CN113080114A

CN113080114A - Method for increasing survival rate of fish offspring

Info

Publication number: CN113080114A
Application number: CN202110388908.4A
Authority: CN
Inventors: 邵建忠; 项黎新; 纪剑飞; 胡崇彬; 范东东; 张楠
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-04-12
Filing date: 2021-04-12
Publication date: 2021-07-09

Abstract

The invention discloses a method for improving the survival rate of fish offspring, which is realized by inducing the expression of a mother fish specific antibody IgZ and transmitting the expression to the offspring. The method of the invention can avoid the large-scale death of early embryos caused by infection of a certain pathogen. Through epidemic investigation and analysis, the corresponding pathogen vaccine immunity is carried out on the female fish in advance, the generation of the specificity IgZ is induced and transmitted to offspring, and the resistance of the offspring is greatly improved. In addition, the method has low cost, convenient operation and obvious effect; the offspring with high immunity can be obtained only by immunizing the female fish with sexual maturity, so that the labor cost is saved, the intraperitoneal injection is adopted, the technical limitations of fish species specification and the like are avoided, and the method has wide application prospects in scientific research and production. The period is short, and the offspring with high IgZ titer can be obtained by immunizing the female fish 14 days before inducing the egg.

Description

Method for increasing survival rate of fish offspring

(I) technical field

The invention relates to the field of aquaculture biotechnology and aquaculture disease control, in particular to a method for improving the survival rate of fish offspring, which protects fish fries from being invaded by pathogens through fish novel immunoglobulin IgZ maternal transfer.

(II) background of the invention

With the rapid development and the continuous improvement of the intensification level of the aquaculture industry, various aquatic diseases such as bacterial infection, viral infection, parasitic infection and the like are increasingly prominent, which causes huge loss to the fishery industry and seriously restricts the healthy and sustainable development of the aquaculture industry. Due to the lack of an effective prevention and treatment method for a long time, various antibiotics and insecticides are widely used, so that the pollution of a large-area culture water environment is caused. This poses a great threat to the vast majority of oviparous fish, resulting in massive fry death with mortality rates of over 90%. The high mortality of embryos and fish larvae has long been a key problem that plagues the development of the fish farming industry. Therefore, the development of natural, safe and efficient aquatic animal disease control preparations and application techniques thereof is a very urgent task. The deep development of research on fish parent body transfer immunity is the key for fundamentally solving the survival rate of the fry. However, for a long time, research on the fish maternal transmission and the protective effect of the fish maternal transmission on offspring starts late and progresses slowly. Especially the knowledge about the influencing factors of the parent source transmission is far from enough.

IgZ were initially found in zebrafish and rainbow trout and later were confirmed to be present in a variety of bony fish species. Recent studies have shown that IgZ has a similar structure and function to mammalian IgA, expressed primarily in the gut, skin, gill and nasal mucus, and plays an important role in mucosal infection. However, it is not clear whether the fish has other biological functions, such as protection of early embryonic development of fish as a maternal factor.

Vaccine immunization is considered as the most effective prevention and control measure, but no specific pathogen carries the vaccine to generate at present, and the development of the technology is restricted due to the influences of high production cost, long production period and the like. The injection immunity is limited by the specification of fish species, operation technology and the like, and is difficult to popularize and apply in fishery production on a large scale.

The invention discloses that fish IgZ as a maternal transfer antibody plays a role in protecting the development of offspring for the first time, finds factors influencing the transfer of the fish IgZ and a mechanism for protecting the offspring, and realizes effective prevention and control of fish diseases. Functional mechanism research shows that specificity IgZ in fish early embryo can be obtained by immunizing specific antigen to female fish, and when pathogen invades, IgZ can coat pathogen by exerting neutralization effect to form a barrier to prevent pathogen invasion, so that fry with high immunity can be obtained, and fry survival rate can be improved. The invention not only enriches the knowledge of fish immunology, but also opens up a new way for the immune control of fish diseases, and has wide application prospect.

