive correlation with the organism inflammation reaction.

As shown in FIG. 11, the relative expression levels of mRNA of COX-2 and iNOS in the gastric tissues of the mice in the capsaicin group were significantly increased (2.24. + -. 0.54 and 2.53. + -. 0.39) compared with those in the control group (1.05. + -. 0.40 and 1.00. + -. 0.11), indicating that capsaicin induced an inflammatory response in the gastric tissues of the mice after intragastric administration. After the gastric perfusion of CCFM1176, the relative expression levels of COX-2 and iNOS in the stomach tissues of the mice are restored to the levels of the control group (1.35 +/-0.23 and 0.88 +/-0.18). Compared with a control group, the iNOS transcription level of the stomach tissue of the mouse is increased after the gastric lavage of the LC01, and the COX-2 transcription level has no significant difference (1.87 +/-0.31 and 1.91 +/-0.53); after lavage of LC02, the mouse stomach tissue was increased in COX-2 and iNOS transcription levels (2.15. + -. 0.61, 1.36. + -. 0.39), but there was no significant difference from the control group due to the large individual difference. The lactobacillus paracasei CCFM1176 for intragastric administration can relieve the increase of the expression of the mouse gastric tissue inflammatory protein caused by capsaicin intragastric administration, and the effect is superior to that of lactobacillus paracasei LC01 and LC 02.

As shown in FIG. 12, the transcriptional levels of mRNA for COX-2 and iNOS in colon tissues of the mice in the capsaicin group were increased (1.83. + -. 0.2 and 0.94. + -. 0.66) compared with those in the control group, and it is presumed that capsaicin caused some inflammatory lesions in the colon of the mice. After the gastric perfusion CCFM1176, the transcription levels of COX-2 and iNOS in colon tissues of mice are remarkably reduced (0.58 +/-0.18 and 0.50 +/-0.13), and the lactobacillus paracasei CCFM1176 is supposed to be capable of inhibiting the inflammatory reaction of the colon tissues. After the lactobacillus paracasei LC01 and the lactobacillus paracasei LC02 are perfused, the transcription level of the mouse colon tissue inflammation marker protein has no significant change compared with the control group (LC 01: 1.02 +/-0.32, 0.92 +/-0.35, LC 02: 0.98 +/-0.27, 0.82 +/-0.34).

Example 7: preparation of instant lactobacillus powder from lactobacillus paracasei CCFM1176

Preparation of a culture medium: 10g/L of peptone, 10g/L of beef extract, 20g/L of glucose, 2g/L of sodium acetate, 5g/L of yeast powder and 2g/L, K of diammonium hydrogen citrate ₂ PO ₄ ·3H ₂ O2.6g/L、MgSO ₄ ·7H ₂ O0.1g/L、MnSO ₄ 0.05g/L, Tween 801mL/L, cysteine salt 0.5g/L, pH 6.8.

Preparation of the protective agent: preparing a protective agent solution containing 100g/L of skimmed milk powder, 30mL/L of glycerol, 100g/L of maltodextrin, 150g/L of trehalose and 10 g/LL-sodium glutamate.

The preparation process of the fungus powder comprises the following steps:

lactobacillus paracasei CCFM1176 is streaked on MRS solid culture medium and cultured for 48h at 37 ℃ to obtain single colony. Selecting a single colony, inoculating the single colony in an MRS liquid culture medium, culturing for 18h at 37 ℃ for activation, and continuously activating for two generations to obtain an activated bacterial liquid; inoculating the activated solution into an MRS liquid culture medium according to the inoculation amount of 2% (v/v), and culturing for 18h at 37 ℃ to obtain a bacterial solution. Centrifuging the bacterial liquid at 4000r/min for 10min to obtain bacterial mud, washing the bacterial mud twice by using phosphate buffer solution with the pH =7.2, and then resuspending the bacterial mud to the concentration of 1 × 1010CFU/mL by using a protective agent to obtain bacterial suspension; pre-culturing the bacterial suspension at 37 ℃ for 60min, and freeze-drying to obtain the powder of lactobacillus paracasei CCFM 1176.

