CN113088579A - Kit and method for qualitatively detecting yersinia sporogenes - Google Patents
Kit and method for qualitatively detecting yersinia sporogenes Download PDFInfo
- Publication number
- CN113088579A CN113088579A CN202110279354.4A CN202110279354A CN113088579A CN 113088579 A CN113088579 A CN 113088579A CN 202110279354 A CN202110279354 A CN 202110279354A CN 113088579 A CN113088579 A CN 113088579A
- Authority
- CN
- China
- Prior art keywords
- detection
- amplification
- rna
- kit
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit and a method for qualitatively detecting yersinia sporogenes. The qualitative detection kit for the pneumocystis yedoensis developed by utilizing the RNA isothermal amplification and CRISPR detection technology mainly comprises the following components: 1) an amplification buffer; 2) an amplification enzyme; 3) detecting a buffer solution; 4) detecting an enzyme; 5) mineral oil; 6) the quality control product is used for carrying out amplification detection on the ribonucleic acid (RNA) in a sample to be detected, has high sensitivity and strong specificity, and is suitable for viable bacteria detection. The method is simple to operate, has low temperature control requirement, can reduce the requirement on laboratory equipment, shortens the detection time, and is easy to realize automatic operation. Provides reference for the colonization and infection states of the detected samples, and has great clinical significance.
Description
Technical Field
The invention belongs to the technical field of detection of yersinia sporogenes, and particularly relates to a kit and a method for qualitatively detecting the yersinia sporogenes.
Background
Pneumocystis pneumonia (PCP), also known as yersinia Pneumocystis pneumonia (PJP), is caused by yersinia Pneumocystis (Pneumocystis jiirovicii), once named Pneumocystis carinii (pneumyces carinii), in immunocompromised persons, in particular HIV infected persons, hematopoietic stem cell transplantation (HCT) and solid organ transplant recipients, hematological malignancies, and patients receiving glucocorticoids, tumor chemotherapy drugs and other immunosuppressive drugs. After entering a human body through a respiratory tract, the medicine can be hidden in the trachea, the bronchus or the alveolar cavity for a long time to form asymptomatic recessive infection; when host immunity is reduced, p.jirovacii, which is latent or newly invaded, begins to multiply, produces a large amount of trophozoites and cysts, and rapidly spreads in lung tissue, causing severe PCP.
Since the first AIDS case was discovered in 1984, the incidence of PCP has been on a steep increase, and related data indicate that the disease is the most important complication and cause of death of AIDS patients. In addition, with the increase of tumor chemotherapy patients, organ transplant recipients receiving immunosuppressant treatment for a long time and patients with autoimmune diseases, the incidence rate of PCP of non-Human Immunodeficiency Virus (HIV) infected patients is obviously increased, and the fatality rate is as high as 30-50%. Probably 95% of the world population is infected within 2 years after birth, but healthy adults are asymptomatic carriers of p. In these different populations, symptoms and severity of disease depend not only on the underlying disease but also on the p.jiirovicii load, and early detection of carriers with low fungal load and infected patients is crucial.
At present, the domestic diagnosis of PCP mainly depends on the results of high-risk infection factors, clinical manifestations, pulmonary imaging and P.jiirovici etiology of patients. The respiratory tract specimen microscopic examination finds characteristic cysts and trophozoites as a diagnostic gold standard, but the PCP clinical expression lacks specificity, the traditional staining method for detecting the pneumocystis has higher technical requirements on inspectors and is complex to operate, and the PCP patients with non-HIV infection have less load of the pneumocystis in vivo and low clinical positive diagnosis rate, thereby restricting the improvement of the PCP etiology diagnosis rate. Diagnosis of PCP can be tricky due to a number of factors, such as nonspecific symptoms, coexistence of other infections, and difficulty in establishing a reliable culture system for the pathogen, such that current standard clinical trials lack high sensitivity and flexibility. Therefore, accurate diagnosis of PCP remains a serious challenge.
The molecular diagnostic technique uses nucleic acid in a specimen as a detection target, and has high specificity, high sensitivity, wide diagnostic range and strong adaptability, and is widely applied. A large number of researches indicate that the sensitivity and positive predictive value of fluorescent quantitative PCR (qPCR) on microbial detection are far higher than those of the traditional PCR, and meanwhile, the thallus colonization and infection load states can be preliminarily evaluated in a quantitative mode, so that the method is very important for determining whether anti-PCP treatment is carried out and formulating a scheme for the anti-PCP treatment. However, most of the fluorescent quantitative detection is to detect Deoxyribonucleoside (DNA) of P.jirovici, and the DNA has a double-stranded structure, is relatively stable and is not easy to degrade. After the cure, the 'dead bacteria' remains, and the complete metabolism in the human body needs 2-3 weeks, so that the 'dead bacteria detection is positive', the 'latent infection' and the 'active infection' cannot be distinguished, the cross contamination is easy to generate and the like in the process of using the DNA nucleic acid for molecular diagnosis, and the clinical relevance is poor. On the contrary, the RNA is in a single-stranded structure, is easy to degrade, is completely degraded after 2-3 days after the death of pathogens, has good clinical relevance, and is beneficial to the evaluation of curative effect and the timely judgment of healing. In some cases, a "live infection" can be diagnosed directly. And the product is easy to degrade, the pollution risk of a laboratory is reduced, and the quality control level of the laboratory is maintained.
