CN113106072A

CN113106072A - High-infectivity hepatitis B virus C strain and application thereof

Info

Publication number: CN113106072A
Application number: CN202110386353.XA
Authority: CN
Inventors: 张全; 刘婷婷; 刘勇
Original assignee: Nanjing Drum Tower Hospital
Current assignee: Nanjing Drum Tower Hospital
Priority date: 2021-04-12
Filing date: 2021-04-12
Publication date: 2021-07-13

Abstract

The invention relates to a high-infectivity hepatitis B virus C-3 strain with a preservation number of CCTCC M2021195. The invention also relates to the genomic sequence and the application of the virus strain. Compared with the D-type virus strains in the currently applied cell lines HepG2.2.15 and HepAD38, the highly infectious hepatitis B virus strain C-3 obtained by screening has a genome sequence closer to the virus strains which are mainly popular in China and the infection capacity improved by about 5 times, so that in an in vitro infection experiment, the virus culture supernatant required for achieving the same infection efficiency is reduced by about 80 percent, and the cost for preparing virus particles required by the in vitro infection experiment is greatly reduced. Meanwhile, because the infectivity is high, the virus in the cell culture supernatant can be directly used for in vitro infection experiments without concentration, and the virus preparation process is simple, so the screened high-infectivity C-type virus strain C-3 can play an important role in hepatitis B virus in vitro infection research and the application of developing and evaluating the targeted hepatitis B virus early infection stage medicament.

Description

High-infectivity hepatitis B virus C strain and application thereof

Technical Field

The invention belongs to the field of viruses, and relates to a high-infectivity hepatitis B virus C strain and application thereof.

Background

Hepatitis B Virus (HBV) belongs to the family of hepadnaviridae, and is hosted by human and gorilla. HBV infection can lead to hepatitis b, and some infected persons will develop cirrhosis and liver cancer, with over 75 ten thousand worldwide deaths due to this factor each year. Thus, it can be seen that HBV is one of the important threats to human health. The complete life history of HBV can be divided into an early infection phase and a late replication phase. The early infection stage refers to the fact that HBV enters cells by recognizing receptors on the surface of hepatocytes, then viral nucleocapsids are transported to the nuclear pore of the nucleus, and its genome is released into the nucleus and converted into covalently closed circular DNA (cccDNA) under the action of a host cell DNA repair system. The late replication stage is to take cccDNA as a template, transcribe and translate all viral genes, then assemble to form a new viral particle, and release the new viral particle outside the cell to infect a new hepatocyte.

The successful formation of cccDNA by HBV infection entering liver cells is a sign of HBV infection, and the failure to clear the cccDNA is also a main reason that chronic HBV infection cannot be cured radically at present. Therefore, to block HBV transmission, drugs are required to act on the target site at the early infection stage of HBV, i.e. before cccDNA formation. In addition to preventing HBV infection, recent studies have shown that drugs targeting the HBV infection stage can also be used to treat already infected HBV patients. Drugs targeting the early infection stage of HBV can reduce cccDNA levels by blocking viral infection of neonatal naive hepatocytes, which may play a major role in the ultimate goal of clearance of cccDNA. However, the anti-HBV drugs in clinical application at present are mainly nucleoside (acid) analogues acting on the later replication stage of the virus life history. Although these drugs can effectively inhibit the replication of HBV, they cannot effectively eliminate viral cccDNA in hepatocytes, and are easy to relapse after drug withdrawal, which means that there is still a need to develop new drugs, especially drugs targeting the early infection stage of viral life history, to achieve the goal of curing HBV thoroughly.