Optionally, in the preparation process of the bacterial powder, the bacterial powder can be mixed with other species and genera of lactic acid bacteria to prepare mixed bacterial liquid, and then freeze drying is carried out.

Optionally, mixing lactobacillus paracasei CCFM1176 powder with fructo-oligosaccharide, galacto-oligosaccharide, hawthorn powder, medlar powder and mulberry powder according to the mass ratio of 5:1:1:1:1:1 to obtain the instant lactobacillus powder.

Example 8: preparation of fermented milk from Lactobacillus paracasei CCFM1176

The specific preparation process of the fermented milk comprises the following steps:

the lactobacillus paracasei CCFM1176 is streaked on an MRS solid culture medium and cultured for 48 hours at the temperature of 37 ℃ to obtain a single colony; and selecting a single colony, inoculating the single colony in an MRS liquid culture medium, culturing for 18h at 37 ℃ for activation, and continuously activating for two generations to obtain an activation solution. The activating solution for fermented milk was centrifuged at an inoculation amount of 2% (v/v) to obtain cells. After washing 3 times with phosphate buffer solution of pH 7.2, it was resuspended in sterilized whole milk. The formula of the full-fat cow milk comprises: 11% whole milk powder +2% sucrose (w/w). And (3) placing the inoculated whole milk at the constant temperature of 37 ℃ for 24 hours, and then refrigerating at 4 ℃ for 24 hours to obtain the fermented milk.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. Lactobacillus paracasei: (Lactobacillus paracasei) CCFM1176, which has been deposited in the Guangdong province culture Collection on 3/19.2021 with the deposit numberIs GDMCC No: 61573.

2. a composition comprising lactobacillus paracasei CCFM1176 of claim 1.

3. The composition of claim 2, wherein the content of lactobacillus paracasei in the composition is not less than 1 x 10 ⁵ CFU/g or 1X 10 ⁵ CFU/mL。

4. The composition according to claim 2 or 3, wherein the composition is a fermented food.

5. The composition according to claim 2 or 3, wherein the composition is a fermented drink.

6. The composition of claim 2 or 3, wherein the composition is a fermented dairy product, a fermented soy product, or a fermented fruit and vegetable product.

7. The composition of claim 6, wherein the dairy product is milk.

8. The composition of claim 6, wherein the fermented dairy product is sour cream or cheese.

9. The composition of claim 6 wherein said soy product is soy milk.

10. The composition of claim 6, wherein said fermented soy product is fermented soybeans or soy paste.

11. The composition as claimed in claim 6, wherein the raw material of the fruit and vegetable product is selected from one or more of cucumber, carrot, beet, celery and cabbage.

12. A starter culture comprising the Lactobacillus paracasei CCFM1176 of claim 1, wherein the starter culture is a suspension comprising the Lactobacillus paracasei CCFM 1176.

13. A fermentation agent comprising the Lactobacillus paracasei CCFM1176 of claim 1, wherein the fermentation agent is a powder prepared from a bacterial liquid containing the Lactobacillus paracasei CCFM1176, and comprises 10 ⁶ CFU/g above active Lactobacillus paracasei CCFM 1176.

14. The starter culture according to claim 12 or 13, further comprising a microorganism usable for food; the microorganism which can be used in food is Streptococcus thermophilus and/or Lactobacillus bulgaricus.

15. Use of lactobacillus paracasei CCFM1176 according to claim 1 for the preparation of a fermented food product.

16. Use of lactobacillus paracasei CCFM1176 according to claim 1 for the preparation of a fermented beverage.

17. Use of lactobacillus paracasei CCFM1176 according to claim 1 for the preparation of a pharmaceutical composition for preventing and/or ameliorating gastrointestinal damage caused by capsaicin.