In the patent, a method for qualitatively detecting the yersinia sporogenes is to perform specific amplification and enrichment on extracted target RNA by using an RNA isothermal amplification technology; then, the amplified target RNA is specifically identified through CRISPR nuclease, the activity of the RNA enzyme is obtained, and a fluorescent substrate is cut to separate a fluorescent group from a fluorescence quenching group, so that a fluorescent signal is generated; and finally, reading the fluorescence value by a nucleic acid amplification analyzer, and analyzing and judging the detection result according to the strength of the fluorescence signal.
Disclosure of Invention
The invention provides a kit and a method for qualitatively detecting yersinia sporogenes based on RNA isothermal amplification and CRISPR detection. Compared with the existing fluorescent quantitative PCR, the kit does not need a precise fluorescent quantitative PCR instrument, the amplified detection product is RNA, pollution is not easy to generate, the specificity is good, and the qualitative detection of P.jirovacii can be realized. Provides a rapid, convenient and high-sensitivity method for P.jirovacii nucleic acid detection, and has great guiding significance for the clinical diagnosis of PCP.
A first object of the invention is to provide a kit for the qualitative detection of sporotrichum yersiniae, characterized in that it comprises:
(1) amplification buffer: comprises a pair of specific amplification primers (an upstream amplification primer SEQ ID NO.1 and a downstream amplification primer SEQ ID NO.2), dNTP, NTP, ITP, DTT, dimethyl sulfoxide DMSO, magnesium chloride, potassium chloride, sorbitol and Bovine Serum Albumin (BSA) which are designed aiming at a P.jirovici mitochondrion large subunit; wherein the sequence of the upstream amplification primer SEQ ID NO.1 is TGCGAAAATTGTTTTGGCAA, and the sequence of the downstream amplification primer SEQ ID NO.2 is aattctaatacgactcactatagggagaTCTACCTTATCGCACATAGTCTGA;
(2) amplification enzyme: including reverse transcriptase AMV, T7 RNA polymerase and RNase H;
(3) detection buffer solution: comprises a specific detection probe (SEQ ID NO.3) designed aiming at the P.jirovici mitochondrion large subunit, a fluorescent report probe (SEQ ID NO.7), NTP, DTT, sodium chloride, magnesium chloride and the like; wherein the sequence of SEQ ID NO.3 is taatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacAATCTCAAAATAACTATTTCTTAAAATAA; SEQ ID NO.7 sequence FAM-/i2OMeA/AUGGC/i2OMeA/-BHQ 1;
(4) detecting enzyme: comprising Cas13a, T7 RNA polymerase and an rnase inhibitor;
(5) mineral oil;
(6) quality control product: comprises a positive quality control material and a negative quality control material.
Further, the specific detection probe SEQ ID No.3 generates crRNA after reaction of detection enzyme in detection buffer solution, can be combined with Cas13 protein and specifically recognizes a target RNA sequence, and the sequence of the crRNA (SEQ ID No.4) is gaUUUagacUaccccaaaaacgaaggggacUaaaacAA UCUCAAAAUAACUAUUUCUUAAAAUAA.
The fluorescent reporter probe is a single-stranded RNA sequence, the 5 'end of the fluorescent reporter probe is marked with a fluorescent group (FAM), and the 3' end of the fluorescent reporter probe is marked with a quenching group (BHQ 1).
The 5' end of the downstream amplification primer comprises a sequence SEQ ID NO.5 containing a T7 promoter, and the sequence is aattctaatacgactcactatagggaga.
The nucleic acid sequence SEQ ID NO.8 amplified by the kit has the sequence of TGCGAAAATTGTTTTGGCAAATTGTTTATTCCTCTAAAAAATAGTAGGTATAGCACTGAATATCTCGAGGGAGTATGAAAATATTTATCTCAGATATTTAATCTCAAAATAACTATTTCTTAAAATAAATAATCAGACTATGTGCGATAAGGTAGA.
The amplification product of the kit is RNA, and the sequence of the amplification product is shown as SEQ ID NO. 9: UCUACCUUAUCGCACAUAGUCUGAUUAUUUAUUUUAAGAAAUAGUUAUUUUGAGAUUAAAUAUCUGAGAUAAAUAUUUUCAUACUCCCUCGAGAUAUUCAGUGCUAUACCUACUAUUUUUUAGAGGAAUAAACAAUUUGCCAAAACAAUUUUCGCA are provided.
The specific detection probe comprises a T7 promoter sequence SEQ ID NO.6, is used for generating crRNA under the action of T7 RNA polymerase, and has a sequence of taatacgactcactataggg.