Development of drugs targeting the early stages of viral infection requires reliance on HBV in vitro cell models for infection. However, the development of drugs targeting HBV early stage infection is severely limited due to the lack of in vitro infected cell models which are simple and easy to use, convenient to culture, cheap and strong in repeatability. The li shinhui team of our country found in 2012 that sodium taurocholate transport polypeptide (NTCP) is a functional receptor for HBV infection. The significant discovery solves the limitation that the liver cancer cells Huh7 and HepG2 cannot be infected by HBV. The hepatoma cell line HepG2-NTCP exogenously expressing HBV receptor NTCP provides a powerful and convenient tool for HBV infection research and drug screening due to the advantages of easy operation, short period and good reproducibility. However, all the HBV in vitro infected cell models including HepG2-NTCP have a serious defect of low infection efficiency. To achieve an acceptable infected cell ratio, the multiplicity of infection (MOI) of the virus to be used is typically around 1000, while many other viruses need to infect MOI in vitro only 0.1 or less. The vast majority of HBV viruses used to infect cells are derived from the two stably HBV expressing cell lines hepg2.2.15 and HepAD38, since only their culture supernatants provide high viral yields and high infectious viral particles. Even so, in order to achieve effective infection, the culture supernatants of both cell lines need to be concentrated 50 to 100 fold in order to further increase virus titer. Therefore, when screening and developing drugs using HBV infection models in vitro, it is necessary to prepare viral particles for infection at a high cost of labor and material. In addition to this, there is another disadvantage in the use of the cell lines HepG2.2.15 and HepAD38 for obtaining virus particles: the two cell lines provide HBV virus particles with D-type genotype, while B-type and C-type are mainly prevalent in China, and the C-type is the majority. Numerous studies have shown that different HBV genotypes differ in transmission pattern, disease progression and response to treatment, such as type D is transmitted mainly by adults, while type B and C are transmitted mainly by mother and infant; the disease condition of type C is more serious and the antiviral effect is worse. Therefore, it is very important to select high-infectivity C-type virus strain for in vitro infection research and drug screening in China.

Disclosure of Invention

The first purpose of the invention is to provide a highly infectious hepatitis B virus C strain C-3, which overcomes the problem of poor infection capability of the current hepatitis B virus strain.

The second purpose of the invention is to provide the application of the high-infectivity hepatitis C virus B strain C-3.

The invention is realized by the following technical scheme:

a high-infectivity hepatitis B virus C-3 with a preservation number of CCTCC NO: m2021195.

Furthermore, the genome sequence of the high-infectivity hepatitis B virus C-3 strain is shown as SEQ ID No. 1.

Secondly, according to the application of the high-infectivity hepatitis C virus C-3 strain in an in-vitro hepatitis B virus infection experiment and the application in developing and evaluating a targeted hepatitis B virus early infection stage medicament.

Adopt above-mentioned technical scheme's positive effect: compared with the D-type virus strains in cell lines HepG2.2.15 and HepAD38 which are mainly used at present, the high-infectivity C-type HBV virus strain C-3 is obtained by screening, the genome sequence of the high-infectivity C-type HBV virus strain C-3 is closer to the virus strains which are mainly popular in China, and the infection capacity is improved by about 5 times, so that the virus culture supernatant which is required by reaching the same infection efficiency is reduced by about 80 percent, and the cost for preparing virus particles required by in vitro infection experiments is greatly reduced; meanwhile, because of high infectivity, the virus in the cell culture supernatant can be directly used for in vitro infection experiments without concentration, thereby simplifying the virus preparation process.

Drawings

FIG. 1 is a schematic representation of a C-3 strain expression vector;

FIG. 2 is a virus strain infectivity assay;

FIG. 3 is a comparison of the infectivity of the D-type virus strains with the C-3 strain in the cell lines HepG2.2.15 and HepAD 38;

FIG. 4 is an in vitro cell infection experiment using unconcentrated culture supernatant of the C-3 virus strain;

FIG. 5 is the response of the C-3 strain to drugs targeting the early stages of HBV infection.

Preservation description:

the genome of the hepatitis B virus strain C-3 of the invention is cloned into an expression vector to obtain the virus strain expression vector pUCm-CMV-1.1HBV-C-3-BGH plasmid. The expression vector can be transfected into a hepatoma cell line HepG2 by a liposome transient transfection method to obtain viral particles. The expression vector of the virus strain is transformed into Escherichia coli and is preserved in 26 months at 2021 with the following preservation numbers: CCTCC NO: m2021195, depository: china center for type culture Collection, Collection Unit Address: wuhan, Wuhan university.

Detailed Description

Sources of the biological material in the present invention:

1. pcdna3.1 vector: purchased from Invitrogen corporation;

2. pUCm-T vector: from Biyuntian Biotechnology Ltd

The technical solution of the present invention is further described with reference to the following specific examples, which should not be construed as limiting the present invention:

example 1

This example illustrates isolation sequencing of viral strains.