Disclosure of the invention

The invention aims to provide a method for improving the survival rate of fish offspring, which is realized by inducing the expression of a maternal fish specific antibody IgZ and transmitting the maternal fish specific antibody to offspring, so that the immunity of the fish offspring is improved, the survival rate of the offspring is improved, and fish diseases are prevented.

The technical scheme adopted by the invention is as follows:

the invention provides a method for improving the survival rate of offspring of fish, which is realized by inducing the expression of mother fish specific antibody IgZ and transmitting the mother fish specific antibody to offspring.

The invention adopts a vaccine preparation to induce the expression of specific antibody IgZ of the female fish, and the offspring can resist the invasion of specific antigen through maternal transmission, thereby playing a role in protection and improving the survival rate of the offspring, wherein the vaccine preparation comprises but is not limited to various pathogenic bacteria whole bacteria inactivated vaccines or virus inactivated vaccines, such as Edwardsiella tarda (E.t) inactivated vaccines or Vesicular Stomatitis Virus (VSV) inactivated vaccines, and can specifically induce the female fish to generate IgZ antibody aiming at E.t or VSV.

The Edwardsiella tarda (E.t) inactivated vaccine is prepared by incubating Edwardsiella tarda (E.t) in a metal bath at 98 ℃ for half an hour.

The Vesicular Stomatitis Virus (VSV) inactivated vaccine is prepared by incubating the VSV for half an hour at 98 ℃ in a metal bath.

Administration of the vaccine formulationThe method adopts an intraperitoneal injection mode, and the dosage of the E.t vaccine and the VSV vaccine is respectively 1 × 10⁵CFU/Tail, 1X 10⁷PFU/tail, produced efficacy within 14 days.

The present invention utilizes E.t vaccine and VSV vaccine to immunize mature female zebrafish. The change in specific antibody IgZ in the embryos was detected using an enzyme-linked immunosorbent assay (ELISA). Meanwhile, corresponding infection experiments are carried out on the offspring of different immunization groups, and the mortality is observed and analyzed. E.t vaccine and VSV vaccine were found to significantly boost the titer of antigen-specific antibody IgZ and peaked 14 days after immunization. Accordingly, infection experiment results show that the death rate of the offspring is also obviously reduced along with the increase of IgZ titer. The IgZ is proved to enhance the immunity of offspring, improve the resistance to pathogenic infection and protect the zebra fish in the early embryo development process.

Compared with the prior art, the method utilizes the characteristic of fish IgZ maternal source transmission, improves the survival rate of offspring by immunizing the female fish, and has the advantages that: (1) the method of the invention can avoid the large-scale death of early embryos caused by infection of a certain pathogen. Through epidemic investigation and analysis, the corresponding pathogen vaccine immunity is carried out on the female fish in advance, the generation of the specificity IgZ is induced and transmitted to offspring, and the resistance of the offspring is greatly improved. In addition, the method has low cost, convenient operation and obvious effect; the offspring with high immunity can be obtained only by immunizing the female fish with sexual maturity, so that the labor cost is saved, the intraperitoneal injection is adopted, the technical limitations of fish species specification and the like are avoided, and the method has wide application prospects in scientific research and production. (2) The period is short, and the offspring with high IgZ titer can be obtained by immunizing the female fish 14 days before inducing the egg.

(IV) description of the drawings

FIG. 1 shows the results of RT-PCR assays delivered by the antibody IgZ from the source. M: and (3) obtaining expected amplification bands by using a DNA Marker, wherein a lane 1 is an embryo sample, and lanes 2-4 are intestinal, skin and gill samples respectively.

FIG. 2 is a SDS-PAGE analysis of the maternally derived delivery of IgZ antibody; lane 1 is the embryonic protein sample,

lanes

2 and 3 are the intestinal and skin controls, respectively, and lane 4 is the zebrafish sperm sample as the negative control. The expected size is 53 KDa.

FIG. 3 is a graph of the results of testing maternal-derived delivery of antigen-specific IgZ that was induced by both the E.t vaccine and the VSV vaccine.

FIG. 4 is a graph of the survival rate of fish offspring immune protection by the maternal delivery of IgZ antibody.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

edwardsiella tarda (E.t) described in the examples of the present invention was purchased from Shanghai Reineckia Biotechnology Ltd, and was designated as ATCC 15947.