Further, the kit for qualitatively detecting the yersinia sporogenes specifically comprises the following components:
(1) amplification buffer: 10-100mM Tris-HCl pH7.5-pH8.5, amplification primer 0.1-2. mu.M, dNTP0.1-10mM, NTP 0.2-20mM, ITP 0.1-5mM, 1-10mM DTT, 0-25% (v/v) dimethyl sulfoxide (DMSO), 2-50mM magnesium chloride, 20-100mM potassium chloride, 0.01M-0.5M sorbitol, Bovine Serum Albumin (BSA) 0.1-100. mu.g/reaction;
(2) amplification enzyme: reverse transcriptase AMV 0.5-100U/reaction, T7 RNA polymerase 1-1000U/reaction, RNase H0.02-5U/reaction, 20-300mM Potasium Phosphonate, pH7.5, 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 20-100mM Tris-HC1(pH 7.5), 0.01-0.5mM EDTA, 20-200mM NaCl, 20-200mM KCl;
(3) detection buffer solution: 1ng-100ng of specific detection probe crDNA, 0.01-2 mu M of fluorescent report probe, 0.1-20mM NTP, 1-20mM DTT, 20-100mM sodium chloride, 1-50mM magnesium chloride, 0-50mM potassium chloride, 1-50mM magnesium chloride and 1% -25% (v/v) polyethylene glycol 4000;
(4) detecting enzyme: 1ng-10 mu g of Cas13a protein per reaction, 1-1000U of T7 RNA polymerase per reaction, 1-200U of RNase inhibitor per reaction, 20-100mM Tris-HC1(pH 7.5), 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 0.01-0.5mM EDTA, 20-600mM NaCl;
(5) mineral oil: 5-100 mu L of mineral oil per reaction;
(6) quality control product: the positive quality control product is RNA nucleic acid containing a P.jiirovaci-mtLSUrRNA gene detection segment and a human cell nucleic acid solution; the negative quality control product is extracted human source cell nucleic acid.
It is a second object of the present invention to provide a method for qualitative detection of pneumocystis yezoensis comprising the steps of:
(1) extracting RNA nucleic acid of a sample to be detected;
(2) preparing an RNA nucleic acid amplification system and a CRISPR detection system by using the extracted RNA as a template and the kit component according to claim 1, and using a positive quality control substance and a negative quality control substance as controls;
(3) and respectively carrying out RNA amplification and detection, carrying out result analysis according to the detected fluorescence signal value, and judging whether the P.jirovacii in the infection state exists in the sample.
Further, the amplification system in the step (2) is: 3.5. mu.l of amplification reaction solution and 1.5. mu.l of RNA template; the detection system in the step (2) is as follows: the reaction solution was measured in 45. mu.l.
The amplification procedure in the step (3) is 41 ℃ and 50 min; the detection procedure in the step (3) is 37 ℃ and 30 min.
The RNA template is RNA nucleic acid which is pre-denatured for 5min at 65 ℃.
The result analysis method in the step (3) comprises the following steps: the fluorescence detection curve is in an ascending trend, and the P.jiirovicii is judged to be positive when the fluorescence signal value of the 30min end point is higher than 4200; the fluorescence detection curve is horizontal, and the P.jiirovici is judged to be negative when the end-point fluorescence signal value of 30min is lower than 4000.
The invention relates to a kit and a method for qualitatively detecting yersinia sporogenes, wherein the target points are selected as follows:
(1) among the target genes that can be selected for detection of p.jiirovici in domestic and foreign studies are the intratranscriptional gap rRNA gene, 18SrRNA gene, 5SrRNA gene, mitochondrial large subunit rRNA gene (mtlsurrrna), dihydrofolate synthase (DHFS) gene, Major Surface Glycoprotein (MSG) gene, thymidylate synthase and the like of pneumocystis. The mtLSUrRNA gene, DHFS gene, and MSG gene are most commonly used for clinical diagnosis of PCP. And (3) quantitatively detecting P.jirovicii according to qPCR primers and probes designed according to the target gene, thereby judging the colonization and infection states of the patient.
(2) Mitochondrial DNA (mtDNA) exists in mitochondria of eukaryotic cells, and comprises genes encoding the size subunit rRNA in mitochondria and genes of some specific enzymes, etc., and is commonly used for detecting intraspecies variation and molecular phylogeny research, which is called as 'molecular clock'. Because of the high repeatability of the genome sequence, the sensitivity and the specificity of the PCR amplification detection of the pneumocystis by taking the target gene as the target gene are higher than those of other methods.
(3) And mitochondrial genome copy number is associated with the survival status of p.jiirovici (Pj), which increases in number to provide sufficient energy when Pj rapidly propagates, when Pj may be in a pathogenic state. When Pj is in a resting state, the number of mitochondria is maintained at a low level, and Pj is possibly in a colonizing state, so that the qPCR clinical application value taking mtLSUrRNA gene as a target gene is higher.
(4) In the research, mtLSUrrRNA gene is used as a target gene, the RNA nucleic acid is amplified and detected, and the colonization and infection states of a patient are judged in a qualitative mode.
The kit has the main advantages that:
(1) expensive and precise fluorescent quantitative PCR instruments are not needed;
(2) pollution is not easy to generate in the whole reaction process;
(3) the sensitivity is high;
(4) the specificity is high;
(5) the diagnosis of the fungal active infection is realized.