Serum of each of a plurality of chronic hepatitis B virus infected persons was collected at 200. mu.L, and viral DNA was extracted using a viral genomic DNA/RNA extraction kit (Tiangen Biochemical technology Co., Ltd.). Amplifying the whole length of the viral genome by a conventional PCR method using the extracted DNA as a template, wherein: an upstream primer tttttcacctctgcctaatca (SEQ ID No. 2); the downstream primer aaaaagttgcatggtgctgg (SEQ ID No. 3). And then sequencing to obtain the whole genome sequence of the virus, wherein the genome sequence of the virus strain with the highest infectivity is shown as SEQ ID No. 1. And determining the C-3 virus strain genotype as C through sequence comparison.

Example 2

This example illustrates the construction of viral strain expression vectors.

1. Using the C-3HBV strain genome (SEQ ID No.1) as a template, a primer (forward primer: tctatataagcgtcgagcaccagcaccatgcaactt SEQ ID No. 4); reverse primer: ccaccacgagtctagactctgt SEQ ID No.5) to obtain 1804, 3215, 262 amplification product (SEQ ID No. 6). PCR amplification was performed using the pCDNA3.1 vector as a template and primers (forward primer: gtatgaaagcttgttgacattgattattga SEQ ID No. 7; reverse primer: ttgcatggtgctggtgctcgacgcttatatagacctccca SEQ ID No.8) to obtain an amplification product of the CMV promoter (SEQ ID No. 9). Further, the two amplification products are taken as templates, PCR amplification is carried out through primers (forward primer: gtatgaaagcttgttgacattgattattga SEQ ID No. 10; reverse primer: ccaccacgagtctagactctgt SEQ ID No.11), the two template fragments are fused to obtain a CMV-1804-3215-262 fragment, and the two ends of the fragment are respectively provided with restriction sites of restriction enzymes HindIII and XbaI;

2. PCR amplification is carried out by taking C-3HBV strain genome (SEQ ID No.1) as a template and using a primer (forward primer: acagagtctagactcgtggtgg SEQ ID No. 12; reverse primer: agttgcggccgctctcgaatagaaggaaag SEQ ID No.13) to obtain an amplification product (SEQ ID No.14) of 241-1986, wherein both ends of the amplification product respectively have restriction enzyme sites of restriction enzymes XbaI and NotI;

3. the pUCM-T plasmid was double-digested with restriction enzymes HindIII and NotI to obtain a vector fragment having HindIII and NotI cohesive ends, which was ligated with the above CMV-1804-3182-containing 262 fragment (double-digested with HindIII and XbaI) and 241-containing 1986 fragment (double-digested with XbaI and NotI) to obtain a pUCM-CMV-1.1HBV-C-3 vector.

4. Using pcdna3.1 vector as a template, primers (forward primer:

ctttccttctattcgagagcggccgccagcctcgactgtgccttct SEQ ID No. 15; reverse primer: atcgatgatatcccatgggcggccgtctcagaagccatagagccca SEQ ID No.16) to obtain an amplification product (SEQ ID No.17) containing BGH and its upstream and downstream homology arms.

4. And (2) carrying out enzyme digestion on the pUCm-CMV-1.1HBV-C-3 vector by using a restriction enzyme NotI to obtain a linearized vector, carrying out homologous recombination on the linearized vector and the amplified product containing BGH and upstream and downstream homologous arms thereof, and integrating BGH into a transcription termination region to obtain the pUCm-CMV-1.1HBV-C-3-BGH vector. Homologous recombination was performed using the Trelief Soso Cloning Kit (New Biotechnology Co., Ltd., Beijing Optimalaceae).

5. The PCR reaction system and conditions were as follows: the enzyme used for PCR was PrimeSTAR HS DNA Polymerase,

composition of reaction solution (50 μ L): 10. mu.L of 5 Xbuffer, 4. mu.L of dNTP mix, 1.25. mu.L of forward primer (10. mu.M), 1.25. mu.L of reverse primer (10. mu.M), 1. mu.L of template, 0.5. mu.L of PCR enzyme, and 32. mu.L of sterilized distilled water.

The reaction conditions are as follows: 30 cycles of 98 ℃ for 10s, 58 ℃ for 15s and 72 ℃ for 2.5 min.

Example 3

This example illustrates virus infectivity assays.