Vesicular Stomatitis Virus (VSV) is provided by the wuhan virus.

Example 1 identification of parent-derived delivery of fish IgZ antibody mRNA

RNA was extracted from zebrafish embryos according to the instructions of the Trizol kit (TaKaRa) and reverse transcribed into cDNA, which was used as a template, using forward primers F1: 5'-GTCTCACACAGAGGAAAAACA-3' and reverse primer R1: 5'-GATCACTGGATTTGCCCTCT-3' was subjected to PCR (see Table 1) amplification to obtain IgZ encoding nucleotide sequence (SEQ ID NO. 1). The PCR conditions were: pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 10min, 35 cycles, and identification of PCR products by 1.2% agarose gel electrophoresis, wherein the results show that IgZ bands identical to the expected bands are obtained by taking the PCR products corresponding to RNA extracted from intestines, skin and gills of zebra fish as positive controls (FIG. 1).

IgZ (SEQ ID NO.1) is as follows:

GTCTCACACAGAGGAAAAACATTTCATAAAACACAGAACTTTACAGCTAAATTCAGACTGATGCTGAAGCCACCAATGGTGAGAGAAATGTTCATCAATAACAGAATTGTCTTGCAAGCTGTTGTTTCTGGAGATTTGTCGACTGCAGTGAAAGAAGCTTCAGTGTCATGCAAAATGGACAATGTGCCTATAAATAGTGTGAGCCAGGAAAATGAGTCACAACACGTAAAAATTTATAATGTTCCAGTTGATACAACGAAATGGTTTAATGGTGGAAAAGTCACCTGTACCACCCGGGACACGCTTAATAACAAAGACATTAAGCAGGAGATCTATTTTAATAAAGGAGATGGACAGGAACCCAGTGTTAAAATGTACAAACCTGATGATATCAGCACAAAGCAAATCTCTTATGTGTGTGAAGTCTCCAGCCCTAACCTTGGTGATGTCTATATCATGTGGAAAGTGAACAATACGTTCACAGAGGGCAAATCCAGTGATC。

TABLE 1 PCR reaction System for IgZ amplification

Example 2 identification of parent-derived delivery of Fish IgZ antibody

1. IgZ preparation of rabbit antibody:

(1) prediction of antigenic epitopes. Firstly, adopting DNAman software and the like to analyze IgZ antibody protein (the nucleotide sequence of the coding gene is shown in SEQ ID NO.1) structure, then utilizing ABCPred software, Bepippred software and the like to predict the specific epitope of the extracellular section, and combining DNAstar software to evaluate the antigen index, surface accessibility, flexibility, hydrophilicity and the like. And predicting the three-dimensional structure by using SWISS-MODEL, and detecting whether the predicted epitope is exposed on the surface of the protein. Finally, the homologous sequences are compared in BLAST, and the specificity of the predicted sequences is detected. By combining the above indexes, the optimal polypeptide sequence (IgZ epitope polypeptide sequence: TKKQRYQSDIMC) is screened out and synthesized (national peptide biology corporation) to obtain TKKQRYQSDIMC.

(2) IgZ preparation of Rabbit polyclonal antibody. Male New Zealand rabbits (1.5 kg) were selected at 6 weeks of age and a small amount of negative serum was taken via the ear-margin vein prior to immunization. On day 1 of immunization, 1mg of the polypeptide (SEQ ID NO: TKKQRYQSDIMC) was mixed with the CFA complete adjuvant (Sigma) in equal volume, two 2mL syringes were connected by a rubber tube, and the adjuvant and the polypeptide were pushed and pulled back and forth until a "water-in-oil" state was formed. The rabbits were then immunized by back-multilamellar intradermal injection. On day 3, the above procedure was repeated. On day 28, booster immunizations were performed by emulsifying the polypeptide (polypeptide sequence: TKKQRYQSDIMC) in equal volumes with IFA incomplete adjuvant (Sigma) and injecting multiple intradermal injections. On day 35, 1mL of blood was first removed via the marginal ear vein, and the antibody titer was measured by ELISA after obtaining serum. If the requirement of the follow-up test is met, obtaining a large amount of antiserum by adopting a carotid artery blood taking method; if the titer is low, the immunization is boosted once again. On day 42, antibody titer is continuously detected, and a large amount of antiserum (namely IgZ rabbit antibody) can be collected after the experimental requirements (titer is more than or equal to 1:10000) are met.