Drawings
FIG. 1 is a graph showing real-time fluorescence detection curves of negative and positive quality control materials;
FIG. 2 is a graph showing fluorescence signals of negative and positive quality control substances at 30 min;
FIG. 3 shows the results of the detection of the sensitivity of Coccidioides Yersinia at 2 x 103copies/ml, i.e. the minimum detection limit is 3 copies/reaction;
FIG. 4 shows the specific detection result of Coccidioides Yersini, which is highly specific and is a negative signal for common pathogens;
FIG. 5 shows the results of a partial clinical specimen test;
FIG. 6 shows the results of verification of specifically amplified RNA nucleic acids.
Detailed Description
The technical method provided by the present invention will be described and explained in detail with reference to the following specific embodiments and the accompanying drawings, wherein the embodiments are only a part of the embodiments of the present invention, and are not limited to all embodiments of the present invention. Reagent components used in the following examples are components of the kit of the present invention unless otherwise specified. Modifications and variations of this invention may occur to those skilled in the art, and such equivalent modifications are intended to fall within the scope of this invention as defined in the following claims.
Example 1:
the kit for qualitatively detecting the yersinia sporogenes specifically comprises the following components:
(1) amplification buffer: 10-100mM Tris-HCl pH7.5-pH8.5, amplification primer 0.1-2 μ M (SEQ ID NO.1, SEQ ID NO.2), dNTP0.1-10mM, NTP 0.2-20mM, ITP 0.1-5mM, 1-10mM DTT, 0-25% (v/v) dimethyl sulfoxide (DMSO), 2-50mM magnesium chloride, 20-100mM potassium chloride, 0.01M-0.5M sorbitol, Bovine Serum Albumin (BSA)0.1-100 μ g/reaction;
(2) amplification enzyme: reverse transcriptase AMV 0.5-100U/reaction, T7 RNA polymerase 1-1000U/reaction, RNase H0.02-5U/reaction, 20-300mM Potasium Phosphonate, pH7.5, 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 20-100mM Tris-HC1(pH 7.5), 0.01-0.5mM EDTA, 20-200mM NaCl, 20-200mM KCl;
(3) detection buffer solution: 1-1 ng-100ng of specific detection probe crDNA, 0.01-2 mu M of fluorescent report probe, 0.1-20mM NTP, 1-20mM DTT, 20-100mM sodium chloride, 1-50mM magnesium chloride, 0-50mM potassium chloride, 1-50mM magnesium chloride and 1-25% (v/v) polyethylene glycol 4000;
(4) detecting enzyme: 1ng-10 mu g of Cas13a protein per reaction, 1-1000U of T7 RNA polymerase per reaction, 1-200U of RNase inhibitor per reaction, 20-100mM Tris-HC1(pH 7.5), 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 0.01-0.5mM EDTA, 20-600mM NaCl;
(5) mineral oil: 5-100 mu L of mineral oil per reaction;
quality control product: the positive quality control product is RNA nucleic acid containing mtLSUrRNA gene detection fragments and a human cell nucleic acid solution; the negative quality control product is extracted human source cell nucleic acid.
Example 2: detection of negative and positive quality control materials
(1) Experimental Material
In vitro transcription kit used was HiScribet7 Quick High Yield RNA Synthesis kit (New England Biolabs); RNA Clean & concentrate-5 kit (Zymo research) was used as the RNA purification kit.
(2) Preparation of standards
Negative quality control product: the concentration of the extracted human source cell nucleic acid is 1-10 ng/mu L;
positive quality control product: an RNA product of mtLSUrRNA gene is obtained by an in vitro transcription kit of an artificially synthesized plasmid containing a T7 promoter sequence (SEQ ID NO.10) and a P.jirovacii mitochondrial large subunit target detection fragment (SEQ ID NO.11), and is purified by an RNA purification kit to obtain RNA nucleic acid containing the mtLSUrRNA gene detection fragment. Diluting the mixture to 1 fg/mu L (about 2 x 10) by using 1-10 ng/mu L of human cell nucleic acid according to a 10-fold ratio6copies/ml), namely a positive quality control product.
(3) Amplification and detection
a. According to the using instructions, the components in the kit are unfrozen at room temperature and mixed uniformly for standby.
b. And (3) amplification reaction: referring to the amount of each component in the following table, 4 parts of amplification reaction solution was prepared in a nuclease-free centrifuge tube; respectively sucking 3.5 mul of amplification reaction liquid, adding the amplification reaction liquid into a reaction tube 1, a reaction tube 2, a reaction tube 3 and a reaction tube 4, and then adding 8 mul of mineral oil into each reaction tube; placing the positive quality control material and the negative quality control material at 65 deg.C, pre-denaturing for 5min, then adding 1.5 μ L of the negative quality control material into the reaction tube 1 and the reaction tube 2, respectively, and adding 1.5 μ L of the positive quality control material into the reaction tube 3 and the reaction tube 4; after the instantaneous centrifugation, the reaction tube is placed in an isothermal amplification reaction device (such as a PCR instrument or a constant temperature metal bath) for reaction at 41 ℃ for 50 min.
c. Detection reaction: referring to the amount of each component in the following table, 4 parts of detection reaction solution was prepared in a nuclease-free centrifuge tube; respectively sucking 45 mu L of detection reaction liquid and adding the detection reaction liquid into the reaction tube 1, the reaction tube 2, the reaction tube 3 and the reaction tube 4 after the amplification is finished; after instantaneous centrifugation, the reaction tube is placed in a nucleic acid amplification analyzer for real-time detection. The nucleic acid amplification analyzer program was set up as follows: the fluorescence value is read once every 30s at 37 ℃, and the real-time detection is carried out for 30min (the fluorescence reading instrument of the kit is suitable for a nucleic acid amplification analysis instrument FMS-800M produced by Hangzhou Jiejieyi biotechnology limited).