Obtaining infectious viral particles: inoculation of 1X 10⁶One HepG2 cell into each well of the six-well plate. After 24 hours, 2 μ g of viral expression vector was transfected into cells using 4 μ L of Lipofectamine3000 transfection reagent per well. After 24 hours of transfection, the cells were changed and then the culture was continued, with the cell culture medium being changed every two days. Cell culture supernatants were harvested at

day

3, 5 and 7 of transfection. The collected supernatants were mixed, added with 8% final concentration of polyethylene glycol 8000(PEG8000), mixed well, left overnight at 4 ℃ and then centrifuged at 5000g for 30 minutes to remove the supernatant, and the precipitate was dissolved with the original volume of 1/50 fresh medium (concentrated 50 times).

Real-time fluorescent quantitative pcr (qpcr) assay of HBV DNA amount in transfection supernatant: an equal volume of concentrate (20% PEG8000, 4.6% NaCl) was added to 500. mu.L of the supernatant, mixed well and left overnight at 4 ℃. 12000g,4 ℃ centrifugation for 10min, supernatant removal, 1 XDnase I buffer (40mM Tris-HCl [ pH 7.5],8mM MgCl2, 5mM DTT) resuspension of the pellet, 70U DNase I (Takara, Dalian)37 ℃ water bath for 8h to remove transfected free plasmid. After the treatment, the reaction was stopped by adding an equal volume of stopping buffer (20mM Tris-HCl [ pH 8.0],50 mM EDTA,200mM NaCl, 1% SDS), adding proteinase K to a final concentration of 0.5mg/mL, treating overnight at 37 ℃ and finally extracting HBV DNA by phenol chloroform method. The extracted HBV DNA was quantified using real-time fluorescent quantitative pcr (qpcr).

In vitro viral infection experiments: taking equal amount of HBV DNATransfection of supernatant suspension infection 1.5X 10⁵After infection of HepG2-NTCP cells (MOI 2000) for 24h, the infected supernatant was discarded, washed several times with 1 × PBS, unbound virus was removed, and cultured by adding cell culture medium containing 2% DMSO. Supernatants were harvested every two days and culture was continued by adding fresh 2% DMSO medium until day 9 post infection. Infected cells were harvested, total Genomic DNA within the cells was extracted using the tiamamp Genomic DNA Kit, and cccDNA levels were determined.

Determination of cccDNA in infected cells: 250ng of the extracted DNA was removed and treated with 5-10U T5 exonuclease (NEB) for 1h at 37 ℃ to remove single stranded and relaxed circular HBV DNA. cccDNA was then detected using qPCR, primers: ccc-1582F: 5'-tgcacttcgcttcacct-3' (SEQ ID No. 18); ccc-2316R: 5'-aggggcatttggtggtc-3' (SEQ ID No. 19). Simultaneously determining an internal reference gene PRNP in the cell, and determining a primer: 5'-ctctgctcctcctgttcgac-3' (SEQ ID No. 20); 5'-ttaaaagcagccctggtgac-3' (SEQ ID No. 21). The reaction conditions are as follows: 30s at 95 ℃, 15s at 62 ℃ and 45s at 72 ℃ for 40 cycles.

20 strains of HBV, type B and type C, were co-screened, and as shown in FIG. 2, the strain C-3 was the most infectious.

Example 4

This example illustrates the comparison of the infectivity of the D-type strain with the C-3 strain in the cell lines HepG2.2.15 and HepAD 38.

The amount of HBV DNA in the harvested supernatant was measured using qPCR, and then HepG2-NTCP cells (MOI 5000) were infected with two kinds of viral particles of equal amount of HBV DNA, in the same manner as above. 7 days after infection, HBV surface antigen (HBsAg) secreted by infected cells was detected using ELISA kit for hepatitis B surface antigen (Beijing Wantai biopharmaceutical industry), and cccDNA in infected cells was simultaneously detected as described above.

As shown in FIG. 3, the infectivity of the virus strain C-3 was about 5 times higher than that of the D-type virus strains in the cell lines HepG2.2.15 and HepAD 38.

Example 5

This example illustrates the use of culture supernatants directly from C-3 virus strains for in vitro cell infection experiments.

