CN113121663A

CN113121663A - Application of corn CRR1 protein and coding gene thereof in regulating and controlling low-temperature stress tolerance of corn

Info

Publication number: CN113121663A
Application number: CN201911421824.5A
Authority: CN
Inventors: 杨淑华; 曾榕; 张晓燕
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2019-12-31
Filing date: 2019-12-31
Publication date: 2021-07-16
Anticipated expiration: 2039-12-31
Also published as: CN113121663B

Abstract

The invention relates to the technical field of plant genetic engineering, and particularly discloses application of a corn CRR1 protein and a coding gene thereof in regulation and control of low-temperature stress tolerance of corn. The invention discovers that the low temperature resistance of plants can be enhanced by over-expressing CRR1 gene in corn. The CRR1 gene is cloned, a transgenic plant for over-expressing the CRR1 gene is constructed, and cold resistance analysis is carried out on the obtained transgenic corn to find that the over-expressed CRR1 can improve cold response gene expression and enable the corn to obtain stronger low-temperature tolerance capability. The invention provides a new gene resource for cultivating new varieties of low-temperature-resistant plants, and lays a certain theoretical basis for researching the mechanism of the response of the corn to low-temperature stress.

Description

Application of corn CRR1 protein and coding gene thereof in regulating and controlling low-temperature stress tolerance of corn

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of a corn CRR1 protein and a coding gene thereof in regulating and controlling low-temperature stress tolerance of corn.

Background

Corn (Zea mays L.) is a crop from the (subtropical) tropics. Later in the last century, its planting has shifted to higher geographical latitudes, but expansion of corn plants in temperate climatic regions still requires breeding for cold-tolerant corn genotypes. The sensitivity of maize to low temperatures is mainly due to reduced photosynthesis and metabolite transport. Short term exposure of maize seedlings to low temperatures results in reduced photosynthesis activity, followed by participation of dissipative mechanisms and antioxidant systems, affecting the transport of assimilates. The transgenic technology can introduce the plant resistance gene into corn genetic material to be improved, and make the corn genetic material express stable genetic resistance capability, thereby providing excellent variety resources for agricultural production.

Therefore, there is a need to provide a corn CRR1 protein and its coding gene for use in regulating the tolerance of corn to low temperature stress to solve the problems of the prior art.

Disclosure of Invention

The invention aims to provide a corn low temperature resistant gene CRR1 and application of a protein coded by the gene. Maize CRR1 has the highest homology with ARR8 in arabidopsis, but ARR8 in arabidopsis is not found to have a low temperature phenotype. According to the invention, through research on a corn cold-related gene CRR1, a transgenic plant over expressing the gene is found to have an obvious low temperature resistance phenotype compared with a wild plant. In the over-expression plants, the expression level of the ZmDREB1 gene is obviously up-regulated. The invention has the beneficial effect that the provided CRR1 gene provides gene resources for cultivating new varieties of low-temperature resistant plants.

The invention aims to provide application of CRR1 protein and a coding gene thereof in cold resistance of corn. In order to discover cold-resistance related genes of corn, the invention screens corn pools of transgenic over-expression strains, observes the phenotypes of the corn pools, finds that the phenotypes of different over-expression gene strains are different, and further finds that a plurality of strains over-expressing CRR1 genes show obvious cold-resistance phenotypes.

Specifically, the over-expressed corn population is screened, the relative wound area of leaves is used as an index, the low-temperature phenotype is preliminarily screened, the over-expressed strain with the initially screened phenotype is re-screened to determine the low-temperature related phenotype, the gene number of the over-expressed gene of the strain is found to be GRMZM2G040736 by referring to an over-expression information table, the gene is further determined to be a corn response regulator CRR1 according to the gene annotation on a gramene website, and the CRR1 is found to belong to an A-type response regulator through unified comparison, but the function of the gene is not reported at all. The CRR1 gene is determined to be a key gene of cold resistance of corn by the research of the invention. In order to achieve the aim, the invention provides a corn low temperature resistant gene CRR1, wherein a low temperature resistant transgenic plant is obtained by over-expressing a CRR1 gene in corn.

The cDNA sequence of the corn CRR1 protein related in the invention is as follows: i) a nucleotide sequence shown as SEQ ID No. 1; or ii) a nucleotide sequence which is shown in SEQ ID No.1 and expresses the same functional protein by replacing, deleting and/or adding one or more nucleotides; or iii) a nucleotide sequence which hybridizes under stringent conditions to the sequence shown in SEQ ID No. 1.

The maize CRR1 cDNA consists of 783 bases, and the sequence is shown as SEQ ID No. 1. The reading frame of the gene is cDNA from the 74 th to 783 rd bases of the 5' end. The reading frame of the gene consists of only 1 exon. The amino acid sequence coded by the maize CRR1 gene is shown in SEQ ID No. 2.

The corn CRR1 protein has any one of the following amino acid sequences:

1) an amino acid sequence shown as SEQ ID NO. 2; or

2) The amino acid sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2.

It is understood that one skilled in the art can substitute, delete and/or add one or several amino acids based on the disclosed amino acid sequences without affecting their activity to obtain mutant sequences of the proteins.

The invention provides application of a corn CRR1 protein or a coding gene thereof, or a biological material containing the coding gene thereof in improving the cold resistance of plants.

The invention provides application of corn CRR1 protein or coding gene thereof, or biological material containing the coding gene thereof in breeding transgenic plants with improved cold resistance.

The invention provides application of a corn CRR1 protein or a coding gene thereof, or a biological material containing the coding gene thereof in improvement of cold-resistant germplasm resources of plants.

The invention provides application of a corn CRR1 protein or a coding gene thereof, or a biological material containing the coding gene thereof in improving plant survival rate in a low-temperature environment.

The invention provides application of corn CRR1 protein or coding gene thereof, or biological material containing the coding gene thereof in positive regulation of cold response gene ZmDREB1 s.

The biological material is an expression cassette, a vector, a host cell or a recombinant bacterium.

The invention also provides a cloning vector or various expression vectors containing the plant low temperature resistant CRR1 gene sequence or the segment thereof, a host cell containing the vector, a transformed plant cell and a transgenic plant containing the gene sequence or the specific segment thereof. Wherein, the overexpression vector containing the CRR1 gene is a pBCXUN vector containing a Ubi promoter.

The invention also provides a preparation method of the transgenic plant, which improves the expression quantity of the CRR1 gene by a transgenic method to obtain the plant with improved cold resistance.

The preparation method of the transgenic plant comprises the following steps:

(1) amplifying a full-length gene cDNA sequence (shown as SEQ ID NO. 1) of the CRR1 gene;

(2) constructing an overexpression vector of the CRR1 gene;

(3) constructing recombinant agrobacterium tumefaciens of an overexpression vector containing a CRR1 gene;

(4) constructing transgenic plants with CRR1 gene over-expression by adopting an agrobacterium infection method.

The CRR1 protein and the application of the coding gene thereof in plants, wherein the plants are monocotyledons or dicotyledons, preferably rice, wheat, soybean, sorghum, millet, cotton, barley or corn.

The invention also provides a method for constructing cold-resistant transgenic corn, which enables the corn to express or over-express the corn CRR1 gene by a transgenic, crossing, backcrossing, selfing or asexual propagation method.

The transgene comprises the step of introducing a recombinant expression vector containing a CRR1 gene into corn by using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, a gene gun, conductance and an agrobacterium-mediated method to obtain a transgenic corn strain.

In the embodiment of the invention, the specific method for constructing the low-temperature-resistant transgenic plant is as follows:

1) extracting total RNA of corn, carrying out reverse transcription to obtain cDNA, amplifying CRR1 gene by taking the cDNA as a template and F and R as primers, constructing an amplification product on an expression vector pBCXUN, and naming the obtained recombinant expression vector as pBCXUN-CRR 1;

2) the agrobacterium EHA105 is transformed by pBCXUN-CRR1, and then the maize callus is infected by the transformed agrobacterium to obtain the low temperature resistant transgenic maize seedling. Wherein, the nucleotide sequences of the primers F and R in the step 1) are shown as SEQ ID No.3 and 4. The maize is preferably a maize plant of the LH244 homozygous genotype. After the CRR1 gene of the invention is over-expressed, the corn shows a low temperature resistant phenotype.

The expression vector is a pBCXUN vector which is modified from a plasmid pCAMBIA1300 and is obtained by connecting a hygromycin resistance gene into the pCAMBIA 1300.

The CRR1 gene is cloned, a transgenic plant for over-expressing the CRR1 gene is constructed, and cold resistance analysis is carried out on the obtained transgenic corn to find that the over-expressed CRR1 can improve cold response gene expression and enable the corn to obtain stronger low-temperature tolerance capability. The invention provides a new gene resource for cultivating new varieties of low-temperature-resistant plants, and lays a certain theoretical basis for researching the mechanism of the response of the corn to low-temperature stress.

Drawings

FIG. 1 is a graph showing the results of the overexpression test of CRR1 gene in CK group and maize overexpression lines in example 2 of the present invention;

FIG. 2 is a photograph showing the growth of plants after recovery of low-temperature treatment of CK group and maize overexpression lines in example 3 of the present invention;

FIG. 3 is a statistical chart of ion leakage rates of CK group and maize overexpression lines in example 3 of the present invention;

FIG. 4 is a schematic diagram showing 2 types of CRR1 gene knockouts in example 4 of the present invention;

FIG. 5 is a photograph showing the growth of plants recovered from the low-temperature treatment of the CK group and the maize CRR1 gene knockout strain in example 4 of the present invention;

FIG. 6 is a statistical chart of ion leakage rates of CK group and maize CRR1 gene knockout strains in example 4 of the present invention;

FIG. 7 is a graph showing the results of ZmDREB1.1 gene expression level measurement after low-temperature treatment of CK group and maize overexpression lines in example 5 of the present invention;

FIG. 8 is a graph showing the results of ZmDREB1.2 gene expression level measurement after the low-temperature treatment of CK group and maize overexpression lines in example 5 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory manual,21), or the conditions as recommended by the manufacturer's instructions.

The main reagents in the following examples are: various restriction enzymes, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, KOD from NEB, Toyobo, etc.; dNTPs were purchased from Genestar; the plasmid miniextraction kit and the agarose gel recovery kit are purchased from Shanghai Czeri bioengineering company; antibiotics such as agar powder, agarose, ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), and rifampicin (Rif), and Glucose, BSA, and LB Medium were purchased from Sigma, Bio-Rad, and the like; reagents for real-time quantitative PCR were purchased from TaKaRa, and various other chemical reagents used in the examples were imported or home-made analytical reagents. The primers used in the examples were synthesized from Hexa Huada and subjected to related sequencing.

Example 1 construction and detection of CRR1 Gene overexpression vector

Extracting total RNA from B73 corn (Zea mays L.), reverse transcription to obtain cDNA, amplifying CRR1 gene by using cDNA as a template and F and R as primers, wherein the primers are provided with enzyme cutting sites and are connected to an over-expression vector after enzyme cutting. The construction method of the CRR1 gene overexpression vector comprises the following steps:

(1) b73 corn total RNA was extracted using the RNA extraction kit from magenta, with the specific steps referred to the kit instructions.

(2) The RNA was reverse transcribed to give cDNA using a reverse transcription kit from thermo, and the detailed procedures were as described in the kit's instructions.

(3) Using cDNA as a template, F and R as primers, amplifying cDNA (shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2) of CRR1 gene, running electrophoresis on the amplified product, cutting gel and recovering, wherein the recovering method refers to the kit instruction of Tiangen corporation.

The primers used for amplifying the cDNA of the CRR1 gene are as follows:

an upstream primer F: 5'-ATG GCC GCT GCA GCC GCC GC-3' (SEQ ID No.3)

A downstream primer R: 5'-CCG GAT CCG GCT GCA GAG GC-3' (SEQ ID No.4)

(4) The recovered cDNA of CRR1 gene and pBCXUN vector (pBCXUN vector is obtained by using commercial vector pCAMBIA1300 as skeleton and connecting hygromycin resistance gene into pCAMBIA1300 (Guo et al, 2018Stepwise cis-regulatory changes in ZCN8 control to mail flowing-time adaptation. Current Bio.28, 3005-3015), and at the same time, the promoter of corn ubiquitin gene Ubi is cloned onto the vector by means of enzyme digestion connection, and the transcription of downstream overexpression gene is driven), and the enzyme digestion product is recovered by electrophoresis cutting gel. The recovered product was ligated with T4 ligase. The CRR1 gene was ligated into the pBCXUN vector to drive expression of the CRR1 gene with the Ubi promoter.

(5) 5 mu.L of the product of the enzyme digestion-ligation system is taken to transform the competence of the escherichia coli. Screening was performed on LB plates containing 50. mu.g/mL kanamycin. And (5) identifying the single clone by colony PCR, and selecting a positive clone for sequencing. The obtained recombinant expression vector with correct sequencing is named pBCXUN-CRR 1. Carrying out enzyme digestion on the plasmid obtained in the last step, and carrying out electrophoresis detection, wherein the specific method comprises the following steps: pBCXUN-CRR1 was digested with Xba I and Cla I, and scanned and imaged with a UVP Gel Documentation Gel analysis system after electrophoresis with 1% agarose Gel, 120V, 50 mA.

Example 2 construction and detection of CRR1 Gene overexpressing plants

The pBCXUN vector containing the CRR1 gene described in example 1 was transformed into Agrobacterium EHA105 strain (Ma et al, 2009, Enhanced tolerance to drilling stress in OsMYB3R-2transgenic stress in cell cycle and optional expression of stress genes. plant physical.150, 244-256), and maize callus was reinfused to obtain transgenic seedlings. The specific method comprises the following steps: inoculating Agrobacterium containing the target vector into 100mL LB three-antibody liquid culture medium (Kan 50. mu.g/mL, Rif 50. mu.g/mL, Gen 50. mu.g/mL), shaking and culturing at 28 deg.C overnight until OD6 value is 1.0-2.0, centrifuging at 50g at room temperature for 15min, and collecting thallus; the cells were suspended in 2mL of transformation medium (1/2MS, 5% sucrose, 40. mu.L Silwet L-77); soaking the corn callus in agrobacterium transformation liquid, and sealing. And putting the seeds back to the illumination culture shelf to grow normally until plants grow. And then, carrying out a low-temperature stress treatment experiment on the screened seeds.

In the embodiment, the gene expression of CRR1 in the over-expression strains OE-2, OE-3, OE-5 and OE-6 obtained by separation is detected by adopting real-time quantitative PCR. The specific method comprises the following steps:

1) extracting total plant RNA and reverse transcribing to obtain cDNA.

2) After the cDNA obtained by reverse transcription was diluted 5 times, real-time quantitative PCR was carried out using a Takara kit, and the reaction system used included: 2 × SYBR Premix ExTaq buffer, 0.2. mu.L DyII, 0.4. mu.L Primer (F1/R1), 2. mu.L cDNA template, and finally ddH₂Supplementing O to 20 μ L, mixing well, and performing two-step PCR amplification in ABI PRISM 75 real-time quantitative PCR instrumentThe conditions are as follows: 30s at 95 ℃; 5s at 95 ℃; 40s at 60 ℃; 40 cycles.

Wherein the sequences of the primers F1 and R1 (primers of qRT-PCR) are as follows:

F1：CAG CCG CCG CTC CAG CAT CT(SEQ ID No.5)

R1：GAC TCC ACG GCG GTC ACC TT(SEQ ID No.6)

after completion of PCR reaction according to 2^-Δ(ΔCt)The relative expression quantity between the wild type (CK group) and the over-expression strain (OE) is calculated and is mapped for analysis, and three biological repetitions are carried out, wherein the trends of the three repetitions are similar. While amplifying the identified genes, each sample was simultaneously amplified with the UBI gene as an internal control. The test results are shown in FIG. 1, and it can be seen from FIG. 1 that the expression amount of the overexpression strain is significantly higher than that of CK.

Example 3 detection of Low temperature resistance of plants overexpressing CRR1 Gene

Firstly, seeds of a CK group (wild type corn) and OE-2, OE-3, OE-5 and OE-6 obtained in example 2 are sown in black soil, small pots with the length of 10cm, the width of 10cm and the height of 10cm of imported soil and vermiculite (mass ratio is 1:1:1), 5 grains are placed in each pot, then 2cm of soil is covered on each pot, the pots are placed in a tray, water is poured until the soil is completely wet, and the pots are placed in a culture room at 23 ℃ and are irradiated by light for 16 hours and dark for 8 hours. After 14 days of growth, the leaves are processed at low temperature of 4 ℃ for 2 to 3 days until the second leaf shrinks and wilts, the leaves are taken out and put in a culture room at 23 ℃ for two days to be recovered, then the pictures are taken, and the materials are taken for counting the ion leakage rate.

The growth of the plants after recovery of the CK group and the maize overexpression line by low-temperature treatment is shown in FIG. 2. The results show that wild CK leaves are severely wilted and even do not stand up, and overexpression strains OE-2, OE-3, OE-5 and OE-6 only have slightly injured leaf tips and still keep straight and stand up, so that the wild CK leaves show the low temperature resistant phenotype.

The ion leakage rate in this example was counted by measuring the relative conductivity L ═ S1-S0)/(S2-S0 of the leaf. Putting the whole plant of the corn subjected to low-temperature treatment into a 15ml centrifugal tube filled with 10ml of distilled water, pumping air for 30min by using a vacuum pump, then placing the plant in a shaking table, shaking for 1h at room temperature, then measuring the initial conductance value by using a conductance meter to be S1, then placing the sample in boiling water for 15min, taking out the sample, placing the sample in the shaking table, shaking for 2h, and measuring the conductance value to be S2. S0 is the conductivity of the blank control distilled water.

The results show that as shown in FIG. 3, compared with wild plants, the ion leakage rates of over-expressed lines OE-2, OE-3, OE-5 and OE-6 are respectively reduced by 32%, 30%, 27% and 40%, so that significant differences are achieved, and P is less than 0.01, which indicates that the cold resistance of the corn can be enhanced by over-expressing the CRR1 gene. Three shoots were taken for each overexpression line (OE) and CK and assayed for three biological replicates.

Example 4 detection of Low temperature resistance ability of CRR1 knock-out Gene plants

In order to further explore the regulation effect of the CRR1 on the cold tolerance of corn, CRR1 gene is knocked out by using CRISPR/Cas9 technology. A total of 2 types of mutant lines were obtained in mutant form (see FIG. 4 for schematic knock-out). Wherein, the #999 strain is deleted for 24bp, and #618 and #651 are single-base insertion mutations.

The CK group and gene knockout strains #999, #618 and #651 are subjected to low-temperature treatment, and the specific experimental mode is as follows: seeds of CK group (wild corn) and gene knockout strains #999, #618 and #651 are sown in black soil, small pots with 10cm length, 10cm width and 10cm height of imported soil and vermiculite (mass ratio is 1:1:1), 5 grains are placed in each pot, 2cm soil is covered on each pot, the pots are placed in a tray, water is poured until the soil is completely wet, the pots are placed in a culture room at 23 ℃, 16 hours of illumination and 8 hours of darkness are carried out, after 14 days of growth, low-temperature treatment at 4 ℃ is carried out for 1-2 days until second shrinking and two leaves are wilted, the pots are taken out and placed in the culture room at 23 ℃ for two days of recovery, and photographing and statistics of ion leakage rate are carried out by taking materials. The injury condition is judged according to the injury proportion of the second leaf. Three seedlings are taken for determination of each knockout strain and CK, and three biological repetitions are carried out.

As shown in fig. 5 and 6, the leaves of the knockout lines (#651, #999, and #618) wilted and rolled up when compared with CK, indicating sensitivity to low temperature. The ion leakage rate reflects the integrity of the cell membrane. Compared with CK, the ion leakage rates of the knockout strains #999, #618 and #651 are respectively increased by 40%, 33% and 24%, the significant difference is achieved, P is less than 0.01, the damage degree of cells is obviously higher than CK, and the cold resistance of the corn can be weakened by knocking out CRR1 gene. Further illustrating the susceptibility of CRR1 knockdown to low temperatures.

Example 5

DREB1s can be rapidly induced by low temperature and is a key regulation mechanism of plants responding to low temperature stress. We examined the cold induction of the ZmDREB1 family members ZmDREB1.1 and ZmDREB1.2 in the Control (CK) and CRR1 overexpression lines.

Specifically, in this example, the CK group and the over-expression strains OE-2 and OE-3 obtained in example 2 were treated at 4 ℃ for 0, 6, 9, and 12 hours, respectively, and RNA was extracted from the samples and reverse transcribed to obtain cDNA. And then real-time quantitative PCR is adopted to detect the gene expression of ZmDREB1.1 and ZmDREB1.2. The specific method comprises the following steps:

1) extracting total plant RNA and reverse transcribing to obtain cDNA.

2) After the cDNA obtained by reverse transcription was diluted 5 times, real-time quantitative PCR was carried out using a Takara kit, and the reaction system used included: 2 × SYBR Premix ExTaq buffer, 0.2. mu.L DyII, 0.4. mu.L Primer (F1.1/R1.1 or F1.2/R1.2), 2. mu.L cDNA template, and finally ddH₂And (3) supplementing the total amount of O to 20 mu L, fully and uniformly mixing, putting into an ABI PRISM 75 real-time quantitative PCR instrument, and performing PCR amplification by using a two-step method under the reaction conditions of: 30s at 95 ℃; 5s at 95 ℃; 40s at 60 ℃; 40 cycles.

Wherein, the primers (qRT-PCR primers) F1.1 and R1.1 are used for detecting ZmDREB1.1, the primers F1.2 and R1.2 are used for detecting ZmDREB1.2, and the sequences of the primers are as follows:

F1.1：ATGGACACGGCCGGCCTC(SEQ ID No.7)

R1.1：CTAGTAGTAGCTCCAGAG(SEQ ID No.8)

F1.2：ATGGACATGGGCCGGCAC(SEQ ID No.9)

R1.2：CTAGTAGCTCCAGAGCGCGAC(SEQ ID No.10)

after completion of PCR reaction according to 2^-Δ(ΔCt)The relative expression quantity between the wild type (CK group) and the over-expression strains (OE-2 and OE-3) is calculated and is mapped for analysis, and three biological repetitions are carried out, wherein the trends are similar. While amplifying the identified genes, each sample was simultaneously amplified with the UBI gene as an internal control. The results of the ZmDREB1.1 gene expression level test are shown in FIG. 7, and the results of the ZmDREB1.2 gene expression level test are shown in FIG. 8. As can be seen from fig. 7 and 8, the low temperature-induced fold of the overexpression lines zmdreb1.1 and zmdreb1.2 was significantly higher than CK. When the gene is treated at low temperature for 6h, the ZmDREB1.1 gene is induced by 5 times in CK and more than 30 times in OE, which is obviously higher than CK and P<0.01. Similarly, ZmDREB1.2 induces 50 times in CK, 150 times in OE-2 and 120 times in OE-3 after being treated at low temperature for 6h, and the expression level is obviously higher than that of CK and P<0.01. It was shown that overexpression of the CRR1 gene enabled significant up-regulation of the ZmDERB1 gene.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> application of corn CRR1 protein and coding gene thereof in regulation and control of low temperature stress tolerance of corn

<130> KHP191116555.4

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 783

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctgcagcct gactgtctgt tttcagcacc cgcaccacct gactgtctgt tcgcagcacc 60

cggacctgtg tcaatggccg ctgcagccgc cgctccagca tctgtggcgc cgtcctcgcc 120

caaggccgcc ggcgacaaca ggaagacggt ggtgtccgtg gacgcgtcgg agctggagaa 180

gcacgtccta gcggtggacg acagctctgt ggaccgtgcc gtgatcgcca ggatcctgcg 240

tggctccagg tacaaggtga ccgccgtgga gtcagcgacg cgcgcgctgg agctgctcgc 300

gctaggcctg ctccccgacg tcagcatgat catcaccgac tactggatgc ccgggatgac 360

tgggtacgag ctgctcaaac gcgtcaagga gtcggcggcg ctcagaggca tccccgtcgt 420

catcatgtca tcggagaacg tgtccacccg tatcacccgc tgcctggagg agggcgccga 480

gggcttcctc ctcaagcccg tccgccccgc cgacgtctcc cgcctctgca gccggatccg 540

gtgactgcgt gtggtgctat gttaggagct aggatcctca accaaaaaaa aaaagattcc 600

tcttctttct ttctttctct cctgcttgga catagatctt caaacaagga gctaacattt 660

ggggggagac tttttagctt tagggatctc aacaagttgt tcggaacggg ggggatggag 720

cacagcgttg gctgttcttt tctccattcc tcttaataac atcaggtgtc aatgtcatgc 780

acg 783

<210> 2

<211> 156

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Ala Ala Ala Ala Ala Pro Ala Ser Val Ala Pro Ser Ser Pro

1 5 10 15

Lys Ala Ala Gly Asp Asn Arg Lys Thr Val Val Ser Val Asp Ala Ser

20 25 30

Glu Leu Glu Lys His Val Leu Ala Val Asp Asp Ser Ser Val Asp Arg

35 40 45

Ala Val Ile Ala Arg Ile Leu Arg Gly Ser Arg Tyr Lys Val Thr Ala

50 55 60

Val Glu Ser Ala Thr Arg Ala Leu Glu Leu Leu Ala Leu Gly Leu Leu

65 70 75 80

Pro Asp Val Ser Met Ile Ile Thr Asp Tyr Trp Met Pro Gly Met Thr

85 90 95

Gly Tyr Glu Leu Leu Lys Arg Val Lys Glu Ser Ala Ala Leu Arg Gly

100 105 110

Ile Pro Val Val Ile Met Ser Ser Glu Asn Val Ser Thr Arg Ile Thr

115 120 125

Arg Cys Leu Glu Glu Gly Ala Glu Gly Phe Leu Leu Lys Pro Val Arg

130 135 140

Pro Ala Asp Val Ser Arg Leu Cys Ser Arg Ile Arg

145 150 155

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggccgctg cagccgccgc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccggatccgg ctgcagaggc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagccgccgc tccagcatct 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gactccacgg cggtcacctt 20

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggacacgg ccggcctc 18

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctagtagtag ctccagag 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atggacatgg gccggcac 18

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctagtagctc cagagcgcga c 21

Claims

1. The application of the corn CRR1 protein or the coding gene thereof or the biological material containing the coding gene thereof in improving the cold resistance of plants.

2. Application of corn CRR1 protein or its coding gene, or biological material containing its coding gene in breeding transgenic plant with improved cold resistance.

3. The application of the corn CRR1 protein or the coding gene thereof, or the biological material containing the coding gene thereof in the improvement of cold-resistant germplasm resources of plants.

4. The application of the corn CRR1 protein or the coding gene thereof or the biological material containing the coding gene thereof in improving the survival rate of plants in low-temperature environment.

5. The application of corn CRR1 protein or its coding gene, or the biological material containing its coding gene in the positive regulation of cold response gene ZmDREB1 s.

6. The use of any one of claims 1 to 5, wherein the maize CRR1 protein has the amino acid sequence of any one of:

1) an amino acid sequence shown as SEQ ID NO. 2; or

7. The use of any one of claims 1 to 5, wherein the cDNA of the maize CRR1 protein has any one of the following nucleotide sequences:

(1) the nucleotide sequence shown as SEQ ID NO.1, or

(2) The coding nucleotide sequence of the protein with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1;

(3) a nucleotide sequence which can be hybridized with the nucleotide sequence shown in SEQ ID NO.1 under strict conditions.

8. The use according to any one of claims 1 to 5, wherein the biological material is an expression cassette, a vector, a host cell or a recombinant bacterium.

9. The use according to any one of claims 1 to 4, wherein the plant is a monocotyledonous or dicotyledonous plant; preferably rice, wheat, soybean, sorghum, millet, cotton, barley or corn.

10. The method for constructing cold-resistant transgenic corn is characterized in that the corn expresses or over-expresses the corn CRR1 gene by a transgenic, hybridization, backcross, selfing or asexual propagation method; preferably, the transgene comprises introducing a recombinant expression vector containing the maize CRR1 gene into maize by Ti plasmid, plant viral vector, direct DNA transformation, microinjection, gene gun, conductance, agrobacterium-mediated methods to obtain transgenic maize lines.