(4) Result judgment
The fluorescence detection curve is in an ascending trend, and the P.jiirovicii is judged to be positive if the end-point fluorescence signal value of 30min is higher than 4200; the fluorescence detection curve is horizontal, and the P.jiirovici is judged to be negative if the end-point fluorescence signal value of 30min is lower than 4000.
(5) Analysis of results
As can be seen from fig. 1: the fluorescence detection curve of the positive quality control material is in an ascending trend, and the fluorescence detection curve of the negative quality control material is in a horizontal state.
As can be seen from fig. 2: the end point fluorescence signal value of the positive quality control product for 30min is higher than 4200; and the end point fluorescence signal value of the negative quality control product for 30min is lower than 4000.
Therefore, the detection and judgment method can correctly and quickly distinguish the negative quality control product from the positive quality control product.
Example 3: detection of sensitivity to pneumocystis yedoensis
(1) The preparation process of the standard substance in example 2 is continued, and 1-10 ng/. mu.L of human cell nucleic acid is used to sequentially dilute the RNA nucleic acid containing mtLSUrRNA gene detection fragment to obtain 10 ag/. mu.L (about 2. multidot.10)4copies/ml)、5ag/μL(1*104copies/ml), 1 ag/. mu.L (about 2. about.1)03copies/ml) and 0.1 ag/. mu.L (about 2. about.10)2copies/ml) of the RNA nucleic acid to be detected.
(2) The amplification assay was performed in 2 replicates per nucleic acid sample, as in the amplification and assay system and conditions of example 2.
(3) And (4) analyzing results: as shown in fig. 3, the negative quality control detection result is negative, and the positive quality control detection result is positive; higher than 1 ag/. mu.L (about 2. multidot.10)3copies/ml) was positive, whereas 0.1 ag/. mu.L (about 2X 10)2copies/ml) was negative. Thus, the sensitivity of the kit was 2 x 103copies/ml, i.e. the minimum detection limit is 3 copies/reaction.
Example 4: detection of specificity of Pneumocystis yeri
(1) The test was carried out with negative and positive quality control substances in the kit as controls and with nucleic acid samples of pathogens of common respiratory or pulmonary infections as specific interfering samples, including Bacillus cereus, Staphylococcus haemolyticus, Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, Mycobacterium tuberculosis, Haemophilus influenzae, Chlamydia psittaci, Neisseria meningitidis, Corynebacterium parvum, Corynebacterium striatum, Corynebacterium strictum, Stenotrophomonas maltophilia, Veillonella vpariella, Streptococcus pneumoniae type 1, Streptococcus pneumoniae, Staphylococcus albus, Pseudomonas aeruginosa, klebsiella pneumoniae klebsiella pneumoniae.
(2) The amplification and detection system and conditions were the same as in example 2, and 2 replicates were set for each of the above nucleic acid samples, and detection was performed after simultaneous amplification.
(3) And (4) analyzing results: as shown in fig. 4, the detection results of the remaining samples are negative except that the detection result of the positive quality control product is positive; therefore, the kit has high specificity, and does not generate cross signals in common pathogens of other respiratory tract or lung infections.
Example 5: detection of Yersinia pneumocystis clinical samples
(1) Alveolar lavage fluid of 10 clinically confirmed p.jirovacii patients was extracted with QIAamp Viral RNA Mini Kit from QIAGEN as a test nucleic acid sample. (2) The amplification and detection system and conditions were the same as in example 2, and 2 replicates were set for each nucleic acid sample to be detected, using the negative and positive quality controls in the kit as controls, and the detection was performed after the simultaneous amplification.
(3) And (4) analyzing results: as shown in FIG. 5, the test results of the samples were positive except that the test result of the negative quality control was negative, and the results were consistent with the results of clinical confirmation. The detection accuracy of the kit is high.
Example 6: detection of specific amplification of Pneumocystis yezoensis RNA nucleic acid validation
(1) Taking 1 case of RNA nucleic acid solution with positive P.jiirovici, evenly dividing into 3 equal parts, wherein one part is not treated (No treated), the other part is treated with RNase (RNase treated), and the other part is treated with DNase (DNase treated); and after the treatment is finished, purifying by using nucleic acid purification kits respectively to obtain nucleic acid samples to be detected.
(2) The amplification and detection system and conditions were the same as in example 2, and 2 replicates were set for each nucleic acid sample to be detected, using the negative and positive quality controls in the kit as controls, and the detection was performed after the simultaneous amplification.