Obtaining infectious viral particles:inoculation of 1X 10⁶One HepG2 cell into each well of the six-well plate. After 24 hours, 2 μ g C-3 strain expression vectors were transfected into cells using 4 μ L Lipofectamine3000 transfection reagent per well. After 24 hours of transfection, the cells were changed and then the culture was continued, with the cell culture medium being changed every two days. Cell culture supernatants were harvested at

day

3, 5 and 7 of transfection. The collected supernatants were mixed and 50. mu.L, 100. mu.L and 200. mu.L of the mixture were used to infect HepG2-NTCP cells, as described above. 7 days after infection, HBsAg secreted by infected cells was detected using ELISA detection kit for hepatitis B surface antigen (Beijing Wantai biopharmaceutical). The results show that culture supernatants of the C-3 strain can be used directly to efficiently infect cells (FIG. 4).

Example 6

This example illustrates the response of C-3 virus strains to drugs targeting the early stages of HBV infection.

The 24-well plate was infected with 1.5X 10 virus strain culture supernatant by adding 200. mu. L C-3 virus strain per well⁵HepG2-NTCP cells (MOI 500), HBV immunoglobulin (HBIG) and HBV entry inhibitor Myr-59 with different concentrations are added at the same time for treatment, HBsAg secreted by infected cells is detected by using a hepatitis B surface antigen ELISA detection kit (Beijing Wantai biopharmaceutical industry) 7 days after infection, cccDNA in the infected cells is simultaneously detected, and the detection method is the same as the above. As expected, both HBV immunoglobulin (HBIG) and the HBV entry inhibitor Myr-59 can inhibit C-3 strain infection concentration-dependently (FIG. 5), indicating that C-3 strain can be used for screening for developing and evaluating drugs targeting the early infection stage of HBV.

The high-infectivity C-type HBV virus strain C-3 is obtained by screening, and the cell culture supernatant can be directly used for in vitro infection experiments without concentration, so that the virus preparation process is simple and convenient; compared with the D-type virus strains in the cell lines HepG2.2.15 and HepAD38 which are mainly used at present, the gene sequence of the strain is more similar to the virus strains which are mainly popular in China, and the replication capacity is improved by about 5 times, so that the virus culture supernatant required for reaching the same infection efficiency is reduced by about 80 percent, and the cost for preparing virus particles is greatly reduced.

The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments, and all technical solutions belonging to the idea of the present invention belong to the protection scope of the present invention, it should be noted that, for those skilled in the art, several modifications and decorations without departing from the principle of the present invention should be regarded as the protection scope of the present invention.

Sequence listing

<110> Nanjing drum building hospital

<120> a highly infectious hepatitis B virus C strain and uses thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3197

<212> DNA

<213> Hepatitis B Virus (Hepatitis B virus)