2. Western blot detection

Collecting 50 embryos of zebra fish after spawning for 1h, washing with PBS for three times, adding 100 μ l of lysis buffer (Biyuntian, P0013), grinding with a grinding rod, and incubating on ice for half an hour. Centrifuging at 12000g for 10min at 4 deg.C, and collecting 100 μ l supernatant as embryo protein sample. 100 μ l of the embryonic protein sample was added to a 2 × loading buffer (Biyun, P0015B) of the same volume and boiled at 100 ℃ for 10min to serve as a western blot electrophoresis sample. Adding polyacrylamide gel (8% of concentrated gel and 12% of separation gel), adding electrophoresis sample, and performing electrophoresis (80V, 120V after 30min, 2h) to separate the target protein from other proteins. The gel was taken out, washed several times with pure water, and soaked in electrotransformation solution (biologies). A PVDF membrane of 8 cm. times.6 cm was immersed in methanol at room temperature for 30 seconds, washed with pure water, and then immersed in an electric transfer solution for 2 minutes. And taking a film rotating clamp, sequentially putting sponge, filter paper, polyacrylamide gel, a PVDF film, the filter paper and the sponge into the film rotating clamp, and then, carrying out 350mA constant current electric rotation for 1.5h in an electric rotating box after clamping the film rotating clamp. After the end, the PVDF membrane is taken out and put into TBST solution containing 5 percent of skimmed milk powder to be sealed for 2 hours or is placed at 4 ℃ for 12 hours. TBST solution containing 5% skimmed milk powder was used in a volume ratio of 1: the IgZ rabbit antibody (primary antibody) was diluted at a rate of 500, and the blocked PVDF membrane was placed in the diluted solution and incubated for 2 hours with shaking or 12 hours at 4 ℃. The primary antibody solution was discarded and the PVDF membrane was washed 3 times with TBST solution for 10min each. TBST solution containing 5% skimmed milk powder was used in a volume ratio of 1: goat anti-rabbit secondary antibody (biologies) conjugated with HRP was diluted at 5000 ratio, and PVDF membrane was put therein and incubated for 1h with shaking. The PVDF membrane was washed 3 times with TBST solution for 10min each. The target protein was developed and photographed by a chemiluminescence kit (thermolfisher, 32106).

Under the same conditions, when the embryo protein sample is replaced by the intestinal and gill protein sample, the positive control is obtained, and the fish sperm protein sample is the negative control, the result is shown in fig. 2, lane 1 is the embryo protein sample,

lanes

2 and 3 are the intestinal and gill protein samples, respectively, lane 4 is the fish sperm protein sample, the molecular weight is 53KDa, and the result indicates that IgZ antibody is detected in the embryo.

Example 3, E.t vaccine and VSV vaccine induce maternally-delivered antigen-specific IgZ expression

1. Reagent

E.t vaccine: edwardsiella tarda (E.t) cells were mixed in a volume ratio of 1:100 in TSB medium (sigma), and culturing at 28 deg.C for 8 hr to obtain bacterial liquid with concentration of 1 × 10⁸Centrifuging at 3000g for 5 min, removing supernatant, resuspending the precipitate with PBS, incubating at 98 deg.C for half an hour in metal bath to obtain E.t vaccine with thallus content of 1 × 10⁷CFU/mL。

VSV vaccine: into 110 cm dish, 5mL of DMEM (Thermofeisher) medium was added, 293 cells (Shangen organism) were seeded, and 1. mu.l (1X 10)¹⁰PFU) Vesicular Stomatitis Virus (VSV), culturing at 37 deg.C for 48 hr, centrifuging the culture solution at 10000g for 10min, collecting supernatant, incubating at 98 deg.C for half an hour in metal bath to obtain VSV vaccine with virus content of 1 × 10⁹PFU/ml。

PBS, pH7.2. PBST solution (8mM Na)₂HPO₄,0.136M NaCl,2mM KH₂PO₄,2.6mM KCl,0.05％Tween-20,pH 7.2)。

2. Grouping

Female zebrafish were set at 3 groups, 10 tails/group: 2 antigen experimental groups (E.t vaccine experimental group, VSV vaccine experimental group) and 1 PBS control group.

3. Embryonic protein samples

PBS control group, 10. mu.l PBS per fish. E.t vaccine experimental group each fish was injected with 10. mu.l of E.t vaccine at 1X 10⁵CFU/tail. VSV vaccine experimental groups were injected with 10. mu.l VSV vaccine, 1X 10⁷PFU/tail. The mother fish was induced to lay eggs, and embryo samples were collected for 1

hour

3, 7, 14, and 21 days after injection, 50 eggs were collected, 100. mu.l of the embryo protein sample was obtained according to the method of example 2, and the preparation was repeated for subsequent experiments.

4. IgZ for detecting antigen specificity by ELISA

The ELISA method is used for detecting the change of the antigen specificity IgZ in each embryo protein sample, and the specific method is as follows: the ELISA plate is divided into E.t vaccine experiment group, VSV vaccine experiment group and PBS control group, each group has 4 holes.

E.t group10 μ l/well of the solution was added⁶0.1mol/L NaHCO of CFU Strain E.t₃An aqueous solution; VSV group was added at 100. mu.l/well in an amount of 10⁸0.1mol/L NaHCO of PFU virus VSV₃In the aqueous solution, PBS was added to the PBS group at a concentration of 100. mu.l/well, and the mixture was left at 37 ℃ for 1 hour. The well solutions were discarded and each well was washed 4 times with purified water. Mu.l of PBST solution containing fetal Bovine Serum (BSA) at a concentration of 1% by volume was added to each well and allowed to stand at 37 ℃ for 1 hour. Each well was washed 3 times with PBST solution, and 100. mu.l of the embryo protein sample (1, 1/10, 1/100) which had been diluted with PBST solution was added thereto and allowed to stand at 37 ℃ for 1 hour. Each well was washed 3 times with PBST solution, and IgZ rabbit antibody (same as example 2) diluted with PBS at a volume ratio of 1:1000 was added to each well of E.t group and VSV group, and the mixture was left at 37 ℃ for 2 hours, while 100. mu.l IgG antibody (biologicals) was added to each well of PBS group and left at 37 ℃ for 2 hours. Each well was washed 3 times with PBST solution, and HRP-conjugated secondary goat anti-rabbit antibody (biologics) diluted with PBS at a volume ratio of 1:8000 was added in an amount of 100. mu.l, and allowed to stand at 37 ℃ for 1 hour. Each well was washed 3 times with PBST solution and 2 times with purified water, and 100. mu.l of freshly prepared TMB solution (Biyunyan, P0209) was added to each well and allowed to stand at 37 ℃ for 20 minutes to develop color. Finally 50. mu.l of 2M H were added to each well₂SO₄In aqueous solution, the OD value of each well was recorded using a microplate reader at a wavelength of 405. The results are shown in FIG. 3: the upregulation of antigen specificity IgZ peaked 14 days after immunization, suggesting that both the E.t vaccine and the VSV vaccine resulted in maternal antigen specificity IgZ delivery to progeny.

Example 4 analysis of the Effect of induced IgZ on the promotion of immune protection of early embryo

150 embryos of the PBS control group, the E.t vaccine experimental group and the VSV vaccine experimental group in step 3 of example 3 after immunizing the mother fish for 14 days were collected respectively, and each group was randomly divided into 3 parts and 50 parts per part and placed in a 10-CM culture dish containing 10mL of sterile water.

For 3 parts of E.t vaccine experimental group and 1 part of PBS control group, strain E.t was added to the two groups of culture dishes for virus challenge infection, and the concentration of the soaked infection was 1 × 10⁵CFU/ml. Observing every 24 hours for 8 days continuously, recordingThe number of dead embryos was recorded and the mortality was calculated. Mortality rate (number of deaths per group/total number of embryos per group) × 100%. The results are shown in fig. 4, and the non-immunized control group died completely on day 8 after E.t challenge; e.t the mortality rate in the vaccine group was 38. + -. 3.6%.

For 3 parts of VSV vaccine experimental group and 1 part of PBS control group, two groups of embryos are injected and infected, and virus VSV is injected into each embryo at 1 x 10³PFU, observed every 12 hours for 84 hours continuously, the number of dead embryos was recorded and the mortality was calculated. The results are shown in FIG. 4, the mortality rate of the non-immunized group at 84h after VSV infection was 92. + -. 2.5%, and the mortality rate of the VSV vaccine-immunized group was 80. + -. 1.6%.

The data show that E.t and VSV vaccine induce the maternal fish to generate antigen specificity IgZ and transfer the antigen specificity to the embryo, improve the embryo immunity and play a role in immune protection of early embryo.

In the invention, the maternally transferred IgZ can be regulated and controlled by manually injecting the vaccine, so that the immunity of the early embryo is enhanced, and the survival rate of the embryo is improved. The method of the invention can avoid the large-scale death of early embryos caused by infection of a certain pathogen. Through epidemic investigation and analysis, the corresponding pathogen vaccine immunity is carried out on the female fish in advance, the generation of the specificity IgZ is induced and transmitted to offspring, and the resistance of the offspring is greatly improved. In addition, the method is simple and convenient to operate, has obvious effect and has wide application prospect in scientific research and production. It should be noted that the above experiments are only illustrative of several specific examples of the present invention, and obviously, many modifications are possible in the present invention, and all modifications that can be derived or suggested by those skilled in the art from the disclosure of the present invention should be considered as the protection scope of the present invention.

Sequence listing

<110> Zhejiang university

<120> a method for improving survival rate of fish offspring

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 502

<212> DNA

<213> Unknown (Unknown)

<400> 1

gtctcacaca gaggaaaaac atttcataaa acacagaact ttacagctaa attcagactg 60

atgctgaagc caccaatggt gagagaaatg ttcatcaata acagaattgt cttgcaagct 120

gttgtttctg gagatttgtc gactgcagtg aaagaagctt cagtgtcatg caaaatggac 180

aatgtgccta taaatagtgt gagccaggaa aatgagtcac aacacgtaaa aatttataat 240

gttccagttg atacaacgaa atggtttaat ggtggaaaag tcacctgtac cacccgggac 300

acgcttaata acaaagacat taagcaggag atctatttta ataaaggaga tggacaggaa 360

cccagtgtta aaatgtacaa acctgatgat atcagcacaa agcaaatctc ttatgtgtgt 420

gaagtctcca gccctaacct tggtgatgtc tatatcatgt ggaaagtgaa caatacgttc 480

acagagggca aatccagtga tc 502

Claims

1. A method for increasing the survival rate of offspring of fish, which is realized by inducing the expression of mother fish specific antibody IgZ.

2. The method of claim 1, wherein said method comprises inducing maternal specific antibody IgZ expression using a vaccine formulation.

3. The method of claim 1, wherein the vaccine preparation comprises a whole bacterial killed vaccine, a virus killed vaccine.

4. The method of claim 1, wherein said vaccine preparation comprises an inactivated vaccine of Edwardsiella tarda or an inactivated vaccine of vesicular stomatitis virus.

5. The method according to claim 1, wherein the inactivated Edwardsiella tarda vaccine is prepared by incubating Edwardsiella tarda in a metal bath at 98 ℃ for half an hour.

6. The method according to claim 1, wherein the inactivated vaccine against vesicular stomatitis virus is prepared by incubating the vesicular stomatitis virus for half an hour in a metal bath at 98 ℃.

7. The method according to claim 1, wherein the inactivated vaccine against Edwardsiella tarda is used in an amount of 1X 10⁵CFU/tail.

8. The method of claim 1, wherein the inactivated vesicular stomatitis virus vaccine is administered in an amount of 1 x 10⁷PFU/tail.