(3) And (4) analyzing results: as shown in FIG. 6, the results of the detection of the positive quality control, the No treated nucleic acid solution and the DNase treated nucleic acid solution were all positive, while the results of the detection of the negative quality control and the RNase treated nucleic acid solution were all negative. As can be seen, the detection method of the kit amplifies only RNA nucleic acid and detects it. Thus, the RNA nucleic acid of P.jirovici in the sample can be specifically detected without being affected by the DNA nucleic acid.
Sequence listing
<110> Guangzhou medical university affiliated first hospital (Guangzhou respiratory center)
GUANGZHOU INSTITUTE OF RESPIRATORY HEALTH
Hangzhou Jieyi Biotechnology Co.,Ltd.
<120> a kit and method for qualitative detection of pneumocystis yeri
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Unknown (Unknown)
<400> 1
<210> 2
<211> 52
<212> DNA
<213> Unknown (Unknown)
<400> 2
aattctaata cgactcacta tagggagatc taccttatcg cacatagtct ga 52
<210> 3
<211> 85
<212> DNA
<213> Unknown (Unknown)
<400> 3
taatacgact cactataggg gatttagact accccaaaaa cgaaggggac taaaacaatc 60
tcaaaataac tatttcttaa aataa 85
<210> 4
<211> 50
<212> DNA
<213> Unknown (Unknown)
<400> 4
gaagacaccc caaaaacgaa ggggacaaaa caaccaaaaa acacaaaaaa 50
<210> 5
<211> 28
<212> DNA
<213> Unknown (Unknown)
<400> 5
aattctaata cgactcacta tagggaga 28
<210> 6
<211> 20
<212> DNA
<213> Unknown (Unknown)
<400> 6
<210> 7
<211> 4
<212> DNA
<213> Unknown (Unknown)
<400> 7
aggc 4
<210> 8
<211> 156
<212> DNA
<213> Unknown (Unknown)
<400> 8
tgcgaaaatt gttttggcaa attgtttatt cctctaaaaa atagtaggta tagcactgaa 60
tatctcgagg gagtatgaaa atatttatct cagatattta atctcaaaat aactatttct 120
taaaataaat aatcagacta tgtgcgataa ggtaga 156
<210> 9
<211> 96
<212> DNA
<213> Unknown (Unknown)
<400> 9
caccacgcac aagcgaaaaa gaaaagagag aaaaacgaga aaaacaaccc ccgagaacag 60
gcaaccacaa gaggaaaaac aagccaaaac aacgca 96
<210> 10
<211> 19
<212> DNA
<213> Unknown (Unknown)
<400> 10
aatacgactc actataggg 19
<210> 11
<211> 660
<212> DNA
<213> Unknown (Unknown)
<400> 11
taatgaagat gattctgaac agggatataa agtattgtgt attagacccg aaatctagtg 60
atcttactat gatcagacaa cttcaggtcg aactggtgta cgtcgcaaag tactcagaag 120
aattgtggta agtagtgaaa tacaaatcgg actaggatat agctggtttt ctgcgaaaat 180
tgttttggca aattgtttat tcctctaaaa aatagtaggt atagcactga atatctcgag 240
ggagtatgaa aatatttatc tcagatattt aatctcaaaa taactatttc ttaaaataaa 300
taatcagact atgtgcgata aggtagatag tcgaaaggga aacagcccag aacagtaatt 360
aaagctcccc aattaatatt aagtgaaata aaagttgttg gatatctaaa acagttaaga 420
agtgggcttg gaaacagcca tcttttaaag aacacgtaaa agtgcaatga tctatgatct 480
ccagcgctga aaatatccgg atctaaatat tatgctgaaa gactgtttat ttttctttta 540
attaactgta atttaattaa aaaaaataag gtagcagaac atttagtaaa tgtgtgaaga 600
atagtatttt attattcgga cataactaaa gagagaatgc tgacatgagt aacgttaaaa 660
Claims (10)
1. A kit for the qualitative detection of sporozoite of yersinia, said kit comprising:
(1) amplification buffer: comprises a pair of specific amplification primers (an upstream amplification primer SEQ ID NO.1 and a downstream amplification primer SEQ ID NO.2), dNTP, NTP, ITP, DTT, dimethyl sulfoxide DMSO, magnesium chloride, potassium chloride, sorbitol and Bovine Serum Albumin (BSA) which are designed aiming at a P.jirovici mitochondrion large subunit; wherein the sequence of the upstream amplification primer SEQ ID NO.1 is TGCGAAAATTGTTTTGGCAA, and the sequence of the downstream amplification primer SEQ ID NO.2 is aattctaatacgactcactatagggagaTCTACCTTATCGCACATAGTCTGA;
(2) amplification enzyme: including reverse transcriptase AMV, T7 RNA polymerase and RNase H;
(3) detection buffer solution: comprises a specific detection probe (SEQ ID NO.3) designed aiming at the P.jirovici mitochondrion large subunit, a fluorescent report probe (SEQ ID NO.7), NTP, DTT, sodium chloride, magnesium chloride and the like; wherein the sequence of SEQ ID NO.3 is taatacgactcactataggggatttagactaccccaaaaacgaaggggactaaaacAATCTCAAAATAACTATTTCTTAAAATAA; SEQ ID NO.7 sequence FAM-/i2OMeA/AUGGC/i2OMeA/-BHQ 1;
(4) detecting enzyme: comprising Cas13a, T7 RNA polymerase and an rnase inhibitor;
(5) mineral oil;
(6) quality control product: comprises a positive quality control material and a negative quality control material.