<400> 1

ctccacaaca ttccaccaag ctctgctaga tcccagagtg aggggcctat attttcctgc 60

tggtggctcc agttccggaa caataaaccc tgttccgact actgcctctc ccacatcgtc 120

aatcttctcg aggactgggg accctgcacc gaacatggag aacacaacat caggattcct 180

aggacccctg ctcgtgttac aggcggggtt tttcttgttg acaagaatcc tcacaatacc 240

acagagtcta gactcgtggt ggacttctct caattttcta gggggagcac ccacgtgtcc 300

tggccaaaat tcgcagtccc caacctccaa tcactcacca acctcttgtc ctccaatttg 360

tcctggctat cgctggatgt gtctgcggcg ttttatcata ttcctcttca tcctgctgct 420

atgcctcatc ttcttgttgg ttcttctgga ctaccaaggt atgttgcccg tttgtcctct 480

acttccagga acatcaacta ccagcacggg accatgcaag acctgcacaa ttcctgctca 540

aggaacctct atgtttccct cttgttgctg tacaaaacct tcggacggaa actgcacttg 600

tattcccatc ccatcatcct gggctttcgc aagattccta tgggagtggg cctcagtccg 660

tttctcctgg ctcagtttac tagtgccatt tgttcagtgg ttcgtagggc tttcccccac 720

tgtttggctt tcagttatat ggatgatgtg gtattggggg ccaagtctgt acaacatctt 780

gagtcccttt ttacctctgt taccaatttt cttttgtctt tgggtataca tttgaaccct 840

aataaaacca aacgctgggg ctacaccctt aacttcatgg gatatgtaat tggaagttgg 900

ggtactttac cgcaggaaca tattgtacaa aaactcaagc aatgttttcg aaaattgcct 960

gtaaatagac ctattgattg gaaagtatgt caacgaattg tgggtctttt gggctttgct 1020

gcccctttta cacaatgtgg ctatcctgct ttgatgcctt tatatgcatg tatacagtct 1080

aagcaggctt tcactttctc gccaacttac aaggcctttc tgtgtaaaca atatctgaac 1140

ctttaccccg ttgcccggca acggtcaggt ctctgccaag tgtttgctga cgcaaccccc 1200

actggatggg gcttggccat aggccatcag cgcatgcgtg gaacctttgt ggctcctctg 1260

ccgatccata ctgcggaact cctagctgct tgttttgctc gcagccggtc tggagcgaaa 1320

cttatcggaa ccgacaactc tgttgtcctc tctcggaaat acacctcctt tccatggctg 1380

ctagggtgtg ctgccaactg gatcctgcgc gggacgtcct ttgtctacgt cccgtcggcg 1440

ctgaatcccg cggacgatcc gtctcggggc cgtttgggac tctaccgtcc ccttcttcat 1500

ctgccgttcc ggccgaccac ggggcgcacc tctctttacg cggtctcccc gtctgtgcct 1560

tctcatctgc cggaccgtgt gcacttcgct tcacctctgc acgtcgcatg gagaccaccg 1620

tgaacgccca ccaggtcttg cccaaggtct tacataagag gactcttgga ctctcagcaa 1680

tgtcaacgac cgaccttgag gcatacttca aagactgtgt gtttaaagac tgggaggagt 1740

tgggggagga gattaggtta aaggtctttg tactaggagg ctgtaggcat aaattggtct 1800

gttcaccagc accatgcaac tttttcacct ctgcctaatc atctcatgtt catgtcctac 1860

tgttcaagcc tccaagctgt gccttgggtg gctttggggc atggacattg acccatataa 1920

agaatttgga gcttctgtgg agttactctc ttttttgcct tctgacttct ttccttctat 1980

tcgagatctc ctcgacaccg cctcagctct atatcgggag gccttagagt ctccggaaca 2040

ttgttcacct caccatacag cactcaggca agccattctg tgttggggtg agttgatgaa 2100

tctggccacc tgggtgggaa gtaatttgga agacccagca tcccgggaat tagtagtcag 2160

ctatgtcaat gttaatatgg gcctaaaaat cagacaacta ttgtggtttc acatttcctg 2220

tcttactttt ggaagagaaa ctgttcttga gtacttggtg tcttttggag tgtggattcg 2280

cactcctccc gcttacagac caccaaatgc ccctatctta tcaacacttc cggaaactac 2340

tgttgttaga cgacgaggca ggtcccctag aagaagaact ccctcgcctc gcagacgaag 2400

gtctcaatcg ccgcgtcgca gaagatctca atctcgggaa tctcaatgtt agtatccctt 2460

ggactcataa ggtgggaaac tttactgggc tttattcttc tactgtacct gtctttaatc 2520

ctgaatggca aactccctcc tttcctcaca ttcatttaca ggaggacatt attgatagat 2580

gtcaacaata tgtgggccct cttacagtta atgaaaaaag aagattaaaa ttaattatgc 2640

ctgctaggtt ctatcctaac cttaccaaat atttgccctt ggacaaaggc attaaaccgt 2700

attatcccga aaatgcagtt aatcattact tcaaaactag gcattattta catactctgt 2760

ggaaggctgg cattctatat aagagagaaa ctacacgcag cgcctcattt tgtgggtcac 2820

catattcttg ggaacaagag ctacagcaaa cctcgacaag gcatggggac gaatctttct 2880

gttcccaatc ctctgggatt ctttcccgat caccagttgg accctgcgtt cggagccaac 2940

tcaaacaatc cagattggga cttcaacccc aacaaggatc actggccaga ggcaaatcag 3000

gtaggagtgg gagcattcgg gccagggttc acccccccac acggtggtct tttggggtgg 3060

agccctcagg ctcagggcat agtgacaaca gtgccagcag cacctcctcc tgcctctacc 3120

aatcggcagt cagggagaca gcctactccc atctctccac ctctaagaga cagtcatcct 3180

caggccatgc agtggaa 3197

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tttttcacct ctgcctaatc a 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaaagttgc atggtgctgg 20

<210> 4

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctatataag cgtcgagcac cagcaccatg caactt 36

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccaccacgag tctagactct gt 22

<210> 6

<211> 1656

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caccagcacc atgcaacttt ttcacctctg cctaatcatc tcatgttcat gtcctactgt 60

tcaagcctcc aagctgtgcc ttgggtggct ttggggcatg gacattgacc catataaaga 120

atttggagct tctgtggagt tactctcttt tttgccttct gacttctttc cttctattcg 180

agatctcctc gacaccgcct cagctctata tcgggaggcc ttagagtctc cggaacattg 240

ttcacctcac catacagcac tcaggcaagc cattctgtgt tggggtgagt tgatgaatct 300

ggccacctgg gtgggaagta atttggaaga cccagcatcc cgggaattag tagtcagcta 360

tgtcaatgtt aatatgggcc taaaaatcag acaactattg tggtttcaca tttcctgtct 420

tacttttgga agagaaactg ttcttgagta cttggtgtct tttggagtgt ggattcgcac 480

tcctcccgct tacagaccac caaatgcccc tatcttatca acacttccgg aaactactgt 540

tgttagacga cgaggcaggt cccctagaag aagaactccc tcgcctcgca gacgaaggtc 600

tcaatcgccg cgtcgcagaa gatctcaatc tcgggaatct caatgttagt atcccttgga 660

ctcataaggt gggaaacttt actgggcttt attcttctac tgtacctgtc tttaatcctg 720

aatggcaaac tccctccttt cctcacattc atttacagga ggacattatt gatagatgtc 780

aacaatatgt gggccctctt acagttaatg aaaaaagaag attaaaatta attatgcctg 840

ctaggttcta tcctaacctt accaaatatt tgcccttgga caaaggcatt aaaccgtatt 900

atcccgaaaa tgcagttaat cattacttca aaactaggca ttatttacat actctgtgga 960

aggctggcat tctatataag agagaaacta cacgcagcgc ctcattttgt gggtcaccat 1020

attcttggga acaagagcta cagcaaacct cgacaaggca tggggacgaa tctttctgtt 1080

cccaatcctc tgggattctt tcccgatcac cagttggacc ctgcgttcgg agccaactca 1140

aacaatccag attgggactt caaccccaac aaggatcact ggccagaggc aaatcaggta 1200

ggagtgggag cattcgggcc agggttcacc cccccacacg gtggtctttt ggggtggagc 1260

cctcaggctc agggcatagt gacaacagtg ccagcagcac ctcctcctgc ctctaccaat 1320

cggcagtcag ggagacagcc tactcccatc tctccacctc taagagacag tcatcctcag 1380

gccatgcagt ggaactccac aacattccac caagctctgc tagatcccag agtgaggggc 1440

ctatattttc ctgctggtgg ctccagttcc ggaacaataa accctgttcc gactactgcc 1500

tctcccacat cgtcaatctt ctcgaggact ggggaccctg caccgaacat ggagaacaca 1560

acatcaggat tcctaggacc cctgctcgtg ttacaggcgg ggtttttctt gttgacaaga 1620

atcctcacaa taccacagag tctagactcg tggtgg 1656

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtatgaaagc ttgttgacat tgattattga 30

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttgcatggtg ctggtgctcg acgcttatat agacctccca 40

<210> 9

<211> 615

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtatgaaagc ttgttgacat tgattattga ctagttatta atagtaatca attacggggt 60

cattagttca tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc 120

ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag 180

taacgccaat agggactttc cattgacgtc aatgggtgga gtatttacgg taaactgccc 240

acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg 300

gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc 360

agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca 420

atgggcgtgg atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca 480

atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg 540

ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcgtcgagc 600

accagcacca tgcaa 615

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtatgaaagc ttgttgacat tgattattga 30

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ccaccacgag tctagactct gt 22

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acagagtcta gactcgtggt gg 22

<210> 13

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agttgcggcc gctctcgaat agaaggaaag 30

