CN113106162A - Method for rapidly detecting Bacillus belgii and application thereof - Google Patents
Method for rapidly detecting Bacillus belgii and application thereof Download PDFInfo
- Publication number
- CN113106162A CN113106162A CN202110339235.3A CN202110339235A CN113106162A CN 113106162 A CN113106162 A CN 113106162A CN 202110339235 A CN202110339235 A CN 202110339235A CN 113106162 A CN113106162 A CN 113106162A
- Authority
- CN
- China
- Prior art keywords
- bacillus belgii
- detected
- pcr amplification
- bacillus
- soil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for rapidly detecting Bacillus belgii and application thereof. The method is characterized in that the genome DNA of a bacterium to be detected is used as a template, a specific primer pair is adopted for PCR amplification, and then the following judgment is carried out: if the PCR amplification product contains a DNA fragment with the size of 193bp, the bacteria to be detected is or is suspected to be Bacillus belgii; the specific primer pair consists of a primer F shown by SEQ ID NO. 2 and a primer R shown by SEQ ID NO. 3. Experiments prove that the specific primer pair can detect the Bacillus belgii, and has high sensitivity and good specificity; the method can also be used for evaluating the colonization ability of the Bacillus belgii in the soil to be detected, namely monitoring the colonization dynamic of the Bacillus belgii in the soil. The invention has important application value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for rapidly detecting Bacillus belgii and application thereof.
Background
The beneficial microorganisms are utilized to prevent and treat plant diseases, so that the method has the advantages of greenness, no pollution and the like, and is a hot spot of the current research. The biocontrol bacillus exists widely in soil, and becomes the most widely beneficial microorganism at present due to the characteristics of strong stress resistance, easy separation and the like. Biocontrol bacillus is widely reported in the aspect of disease control, but research on detection of bacillus is less. The traditional biocontrol bacteria detection mainly comprises a flat plate detection method and a selective culture medium, so that the time and the labor are consumed, the detection period is long, and beneficial microorganisms in the natural environment cannot be rapidly detected.
The bacillus has various types, including bacillus subtilis, bacillus amyloliquefaciens, bacillus belgii, bacillus cereus and the like. The Bacillus belgii is newly named in recent years, is separated from a group of Bacillus amyloliquefaciens, and has huge application prospect. Bacillus belgii is very similar to Bacillus amyloliquefaciens, but is difficult to distinguish by only using a single conserved gene sequence, and is mainly identified by a method for constructing a phylogenetic tree by combining multiple genes at present.
Disclosure of Invention
The invention aims to specifically detect Bacillus belgii.
Firstly, protecting a specific primer pair, including a primer F and a primer R;
the primer F can be a1) or a2) as follows:
a1) a single-stranded DNA molecule shown as SEQ ID NO. 2;
a2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides to SEQ ID NO. 2 and have the same functions as SEQ ID NO. 2;
the primer R can be a3) or a4) as follows:
a3) a single-stranded DNA molecule represented by SEQ ID NO. 3;
a4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to SEQ ID NO. 3 and has the same function as SEQ ID NO. 3.
The specific primer pair can specifically consist of the primer F and the primer R.
The invention also protects the application of any one of the specific primer pairs, which can be b1) or b2) or b3) or b4) or b5) or b 6):
b1) detecting Bacillus belgii;
b2) identifying whether the bacteria to be detected are Bacillus belgii;
b3) evaluating the colonization ability of the Bacillus belgii in the soil to be tested;
b4) preparing a kit for detecting Bacillus belgii;
b5) preparing a kit for identifying whether the bacteria to be detected are Bacillus belgii;
b6) preparing a kit for evaluating the colonization ability of the Bacillus belgii in the soil to be tested.
The invention also provides a kit comprising any one of the specific primer pairs.
The invention also protects the application of the kit, which can be b1) or b2) or b 3):
b1) detecting Bacillus belgii;
b2) identifying whether the bacteria to be detected are Bacillus belgii;
b3) and evaluating the colonization ability of the Bacillus belgii in the soil to be tested.
The invention also provides a preparation method of the kit, which comprises the step of separately packaging each primer in any one specific primer pair.
The invention also protects a method for identifying whether the bacteria to be detected is Bacillus belgii.
The method for identifying whether the bacteria to be detected are Bacillus belgii or not, which is protected by the invention, can be specifically a method Q1) or a method Q2).
The method Q1) is as follows: taking the genome DNA of a bacterium to be detected as a template, carrying out PCR amplification by adopting any one of the specific primer pairs, and then judging as follows: if the PCR amplification product contains a DNA fragment with the size of 193bp, the bacteria to be detected is or is suspected to be Bacillus belgii; if the PCR amplification product does not contain the DNA fragment with the size of 193bp, the bacteria to be detected are not or are suspected not to be Bacillus belgii.
The method Q2) is as follows: taking the genome DNA of a bacterium to be detected as a template, carrying out PCR amplification by adopting any one of the specific primer pairs, and then judging as follows: if the PCR amplification product contains a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the bacteria to be detected is or is suspected to be Bacillus belgii; if the PCR amplification product does not contain a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the bacteria to be detected are not or are suspected not to be Bacillus belgii.
The invention also discloses a method for detecting whether the substance to be detected contains Bacillus belgii.
The method for detecting whether the substance to be detected contains Bacillus belgii or not, which is protected by the invention, can be a method R1) or a method R2).