2. The kit of claim 1, wherein the specific detection probe SEQ ID No.3 generates crRNA after reaction of detection enzyme in detection buffer, can bind with Cas13 protein and specifically recognizes a target RNA sequence, and the sequence of the crRNA (SEQ ID No.4) is gaUUUagacUaccccaaaaacgaaggggacUaaaacAAUCUCAAAAUAACUAUUUCUUAAAAUAA.
3. The kit of claim 1, wherein the fluorescent reporter probe is a single-stranded RNA sequence, and the 5 'end of the single-stranded RNA sequence is labeled with a Fluorophore (FAM) and the 3' end of the single-stranded RNA sequence is labeled with a quencher (BHQ 1).
4. The kit of claim 1, wherein the 5' end of the downstream amplification primer comprises a sequence SEQ ID NO.5 containing a T7 promoter, and the sequence is aattctaatacgactcactatagggaga.
5. The kit of claim 1, wherein the specific detection probe comprises a T7 promoter sequence SEQ ID NO.6, which is used for generating crRNA under the action of T7 RNA polymerase, and the sequence is taatacgactcactataggg.
6. The kit according to claim 1, wherein the specific reagents comprise:
(1) amplification buffer: 10-100mM Tris-HCl pH7.5-pH8.5, amplification primer 0.1-2. mu.M, dNTP0.1-10mM, NTP 0.2-20mM, ITP 0.1-5mM, 1-10mM DTT, 0-25% (v/v) dimethyl sulfoxide (DMSO), 2-50mM magnesium chloride, 20-100mM potassium chloride, 0.01M-0.5M sorbitol, Bovine Serum Albumin (BSA) 0.1-100. mu.g/reaction;
(2) amplification enzyme: reverse transcriptase AMV 0.5-100U/reaction, T7 RNA polymerase 1-1000U/reaction, RNase H0.02-5U/reaction, 20-300mM Potasium Phosphonate, pH7.5, 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 20-100mM Tris-HC1(pH 7.5), 0.01-0.5mM EDTA, 20-200mM NaCl, 20-200mM KCl;
(3) detection buffer solution: 1ng-100ng of specific detection probe crDNA, 0.01-2 mu M of fluorescent report probe, 0.1-20mM NTP, 1-20mM DTT, 20-100mM sodium chloride, 1-50mM magnesium chloride, 0-50mM potassium chloride, 1-50mM magnesium chloride and 1% -25% (v/v) polyethylene glycol 4000;
(4) detecting enzyme: 1ng-10 mu g of Cas13a protein per reaction, 1-1000U of T7 RNA polymerase per reaction, 1-200U of RNase inhibitor per reaction, 20-100mM Tris-HC1(pH 7.5), 1-10mM Dithioreitol (DTT), 20-50% (v/v) glycerol, 0.01% -1% Triton X-100, 0.01-0.5mM EDTA, 20-600mM NaCl;
(5) mineral oil: 5-100 mu L of mineral oil per reaction;
(6) quality control product: the positive quality control product is RNA nucleic acid containing a P.jiirovaci-mtLSUrRNA gene detection segment and a human cell nucleic acid solution; the negative quality control product is extracted human source cell nucleic acid.
7. A method for the qualitative detection of sporozoite of yersinia comprising the steps of:
(1) extracting RNA nucleic acid of a sample to be detected;
(2) preparing an RNA nucleic acid amplification system and a CRISPR detection system by using the extracted RNA as a template and the kit component according to claim 1, and using a positive quality control substance and a negative quality control substance as controls;
(3) and respectively carrying out RNA amplification and detection, carrying out result analysis according to the detected fluorescence signal value, and judging whether the P.jirovacii in the infection state exists in the sample.
8. The method of claim 7, wherein the amplification procedure of step (3) is 41 ℃, 50 min; the detection procedure in the step (3) is 37 ℃ and 30 min.