<210> 14

<211> 1758

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

acagagtcta gactcgtggt ggacttctct caattttcta gggggagcac ccacgtgtcc 60

tggccaaaat tcgcagtccc caacctccaa tcactcacca acctcttgtc ctccaatttg 120

tcctggctat cgctggatgt gtctgcggcg ttttatcata ttcctcttca tcctgctgct 180

atgcctcatc ttcttgttgg ttcttctgga ctaccaaggt atgttgcccg tttgtcctct 240

acttccagga acatcaacta ccagcacggg accatgcaag acctgcacaa ttcctgctca 300

aggaacctct atgtttccct cttgttgctg tacaaaacct tcggacggaa actgcacttg 360

tattcccatc ccatcatcct gggctttcgc aagattccta tgggagtggg cctcagtccg 420

tttctcctgg ctcagtttac tagtgccatt tgttcagtgg ttcgtagggc tttcccccac 480

tgtttggctt tcagttatat ggatgatgtg gtattggggg ccaagtctgt acaacatctt 540

gagtcccttt ttacctctgt taccaatttt cttttgtctt tgggtataca tttgaaccct 600

aataaaacca aacgctgggg ctacaccctt aacttcatgg gatatgtaat tggaagttgg 660

ggtactttac cgcaggaaca tattgtacaa aaactcaagc aatgttttcg aaaattgcct 720

gtaaatagac ctattgattg gaaagtatgt caacgaattg tgggtctttt gggctttgct 780

gcccctttta cacaatgtgg ctatcctgct ttgatgcctt tatatgcatg tatacagtct 840

aagcaggctt tcactttctc gccaacttac aaggcctttc tgtgtaaaca atatctgaac 900

ctttaccccg ttgcccggca acggtcaggt ctctgccaag tgtttgctga cgcaaccccc 960

actggatggg gcttggccat aggccatcag cgcatgcgtg gaacctttgt ggctcctctg 1020

ccgatccata ctgcggaact cctagctgct tgttttgctc gcagccggtc tggagcgaaa 1080

cttatcggaa ccgacaactc tgttgtcctc tctcggaaat acacctcctt tccatggctg 1140

ctagggtgtg ctgccaactg gatcctgcgc gggacgtcct ttgtctacgt cccgtcggcg 1200

ctgaatcccg cggacgatcc gtctcggggc cgtttgggac tctaccgtcc ccttcttcat 1260

ctgccgttcc ggccgaccac ggggcgcacc tctctttacg cggtctcccc gtctgtgcct 1320

tctcatctgc cggaccgtgt gcacttcgct tcacctctgc acgtcgcatg gagaccaccg 1380

tgaacgccca ccaggtcttg cccaaggtct tacataagag gactcttgga ctctcagcaa 1440

tgtcaacgac cgaccttgag gcatacttca aagactgtgt gtttaaagac tgggaggagt 1500

tgggggagga gattaggtta aaggtctttg tactaggagg ctgtaggcat aaattggtct 1560

gttcaccagc accatgcaac tttttcacct ctgcctaatc atctcatgtt catgtcctac 1620

tgttcaagcc tccaagctgt gccttgggtg gctttggggc atggacattg acccatataa 1680

agaatttgga gcttctgtgg agttactctc ttttttgcct tctgacttct ttccttctat 1740

tcgagagcgg ccgcaact 1758

<210> 15

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctttccttct attcgagagc ggccgccagc ctcgactgtg ccttct 46

<210> 16

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

atcgatgata tcccatgggc ggccgtctca gaagccatag agccca 46

<210> 17

<211> 295

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ctttccttct attcgagagc ggccgccagc ctcgactgtg ccttcttagt tgccagccat 60

ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc 120

tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg 180

ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg 240

gggatgcggt gggctctatg gcttctgaga cggccgccca tgggatatca tcgat 295

<210> 18

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tgcacttcgc ttcacct 17

<210> 19

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

aggggcattt ggtggtc 17

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctctgctcct cctgttcgac 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ttaaaagcag ccctggtgac 20

Claims

1. A high-infectivity hepatitis B virus C-3 with a preservation number of CCTCC NO: m2021195.

2. The highly infectious strain of hepatitis B virus C-3 according to claim 1, having the genomic sequence shown in SEQ ID No. 1.

3. The use of the highly infectious strain of hepatitis C virus C-3 of claim 1 in vitro hepatitis B infection experiments.

4. Use of the highly infectious strain of hepatitis C virus C-3 according to claim 1 for the development and evaluation of a medicament targeting the early stages of infection with hepatitis b virus.