The method R1) is as follows: taking the genome DNA of a substance to be detected as a template, carrying out PCR amplification by adopting any one of the specific primer pairs, and then carrying out judgment as follows: if the PCR amplification product contains a DNA fragment with the size of 193bp, the substance to be detected contains or is suspected to contain Bacillus belgii; if the PCR amplification product does not contain the DNA fragment with the size of 193bp, the substance to be detected does not contain or is suspected to contain Bacillus belgii.
The method R2) is as follows: taking the genome DNA of a substance to be detected as a template, carrying out PCR amplification by adopting any one of the specific primer pairs, and then carrying out judgment as follows: if the PCR amplification product contains a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the substance to be detected contains or is suspected to contain Bacillus belgii; if the PCR amplification product does not contain the DNA fragment with the nucleotide sequence shown as SEQ ID NO. 1, the substance to be detected does not contain or is suspected to contain Bacillus belgii.
The invention also protects and evaluates the colonization ability of the Bacillus belgii in the soil to be tested.
The method for evaluating the colonization ability of the Bacillus belgii in the soil to be tested, which is protected by the invention, can be a method S1) or a method S2).
The method S1) is: inoculating Bacillus belgii into soil to be tested, and standing and culturing; then extracting the cultured genome DNA of the soil to be detected, taking the genome DNA as a template, and carrying out PCR amplification by adopting any one of the specific primer pairs; the higher the content of the DNA fragment with the size of 193bp in the PCR amplification product is, the stronger the colonization ability of the Bacillus belgii in the soil to be detected is.
The method S2) is: inoculating Bacillus belgii into soil to be tested, and standing and culturing; then extracting the cultured genome DNA of the soil to be detected, taking the genome DNA as a template, and carrying out PCR amplification by adopting any one of the specific primer pairs; the more the content of the DNA fragment with the nucleotide sequence shown as SEQ ID NO. 1 in the PCR amplification product is, the stronger the colonization ability of the Bacillus belgii in the soil to be detected is.
In any of the above methods, the annealing temperature may be 53 ℃ to 56 ℃ (e.g., 56 ℃, 55.8 ℃, 54.4 ℃, 53.4 ℃ or 53 ℃) when PCR amplification is performed.
Any one of the Bacillus belgii can be at least one of Bacillus belgii ZF2, Bacillus belgii FZB42, Bacillus belgii ZF128 and Bacillus belgii ZF 50.
Experiments prove that the specific primer pair provided by the invention can be used for detecting Bacillus belgii, has high sensitivity (the lowest detection concentration is 0.1 fg/. mu.L, the lowest copy number is 474 copies/. mu.L) and good specificity. The specific primer pair can also be used for evaluating the colonization ability of the Bacillus belgii in the soil to be detected, namely monitoring the colonization dynamic of the Bacillus belgii in the soil; the method provides technical conditions for exploring the effective period of the Bacillus belgii in the soil and the effective period in the disease control process, predicts the content of the Bacillus belgii in beneficial microorganisms in the soil, and provides a direction for separating the Bacillus belgii from the soil. The invention has important application value.
Drawings
FIG. 1 shows the general PCR screening of specific primer pairs.
FIG. 2 shows the PCR amplification annealing temperature screening.
FIG. 3 shows the specific PCR verification of the specific primer pair 17.
Figure 4 is a qPCR validation of the specificity of the specific primer pair 17.
FIG. 5 shows the qPCR amplification results for different concentrations of positive plasmid solutions.
FIG. 6 is a standard curve based on positive plasmid concentration.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Bacillus belais ZF2 has been disclosed in "zhao banyan, li epi, xie weng, xiansian, cauaoli, sun guangye, li bao poly" bacillus belaisi ZF2 has control effect on polyspora clavuligerii [ J ] chinese biocontrol bulletin, 2019, 35 (02): 217 and 225.
Bacillus belgii FZB42 has been described in the literature "Fan B, Wang C, Song X, et al Corrigengdum: Bacillus velezensis FZB42 in 2018: the Gram-Positive Model string for Plant Growth Promotion and Biocontrol [ J ] Frontiers in Microbiology, 2019, 10:1279 ].
Bacillus amyloliquefaciens ZF75 has been disclosed in the literature "Li Lei, Zhao Yi banian, Zheng Fei, Shi Yan Xia, Chailali, Xischwen, Li Bao Ju. celery soft rot antagonistic Bacillus screening and prevention effects [ J ]. Chinese Bioprevention and treatment Proc., 2020, 36(03):388 one 395.".
Bacillus subtilis ZF161 has been disclosed in the literature "screening and identification of antagonistic bacteria against Phytophthora parasitica of Li Xinyu, Li Lei, Chen Li Da, Shi Yan Xia, Chailai, Xiehu, Li Bao.
Bacillus polymyxa ZF129 has been disclosed in the literature "Li Yi, Zhao Yi banyan, Zheng Fei, Shi Yan Xia, Chailali, Xiechuan, Li Bao Ju. screening and prevention effects of biocontrol bacteria of potato black nevus [ J/OL ]. plant pathology report: 1-6[2020-12-23]. https:// doi.org/10.13926/j.cnki.apps.000357 ].
Bacillus beleisi ZF128 has been disclosed in the literature "Schuashu, Thanksgang, Zhang, Chinesia, Chaarali, Li Lei Bao, Li Bao poly. screening of Bacillus biocontrol bacteria for blight of potato and biocontrol effect study [ J ]. Chinese Biocontrol bulletin, 2020, 36(05): 761-.
Bacillus beleisi ZF50 has been disclosed in the literature "Xie Wen, Zhao Yi Ficus, Sun Xueying, Shiyanxia, Chaarali, Li Lei Nei, Li Bao poly. tomato Phytophthora root rot biocontrol bacteria isolation identification and its prevention and control effect [ J ]. plant pathology reports, 2020,50(05): 610-.
Bacillus amyloliquefaciens ZF57 has been disclosed in the document "screening, identification and control effects of antagonistic bacteria of plum Xinyu, plum Lei, Shiyanxia, Chailali, Shewang, plum Bay cucumber Tabacospore leaf spot disease [ J ]. plant protection article 2020,47(03): 620-.
Bacillus amyloliquefaciens DSM7 has been disclosed in the literature "Christian R, Jochen B, Xiaohua C, Oleg R, Rainer B (2011) Genome sequence of B.amyloliquefaciens type strain DSM7(T) derivatives to plant-associated B.amyloliquefaciens FZBS 42.J Biotechnol 155:78-85.https:// doi.org10.1016/j.jbiotec.2011.01.006.Epub 2011Jan 22.".
Corynebacterium michiganensis subsp. michiganensis has been disclosed in "li huan, huixia, schwann, li bao poly. occurrence of tomato canker and prevention and treatment technique" chinese vegetables 2011, 23:24-27 ".
The lilac Pseudomonas tomato pathogenic variety (Pseudomonas syringaepv. tomato) is disclosed in the document "establishment and application of real-time fluorescence quantitative PCR detection method for bacterial spot pathogen of tomato [ J ]. Horticulture, 2019, 46(01): 182-" of Pai-Gou-Gu, Guo-Wei, Shi-Yan, Xie-xi, Schimmer-Mey, Li-Bao-Ju.
The wild rape Xanthomonas campestris variety (Xanthomonas campestris pv. campestris) has been disclosed in the literature "Zhang Yang, Leijingping, Zhou Hui Ming, Li Bao Ju. Cruciferae vegetable bacterial black rot occurrence rule and control. Chinese vegetable 2011, 17:23-25.
Pseudomonad syringae lachryrnans (Pseudomonas syringae pv. lachryrnans) has been disclosed in the document "li huan, li bao ju doctor's hand-note (fifty-three) for symptom diversity and comprehensive control of cucumber bacterial angular leaf spot [ J ] chinese vegetables, 2012(21):23-25 ].
Clavibacter clavatus subsp.sepedonicus is disclosed in the literature "Mahai Yan, Zhansen, Wangli, Gao Zhong Qiang, Yun hong Jun, Jiang Weijie doctor, focused production line (fourteen Teng city, early spring arched shed potato high-efficiency cultivation technique., (08):70-73.
Example 1 screening of specific primer pairs for amplification of Bacillus velezensis
Design and synthesis of specific primer pair for amplifying Bacillus belgii
Specific primer pairs for amplifying B.bailii were designed and artificially synthesized based on the nucleotide alignment of B.bailii ZF2 with B.bailii FZB42 (model strain), B.amyloliquefaciens DSM7, the conserved gene sequence of B.subtilis 168, the flagellin synthesis gene sequence, and the nucleotide sequence of the gene specific to B.bailii ZF 2. The method comprises the following specific steps:
1. the nucleotide sequences of the 16S rRNA, atpD, galE, gap, gyrB, metC, pdhA, pgk, rho, rpoD and other conserved genes of Bacillus belgii ZB 2(CP032154.1), Bacillus belgii FZB42(CP000560.1), Bacillus amyloliquefaciens DSM7(FN597644.1) and Bacillus subtilis 168(AL009126.3), respectively, and the nucleotide sequence of the flagellin synthesis gene fliC, and the nucleotide sequence of the 27 B.ZB 2 specific genes determined by comparative genome analysis of Bacillus belgii ZF2, Bacillus belgii FHB 42, Bacillus amyloliquefaciens DSM7 and Bacillus subtilis 168 were downloaded from the NCBI database (https:// www.ncbi.nlm.nih.gov /).
2. DNAMAN software is adopted to compare nucleotide sequences of the same gene of different strains, and in a region with a low sequence comparison consistency ratio, a specific primer pair is designed according to a corresponding gene sequence of Bacillus belgii ZF2, and in addition, the specific primer pair is designed according to a specific gene sequence of Bacillus belgii ZF 2.
Through DNAMAN software sequence alignment, the nucleotide sequence consistency ratio is relatively low (lower than 95%) only in the galE, gyrB, metC, pdhA, pgk and fliC gene sequence alignment, and the nucleotide sequence consistency ratio of other conserved genes in four strains is more than 98%. Therefore, 18 specific primer pairs are designed and synthesized by Beijing Bomaide biotechnology limited according to the nucleotide sequence of Bacillus belgii ZF2 galE, gyrB, metC, pdhA, pgk and fliC genes and the unique gene sequence of 12 Bacillus belgii ZF 2.
The primer sequences constituting the 18 specific primer pairs, the names of the genes used for amplification and the amplification sizes are shown in Table 1.
TABLE 1 amplified genes and corresponding primer sequences
Second, screening of specific primer pair for amplifying Bacillus belgii
1. General PCR screening of specific primer pairs
(1) A bacterial genome DNA extraction kit (Tiangen Biochemical technology Co., Ltd.) is adopted to extract the genome DNA of the bacteria to be detected (Bacillus belgii ZF2, Bacillus belgii FZB42, Bacillus amyloliquefaciens ZF75, Bacillus subtilis ZF161 and Bacillus polymyxa ZF129) to obtain the genome DNA of the bacteria to be detected.
(2) And (3) taking the genome DNA of the bacteria to be detected as a template, and respectively adopting 18 specific primer pairs in the step one to carry out PCR amplification to obtain PCR amplification products.
The reaction system was 20. mu.L, and included 10. mu. L T-taq Mix (product of Biotech Co., Ltd., Beijing), 1. mu.L of primer F aqueous solution, 1. mu.L of primer R aqueous solution, 1. mu.L of template, and 7. mu.L of ddH2O。
The reaction procedure is as follows: 3min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 30s at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 ℃.
(3) The PCR amplification product was subjected to agarose gel electrophoresis.
And (3) replacing the genome DNA of the bacteria to be detected in the step (2) with water, and taking the other steps as blank controls without changing.
Part of the detection results are shown in figure 1(M is DNAmarker, N is blank control, 1 is Bacillus belgii ZF2, 2 is Bacillus belgii FZB42, 3 is Bacillus amyloliquefaciens ZF75, 4 is Bacillus subtilis ZF161, and 5 is Bacillus polymyxa ZF 129). The result shows that the specific primer pair 17 synthesized based on the nucleotide sequence of the D3N19_ RS13500 gene has better specificity, and the Bacillus belgii can be identified from a plurality of bacilli.
2. PCR amplification annealing temperature screening
(1) A bacterial genome DNA extraction kit (Tiangen Biochemical technology Co., Ltd.) is adopted to extract the genome DNA of the bacteria to be detected (Bacillus belgii ZF2, Bacillus belgii FZB42, Bacillus amyloliquefaciens ZF75, Bacillus subtilis ZF161 or Bacillus polymyxa ZF129) to obtain the genome DNA of the bacteria to be detected.
(2) And (3) performing PCR amplification by using the genome DNA of the bacteria to be detected as a template and respectively adopting a specific primer pair 17 to obtain PCR amplification products.
The reaction procedure is as follows: 3min at 94 ℃; 30s at 94 ℃, 30s at 52-58 ℃, 30s at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 ℃.
(3) The PCR amplification product was subjected to agarose gel electrophoresis.
And (3) replacing the genome DNA of the bacteria to be detected in the step (2) with water, and taking the other steps as blank controls without changing.
Part of the detection results are shown in figure 2(M is DNAmarker, N is blank control, 1 is Bacillus belgii ZF2, 2 is Bacillus belgii FZB42, 3 is Bacillus amyloliquefaciens ZF75, 4 is Bacillus subtilis ZF161, 5 is Bacillus polymyxa ZF129, and the annealing temperatures are 57.6 ℃, 56.9 ℃, 55.8 ℃, 54.4 ℃, 53.4 ℃ and 52.6 ℃ in sequence). The result shows that when the annealing temperature is between 53 ℃ and 56 ℃, the amplified product band has specificity and better amplification effect. Therefore, 53 ℃ to 56 ℃ is the optimum annealing temperature.
3. Specificity verification of specific primer pair 17
(1) The method comprises the steps of extracting the genomic DNA of bacteria to be detected (Bacillus belgii ZF2, Bacillus belgii ZF50, Bacillus belgii ZF128, Bacillus belgii FZB42, Bacillus amyloliquefaciens ZF57, Bacillus amyloliquefaciens ZF75, Bacillus amyloliquefaciens DSM7, Bacillus subtilis ZF161, Bacillus polymyxa ZF129, Corynebacterium michiganensis subspecies, Pseudomonas syringae pathopoiesia variation, Brassica napus variation, Pseudomonas syringae lacrima variation or Corynebacterium michiganensis subspecies) by using a bacterial genomic DNA extraction kit (Tiangen Biotechnology Co., Ltd) to obtain the genomic DNA of the bacteria to be detected.
(2) And (3) performing PCR amplification by using the genome DNA of the bacteria to be detected as a template and respectively adopting a specific primer pair 17 to obtain PCR amplification products.
The reaction procedure is as follows: 3min at 94 ℃; 30s at 94 ℃, 30s at 54 ℃, 30s at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 ℃.
(3) The PCR amplification product was subjected to agarose gel electrophoresis.
And (3) replacing the genome DNA of the bacteria to be detected in the step (2) with water, and taking the other steps as blank controls without changing.
The results are shown in FIG. 3(M is DNAmarker, N is blank control, 1 is Bacillus belgii ZF2, 2 is Bacillus belgii ZF50, 3 is Bacillus belgii ZF128, 4 is Bacillus belgii FZB42, 5 is Bacillus amyloliquefaciens ZF57, 6 is Bacillus amyloliquefaciens ZF75, 7 is Bacillus amyloliquefaciens DSM7, 8 is Bacillus subtilis ZF161, 9 is Bacillus polymyxa ZF129, 10-14 is other non-spore bacteria (i.e.Corynebacterium melanini, Pseudomonas syringae var. solani, Xanthomonas campestris, Pseudomonas syringae lacrimalis, Corynebacterium clausii). No bands appeared. It can be seen that the specific primer pair 17 is specific for Bacillus belgii.
The nucleotide sequence of the band with the size of about 193bp is shown as SEQ ID NO 1. 1 is: CTAATTTTTCCTATTTCTTTAACGCTGATTTTCATCTTTGTCTTTGACCCATGAATGCCGTCAGCAGTAAGGCCGTACATGGACTGGAATCGTTTGACTGCATTTGCGCTGTTTTCGGGCCGTAAATATCATCATCAAACCGTTCATCAATTGAAACTGACTCATTTACTGATGTAAGTGAATTTAAATAAAT are provided.
4. Fluorescent quantitative PCR verification of specific primer pair 17
(1) The genome DNA of a bacterium to be detected (Bacillus belgii ZF2, Bacillus belgii FZB42, Bacillus amyloliquefaciens ZF75, Bacillus subtilis ZF161, Bacillus polymyxa ZF129, Corynebacterium michiganensis subspecies, Pseudomonas syringae tomato pathogenic variant, Brassica campestris variant or Pseudomonas syringae lacrimalis pathogenic variant) is extracted by using a bacterial genome DNA extraction kit (Tiangen Biochemical technology Co., Ltd.) to obtain the genome DNA of the bacterium to be detected.
(2) The genome DNA of the bacteria to be detected is taken as a template, and a fluorescent quantitative PCR kit (a product of Tiangen Biochemical technology Co., Ltd.) is adopted for fluorescent quantitative PCR amplification. The detection primer is a primer of the specific primer pair 17.
The fluorescent quantitative PCR system was 20. mu.L, and included 10. mu.L of SYBR Mix (components of the fluorescent quantitative PCR kit), 0.5. mu.L of primer F aqueous solution, 0.5. mu.L of primer R aqueous solution, 0.4. mu.L of LROX, 1. mu.L of template, and 7.6. mu.L of ddH2O。
The fluorescent quantitative PCR program is: 5min at 98 ℃; 10s at 98 ℃, 10s at 60 ℃, 30s at 72 ℃ and 40 cycles.
Each template was provided with 3 replicates.
Sterile water was used as a blank control instead of template.
The results are shown in FIG. 4. The result shows that obvious amplification occurs when the genome DNA of the Bacillus belgii ZF2 or Bacillus belgii FZB42 is taken as a template, and the CT value is less than 15; when the genome DNA of other strains is taken as a template, no amplification or the CT value is more than 35. As can be seen, the specific primer pair 17 is specific.
Example 2 establishment of Bacillus velezensis ZF2 PMA-qPCR detection System
First, screening of optimum PMA concentration
The azide propidium bromide (PMA) can selectively penetrate the cell membrane of dead bacteria and combine with DNA of the dead bacteria under the condition of illumination, thereby preventing PCR amplification of the dead bacteria. Screening the optimal PMA concentration can distinguish live bacteria from dead bacteria and detect the active Bacillus belgii.
1. Inoculating single colony of Bacillus belgii ZF2 in LB liquid culture medium, performing constant temperature shaking culture at 28 deg.C for 24 hr, and adjusting OD600nmIs 0.8. The bacterial liquid is divided into two parts, namely a group A and a group B, wherein the group A is kept in ice bath for later use, and the group B is placed in a water bath at 99 ℃ for incubation for 30min to inactivate cells. And coating 100 mu L of the treated bacterial suspension on an LB solid plate, culturing at 28 ℃ for 48h, and verifying the high-temperature lethal effect.
2. PMA was added to a 1.5mL centrifuge tube containing 1mL of live cells (group A) or dead cells (group B) so that the concentration of PMA in the system was 0. mu.M/L, 10. mu.M/L, 20. mu.M/L, 30. mu.M/L, 40. mu.M/L, 50. mu.M/L or 60. mu.M/L, to obtain PMA solutions of different concentrations.
3. PMA bacterial liquids with different concentrations are placed under a dark condition for treatment for 15min, then the bacterial liquids are placed under a 50W LED lamp for treatment for 10min, and ice bath incubation is carried out to avoid death of living cells due to overhigh temperature.
4. And extracting genome DNA of the bacterial liquid subjected to different treatments, taking the genome DNA as a template, and performing fluorescent quantitative PCR amplification by adopting a fluorescent quantitative PCR kit. The detection primer is a primer of the specific primer pair 17.
The effect of different PMA concentrations on live and dead cells was compared.
The results are shown in Table 2. The results showed that the CT value for live cell expansion was 13.27 and that for dead cells was 37.09 at a final PMA concentration of 60. mu.M. It can be seen that a PMA concentration of 60. mu.M is the optimum concentration for distinguishing live cells from dead cells of Bacillus belgii ZF 2.
TABLE 2 CT values for the amplification of live and dead cells treated with PMA at different concentrations
Second, establishment of ZF2 qPCR detection system
1. Specific fragment amplification
The genomic DNA of Bacillus belgii ZF2 is used as a template, a specific primer pair 17 is adopted for PCR amplification, and a DNA fragment of about 193bp is recovered.
The reaction system was 50. mu.L, including 25. mu. L T-taq Mix, 2. mu.L primer F aqueous solution, 2. mu.L primer R aqueous solution, 2. mu.L template and 19. mu.L ddH2O。
The reaction procedure is as follows: 3min at 94 ℃; 30s at 94 ℃, 30s at 54 ℃, 30s at 72 ℃ and 35 cycles; 10min at 72 ℃; storing at 4 ℃.
2. And (3) connecting the DNA fragment recovered in the step (1) with a cloning vector pMD18-T to obtain a positive plasmid.
3. The DNA concentration of the positive plasmid is determined by using Nanodrop, and then is diluted to 10 ng/mu L by using sterile water; then the mixture is diluted in a gradient way to obtain the concentration of 10 multiplied by 10 in turn-1ng/μL—10×10-9ng/. mu.L of positive plasmid solution. And (3) carrying out fluorescent quantitative PCR amplification by using the fluorescent quantitative PCR kit by taking the positive plasmid solutions with different concentrations as templates. The detection primer is a primer of the specific primer pair 17.
And (3) taking the logarithmic value of the concentration of the positive plasmid solution as an abscissa and the corresponding CT value as an ordinate, and drawing a standard curve.
The results of the fluorescent quantitative PCR amplification are shown in FIG. 5.
The standard curve is plotted in FIG. 6.
The results show that qPCR of positive plasmid solutions with different concentrations has amplification in different degrees and has a certain linear relationship. The linear equation for the standard curve is-3.8785 x +30.713, and R2 is 0.9972.
As can be seen, the specific primer pair 17 has high sensitivity, the minimum detection concentration is 0.1 fg/. mu.L, and the minimum copy number is 474 copies/. mu.L.
Example 3 dynamic monitoring of the colonization of Bacillus velezensis ZF2 in soil
Bacillus belgii ZF2 rifampicin domestication
Rifampin is a broad-spectrum bacterial antibiotic, Bacillus belgii ZF2 can grow in LB plate or culture medium containing rifampin after acclimatization of rifampin, but other bacteria can not grow, so strain ZF2 is distinguished from other bacteria, and the colonization ability of strain ZF2 is conveniently and accurately detected. Rifampicin is red in color, has strong identification and is the most common antibiotic currently used for strain domestication.
1. A single colony of Bacillus belgii ZF2 is inoculated in 5mL LB liquid culture medium containing 0.5 ng/. mu.L rifampicin, and shaking culture is carried out at 28 ℃ and 180rpm for 24h to obtain ZF2 bacterial liquid.
2. And (3) performing transfer subculture on the ZF2 bacterial liquid with rifampicin resistance from low concentration to high concentration, wherein the rifampicin concentration gradient is 1 ng/mu L, 2 g/mu L, 5 ng/mu L, 10 ng/mu L, 20 ng/mu L, 30 ng/mu L, 40 ng/mu L and 50 ng/mu L, so as to obtain rifampicin domesticated bacteria ZF 2.
Mixing the bacterial liquid of the rifampicin domestication bacterium ZF2 and 40% (v/v) glycerol aqueous solution in equal volume, and preserving at-80 ℃.
Dynamic monitoring of colonization of Bacillus belgii ZF2 in soil
The soil to be tested is collected from Qing county, Hainan, Shandong shou Guang, Xinjiang, Tianjin or Ningxia in Hebei province.
The experiment was repeated 3 times to obtain an average, and the procedure for each repetition was as follows:
1. inoculating single colony of rifampicin domesticated bacteria ZF2 into 5mL LB liquid culture medium containing rifampicin, performing shake culture at 28 deg.C and 180rpm for 24h to obtain OD600nmBacterial liquid with a value of 1.0.
2. And (3) uniformly mixing the bacterial liquid obtained in the step (1) and the soil to be detected (the mixing ratio is 1mL of bacterial liquid: 10g of soil), placing the mixture in a moisture preservation box, and standing and culturing for 0 day, 5 days, 10 days or 15 days at the temperature of 28 ℃.
3. After the step 2 is completed, extracting the DNA of the soil (by using a soil DNA extraction kit of Tiangen corporation) and performing fluorescent quantitative PCR amplification by using a fluorescent quantitative PCR kit by using the DNA as a template to obtain a CT value. The detection primer is a primer of the specific primer pair 17.
The ZF2 gene copy number was obtained from the standard curve and CT values plotted in step two of example 2. The larger the copy number of the ZF2 gene is, the higher the content of the strain ZF2 in soil is, and the stronger the colonization ability is.
The results of the copy number detection of the ZF2 gene in different soils are shown in Table 3. The result shows that the copy number of the ZF2 gene in Ningxia soil and Xinjiang soil is higher and relatively stable within 15 days after the rifampicin acclimation bacterium ZF2 is inoculated, and the rifampicin acclimation bacterium ZF2 is proved to have stronger colonization ability in Xinjiang soil and Ningxia soil.
TABLE 31 grams of Gene copy number detected by Strain ZF2 in soil
4. Dissolving 1g of soil to be detected or the soil after completing the step 2 in 9mL of sterile water, and performing shaking culture at 28 ℃ for 30min to obtain the dilution of 10-1The diluent 1 of (1). Taking 1mL of the diluted solution 1, adding 9mL of sterile water to obtain a dilution degree of 10-2The diluent 2 of (1). The dilution is obtained by analogy to obtain the dilution degree of 10-3 Dilution 3, dilution degree of 10-4 Dilution 4 of (D) with a dilution of 10-5The diluent 5. 100 μ L of dilution 3, 4 or 5 was spread on LB solid plate containing 50mg/L rifampicin, cultured for 48h, and colonies were counted.
The colony count statistics are shown in Table 4. The results show that the colony count in each gram of Ningxia soil and Xinjiang soil is kept at 10 within 15 days after inoculation of rifampicin acclimation bacterium ZF28The above.
TABLE 41 g number of ZF2 colonies in soil to be tested
The detection result of the plate counting method is basically consistent with the detection result of the real-time fluorescent quantitative PCR. The above results indicate that the colonization ability of bacillus beijerinckii ZF2 in Ningxia soil and Xinjiang soil is significantly increased compared to other soils.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> vegetable and flower institute of Chinese academy of agricultural sciences
<120> method for rapidly detecting Bacillus belgii and application thereof
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 193
<212> DNA
<213> Artificial sequence
<400> 1
ctaatttttc ctatttcttt aacgctgatt ttcatctttg tctttgaccc atgaatgccg 60
tcagcagtaa ggccgtacat ggactggaat cgtttgactg catttgcgct gttttcgggc 120
cgtaaatatc atcatcaaac cgttcatcaa ttgaaactga ctcatttact gatgtaagtg 180
aatttaaata aat 193
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<400> 2
ctaatttttc ctatttcttt aacgc 25
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
atttatttaa attcacttac atcagt 26
Claims (10)
1. A specific primer pair comprises a primer F and a primer R;
the primer F is a1) or a 2):
a1) a single-stranded DNA molecule shown as SEQ ID NO. 2;
a2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides to SEQ ID NO. 2 and have the same functions as SEQ ID NO. 2;
the primer R is a3) or a 4):
a3) a single-stranded DNA molecule represented by SEQ ID NO. 3;
a4) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to SEQ ID NO. 3 and has the same function as SEQ ID NO. 3.
2. The use of the specific primer pair according to claim 1, which is b1) or b2) or b3) or b4) or b5) or b 6):
b1) detecting Bacillus belgii;
b2) identifying whether the bacteria to be detected are Bacillus belgii;
b3) evaluating the colonization ability of the Bacillus belgii in the soil to be tested;
b4) preparing a kit for detecting Bacillus belgii;
b5) preparing a kit for identifying whether the bacteria to be detected are Bacillus belgii;
b6) preparing a kit for evaluating the colonization ability of the Bacillus belgii in the soil to be tested.
3. A kit comprising the specific primer pair of claim 1.
4. The use of the kit of claim 3, being b1) or b2) or b 3):
b1) detecting Bacillus belgii;
b2) identifying whether the bacteria to be detected are Bacillus belgii;
b3) and evaluating the colonization ability of the Bacillus belgii in the soil to be tested.
5. A method for preparing the kit according to claim 3, comprising the step of separately packaging each primer of the specific primer pair according to claim 1.
6. A method for identifying whether the test bacterium is Bacillus belgii, which is Q1) or Q2):
q1) using the genome DNA of the bacteria to be tested as the template, carrying out PCR amplification by using the specific primer pair of claim 1, and then carrying out the following judgment: if the PCR amplification product contains a DNA fragment with the size of 193bp, the bacteria to be detected is or is suspected to be Bacillus belgii; if the PCR amplification product does not contain a DNA fragment with the size of 193bp, the bacteria to be detected are not or are suspected not to be Bacillus belgii;
q2) using the genome DNA of the bacteria to be tested as the template, carrying out PCR amplification by using the specific primer pair of claim 1, and then carrying out the following judgment: if the PCR amplification product contains a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the bacteria to be detected is or is suspected to be Bacillus belgii; if the PCR amplification product does not contain a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the bacteria to be detected are not or are suspected not to be Bacillus belgii.
7. The method for detecting whether the substance to be detected contains Bacillus belgii is R1) or R2):
r1) using the genome DNA of the substance to be tested as the template, carrying out PCR amplification by using the specific primer pair of claim 1, and then carrying out the following judgment: if the PCR amplification product contains a DNA fragment with the size of 193bp, the substance to be detected contains or is suspected to contain Bacillus belgii; if the PCR amplification product does not contain the DNA fragment with the size of 193bp, the substance to be detected does not contain or is suspected to contain Bacillus belgii;
r2) using the genome DNA of the substance to be tested as the template, carrying out PCR amplification by using the specific primer pair of claim 1, and then carrying out the following judgment: if the PCR amplification product contains a DNA fragment with a nucleotide sequence shown as SEQ ID NO. 1, the substance to be detected contains or is suspected to contain Bacillus belgii; if the PCR amplification product does not contain the DNA fragment with the nucleotide sequence shown as SEQ ID NO. 1, the substance to be detected does not contain or is suspected to contain Bacillus belgii.
8. The method for evaluating the colonization ability of the Bacillus belgii in the soil to be tested is S1) or S2):
s1) inoculating Bacillus belgii to the soil to be tested, and standing and culturing; then extracting the genomic DNA of the cultured soil to be detected, taking the genomic DNA as a template, and carrying out PCR amplification by adopting the specific primer pair of claim 1; the more the content of the DNA fragment with the size of 193bp in the PCR amplification product is, the stronger the colonization ability of the Bacillus belgii in the soil to be detected is;
s2) inoculating Bacillus belgii to the soil to be tested, and standing and culturing; then extracting the genomic DNA of the cultured soil to be detected, taking the genomic DNA as a template, and carrying out PCR amplification by adopting the specific primer pair of claim 1; the more the content of the DNA fragment with the nucleotide sequence shown as SEQ ID NO. 1 in the PCR amplification product is, the stronger the colonization ability of the Bacillus belgii in the soil to be detected is.
9. The method of any of claims 6 to 8, wherein: when PCR amplification is carried out, the annealing temperature is 53-56 ℃.
10. The use of claim 2 or 4, or the method of any one of claims 6 to 8, wherein: the Bacillus belgii is at least one of Bacillus belgii ZF2, Bacillus belgii FZB42, Bacillus belgii ZF128 and Bacillus belgii ZF 50.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110339235.3A CN113106162A (en) | 2021-03-30 | 2021-03-30 | Method for rapidly detecting Bacillus belgii and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110339235.3A CN113106162A (en) | 2021-03-30 | 2021-03-30 | Method for rapidly detecting Bacillus belgii and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113106162A true CN113106162A (en) | 2021-07-13 |
Family
ID=76712674
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110339235.3A Pending CN113106162A (en) | 2021-03-30 | 2021-03-30 | Method for rapidly detecting Bacillus belgii and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113106162A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215010A (en) * | 2020-01-21 | 2021-08-06 | 中国农业科学院蔬菜花卉研究所 | Bacillus belgii ZF128 and application thereof in preventing and treating potato wilt |
| CN113249242A (en) * | 2020-02-13 | 2021-08-13 | 中国农业科学院蔬菜花卉研究所 | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111778171A (en) * | 2020-03-24 | 2020-10-16 | 仲恺农业工程学院 | Bacillus belgii and application thereof |
-
2021
- 2021-03-30 CN CN202110339235.3A patent/CN113106162A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111778171A (en) * | 2020-03-24 | 2020-10-16 | 仲恺农业工程学院 | Bacillus belgii and application thereof |
Non-Patent Citations (7)
| Title |
|---|
| LI,L.等: "《Bacillus velezensis strain ZF2 chromosome, complete genome》", 《GENBANK: CP032154.1》 * |
| LIU,H., 等: "《Bacillus amyloliquefaciens strain WS-8 chromosome, complete genome》", 《GENBANK: CP018200.1》 * |
| MIN SEOK CHO等: "《Understanding the ontogeny and succession of Bacillus velezensis and B. subtilis subsp. subtilis by focusing on kimchi fermentation》", 《SCIENTIFIC REPORTS》 * |
| YANG ZHANG等: "《Application of Bacillus velezensis NJAU-Z9 Enhanced Plant Growth Associated with Efficient Rhizospheric Colonization Monitored by qPCR with Primers Designed from the Whole Genome Sequence》", 《CURRENT MICROBIOLOGY》 * |
| 王雨等: "贝莱斯芽胞杆菌HN-2的鉴定及对?果炭疽菌的抑菌活性研究", 《中国生物防治学报》 * |
| 赵昱榕等: "《贝莱斯芽胞杆菌ZF2对多主棒孢病菌防治效果》", 《中国生物防治学报》 * |
| 陶永梅等: "贝莱斯芽胞杆菌NSZ-YBGJ001的鉴定及其生物学特性", 《植物保护学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215010A (en) * | 2020-01-21 | 2021-08-06 | 中国农业科学院蔬菜花卉研究所 | Bacillus belgii ZF128 and application thereof in preventing and treating potato wilt |
| CN113249242A (en) * | 2020-02-13 | 2021-08-13 | 中国农业科学院蔬菜花卉研究所 | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases |
| CN113249242B (en) * | 2020-02-13 | 2022-05-03 | 中国农业科学院蔬菜花卉研究所 | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xiao et al. | Changes in the actinomycetal communities during continuous thermophilic composting as revealed by denaturing gradient gel electrophoresis and quantitative PCR | |
| Yin et al. | Impact of biocontrol agents Pseudomonas fluorescens 2P24 and CPF10 on the bacterial community in the cucumber rhizosphere | |
| Tian et al. | Diversity of cultivated and uncultivated actinobacterial endophytes in the stems and roots of rice | |
| CN109468243B (en) | Bacillus siamensis and application thereof | |
| Madhaiyan et al. | Improvement of plant growth and seed yield in Jatropha curcas by a novel nitrogen-fixing root associated Enterobacter species | |
| CN113106162A (en) | Method for rapidly detecting Bacillus belgii and application thereof | |
| Wakase et al. | Investigation of the microbial community in a microbiological additive used in a manure composting process | |
| CN110106102B (en) | Cold-resistant brevibacterium strain ZL-2 and preparation method and application of compost low-temperature starting microbial inoculum thereof | |
| CN105733986B (en) | Bacillus tequilensis and application thereof | |
| Wang et al. | Diversity of microorganisms isolated from the soil sample surround Chroogomphus rutilus in the Beijing region | |
| CN113549578B (en) | Bacillus siamensis BsNlG13 for inhibiting Pyricularia oryzae and promoting seed germination and application thereof | |
| CN104498374A (en) | Verticillium dahlia delta VdKu70 defective mutant strain and application thereof | |
| CN110172422B (en) | Bacillus proteolicus and application thereof in preventing and controlling root-knot nematodes | |
| CN112481137A (en) | Cladosporium and application thereof in degradation of polyurethane plastic | |
| CN110172423B (en) | Bacillus belgii and application thereof in preventing and controlling root-knot nematodes | |
| Wu et al. | Culture-dependent and culture-independent analysis of lactic acid bacteria from Shanxi aged vinegar | |
| Lü et al. | Characterization of the effective cellulose degrading strain CTL-6 | |
| CN102604869A (en) | Bio-control bacteria strain 1JN2 for preventing and treating bacterial fruit blotches of watermelons and application thereof | |
| CN109536390B (en) | Citrus endophytic fungi and application thereof | |
| Srivastava et al. | Profiling of plant growth promoting bacteria associated with Jaunpuri giant raddish rhizosphere | |
| CN110878272B (en) | Bacillus subtilis ZWZ-19 for preventing and controlling rot stem nematode and application thereof | |
| CN110923153B (en) | Straw saprophytic bacteria and application thereof | |
| CN115466690A (en) | Novel geobacillus strain as well as culture method and application thereof | |
| CN108220216A (en) | A kind of nitrogen-fixing microorganism of resistance to ammonium for being overexpressed glnR genes and its construction method and application | |
| CN114933974A (en) | Trichoderma pseudokoningii C5-9 and application thereof in antagonism of botrytis cinerea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210713 |