9. The method of claim 7, wherein the RNA template is RNA nucleic acid pre-denatured at 65 ℃ for 5 min.
10. The method of claim 7, wherein the result analysis method of step (3) is: the fluorescence detection curve is in an ascending trend, and the P.jiirovicii is judged to be positive when the fluorescence signal value of the 30min end point is higher than 4200; the fluorescence detection curve is horizontal, and the P.jiirovici is judged to be negative when the end-point fluorescence signal value of 30min is lower than 4000.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110279354.4A CN113088579B (en) | 2021-03-16 | 2021-03-16 | Kit and method for qualitatively detecting yersinia sporogenes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110279354.4A CN113088579B (en) | 2021-03-16 | 2021-03-16 | Kit and method for qualitatively detecting yersinia sporogenes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113088579A true CN113088579A (en) | 2021-07-09 |
| CN113088579B CN113088579B (en) | 2022-03-22 |
Family
ID=76668114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110279354.4A Active CN113088579B (en) | 2021-03-16 | 2021-03-16 | Kit and method for qualitatively detecting yersinia sporogenes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113088579B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458196A (en) * | 2020-12-11 | 2021-03-09 | 吉林大学 | Primer group and kit for quantitative detection of yersinia sporogenes and application of primer group and kit |
| CN113718053A (en) * | 2021-09-30 | 2021-11-30 | 北京大学第一医院 | Probe and primer pair for detecting yersinia sporogenes, detection method and application |
| CN113943823A (en) * | 2021-10-22 | 2022-01-18 | 杭州杰毅生物技术有限公司 | Mycobacterium tuberculosis nucleic acid detection kit for detecting CRISPR (clustered regularly interspaced short palindromic repeats) by utilizing RNA (ribonucleic acid) isothermal amplification |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107636172A (en) * | 2015-04-15 | 2018-01-26 | 巴斯德研究所 | For diagnosing, predicting or monitoring the instrument of pneumocystis pneumonia |
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
-
2021
- 2021-03-16 CN CN202110279354.4A patent/CN113088579B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107636172A (en) * | 2015-04-15 | 2018-01-26 | 巴斯德研究所 | For diagnosing, predicting or monitoring the instrument of pneumocystis pneumonia |
| CN110506128A (en) * | 2016-12-09 | 2019-11-26 | 博德研究所 | Diagnosis based on CRISPR effect system |
Non-Patent Citations (2)
| Title |
|---|
| WANG XINJIE等: "Next-generation pathogen diagnosis with CRISPR/Cas-based detection", 《EMERGING MICROBES & INFECTIONS》 * |
| 任珊珊等: "脑瘤手术患者咽喉部吸取液中耶氏肺孢子菌的筛查", 《中国病原生物学杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458196A (en) * | 2020-12-11 | 2021-03-09 | 吉林大学 | Primer group and kit for quantitative detection of yersinia sporogenes and application of primer group and kit |
| CN112458196B (en) * | 2020-12-11 | 2023-02-03 | 吉林大学 | Primer group and kit for quantitative detection of yersinia sporogenes and application of primer group and kit |
| CN113718053A (en) * | 2021-09-30 | 2021-11-30 | 北京大学第一医院 | Probe and primer pair for detecting yersinia sporogenes, detection method and application |
| CN113943823A (en) * | 2021-10-22 | 2022-01-18 | 杭州杰毅生物技术有限公司 | Mycobacterium tuberculosis nucleic acid detection kit for detecting CRISPR (clustered regularly interspaced short palindromic repeats) by utilizing RNA (ribonucleic acid) isothermal amplification |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113088579B (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Afzal | Molecular diagnostic technologies for COVID-19: Limitations and challenges | |
| CN113088579B (en) | Kit and method for qualitatively detecting yersinia sporogenes | |
| CN107636172B (en) | Tool for diagnosing, predicting or monitoring pneumocystis pneumonia | |
| CN111778357A (en) | CRISPR/Cas12 a-based respiratory syncytial virus nucleic acid rapid detection kit and detection method thereof | |
| CN109487008B (en) | Multiplex PCR detection kit for respiratory pathogens, application and use method thereof | |
| CN103642945B (en) | A kind of highly sensitive Epstein-Barr FLuorescent quantitative PCR kit containing internal reference | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| WO2021177372A1 (en) | METHOD FOR DETECTING CORONAVIRUS (SARS-CoV-2) | |
| TWI377255B (en) | Nucleic acid detection | |
| CN112680541B (en) | LNA-Taqman-multiplex fluorescence PCR technology and application thereof in rapid detection of candida | |
| CN116042927B (en) | CRISPR-Cas13 system for detecting novel coronaviruses, kit and method thereof | |
| WO2023207909A1 (en) | Crispr-based nucleic acid detection kit and use thereof | |
| CN111424101A (en) | Kit and method for quantitatively detecting yersinia sporogenes | |
| CN116121413A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for group B streptococcus and special primer and probe thereof | |
| CN113502341B (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for treponema pallidum 16s RNA and special primer and probe thereof | |
| CN111411169A (en) | Nucleic acid sequence, kit and method for detecting measles virus by isothermal amplification and application | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN111378724B (en) | RNA amplification detection method and detection kit | |
| CN111455094B (en) | Composition, kit, application and method for detecting deep infection fungi | |
| Hajia et al. | Is PCR assay reliable for diagnosis of extrapulmonary tuberculosis | |
| CN113512598A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for bordetella pertussis, and special primer and probe thereof | |
| CN112553378B (en) | Reagent and kit for detecting 2019-nCoV and application | |
| CN113151570B (en) | Loop-mediated isothermal amplification LAMP technology based on LNA modification and application of LAMP technology in rapid detection of candida | |
| CN110819724A (en) | Nucleic acid sequence for detecting mycobacterium tuberculosis complex, kit, detection method and application | |
| WO2022266946A1 (en) | Kit for detection of pathogen rna and animal or human gene rna, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |