CN113073131B - Hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid double-layer membrane - Google Patents
Hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid double-layer membrane Download PDFInfo
- Publication number
- CN113073131B CN113073131B CN202110338354.7A CN202110338354A CN113073131B CN 113073131 B CN113073131 B CN 113073131B CN 202110338354 A CN202110338354 A CN 202110338354A CN 113073131 B CN113073131 B CN 113073131B
- Authority
- CN
- China
- Prior art keywords
- dna
- target
- dna single
- silver
- single strand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6825—Nucleic acid detection involving sensors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/28—Electrolytic cell components
- G01N27/30—Electrodes, e.g. test electrodes; Half-cells
- G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
- G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
- G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/416—Systems
- G01N27/48—Systems using polarography, i.e. measuring changes in current under a slowly-varying voltage
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Electrochemistry (AREA)
- Pathology (AREA)
- Zoology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Nanotechnology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an electrochemical biosensor labeled by hepatocellular carcinoma nucleic acid based on nano-silver and anchored phospholipid bilayer membranes, which comprises the following parts: the gold electrode, the phospholipid bilayer coated on the gold electrode, and two complementary DNA single strands a and a1 positioned on the outer surface of the phospholipid bilayer; the silver nanoparticle is matched with a sensor for use, and a DNA single chain c is modified on the surface of the silver nanoparticle; when the target DNA exists, the target DNA and the DNA single strand c are respectively hybridized with the 3' end of the DNA single strand a to form a Y structure; the nucleic acid sequence of the target DNA is shown as SEQ ID NO. 1. The invention combines target marker detection and DNA self-assembly signal amplification strategy through reasonable design, improves accuracy and sensitivity, realizes detection of target tumor marker with extremely low concentration in serum, and is expected to provide basis for early diagnosis of hepatocellular carcinoma.
Description
Technical Field
The invention belongs to the technical field of bioelectrochemical sensors, and particularly discloses a hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on a nano-silver and anchored phospholipid double-layer membrane.
Background
The electrochemical technology is used as a traditional analysis means, is rapid, simple and convenient, has low price, has high sensitivity, wide detection range and low detection limit which are difficult to be compared with other technologies, and is very suitable for detecting low-concentration target objects. In recent years, with the development of technologies such as molecular assembly, interface modification, and molecular labeling, electrochemical technology is not only an important method for detecting inorganic and organic small molecules, but also a powerful tool for analyzing biological macromolecules. In recent years, scholars at home and abroad report a plurality of related research results, wherein the most important is a sensing method designed by taking an antibody or a nucleic acid aptamer as a recognition molecule. The antibody as a recognition molecule can form a stable complex with a target protein, and high specificity is achieved through molecular recognition. At present, the antibody preparation method is clear, the commercialization degree is high, and the applicable protein range is wide, which brings great convenience for the design of an immunoassay method based on antibody-antigen interaction. On the other hand, aptamers, as a class of ligand system evolution (SELEX) technology utilizing exponential enrichment, oligonucleotide fragments screened from artificially constructed single-stranded nucleic acid molecule libraries can be combined with multiple target substances including proteins with high specificity and high affinity, have the advantages of simple structure, easy modification, high stability and the like which are lacking in antibodies, and are increasingly used for sensing research of proteins in recent years. Although only limited kinds of protein molecules are screened to obtain corresponding aptamers due to slow progress of aptamer screening, the application of the aptamers in protein detection is limited to a certain extent, however, some protein aptamers which are screened have already been used in protein analysis, and with rapid development of the field of aptamer screening, more and more protein aptamers are screened.
Until now, electrochemical methods using antibodies or aptamers as recognition molecules have achieved certain results in tumor marker protein detection research, but the applications of the existing methods in serological diagnosis are still greatly limited. For example, electrochemical workers often detect a target protein by using impedance changes generated after recognition molecules immobilized on the surface of an electrode are combined with the target protein. Such methods are simple, rapid, straightforward, but sensitivity and specificity are often difficult to meet with the needs of serological diagnosis. The introduction of a signal amplification unit in the detection can achieve a more desirable effect. Enzyme-catalyzed signal amplification is a widely used signal amplification strategy in electrochemical detection methods for tumor markers: oxidoreductases, such as glucose dehydrogenase, alkaline phosphatase, horseradish peroxidase, and the like, are covalently linked to recognition molecules and effectively improve the sensitivity of the detection method by catalyzing the substrate redox reaction to generate electron circulation. However, the decrease of the catalytic activity of the oxidoreductase caused by the covalent modification process and the limitation of the number of enzyme molecules that can be linked by a single recognition molecule greatly influence the improvement effect of the signal amplification strategy on the detection sensitivity. In recent years, with the rapid development of the nucleic acid signal amplification strategies assisted by tool enzymes, such as nicking endonuclease signal amplification, Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR), Rolling Circle Amplification (RCA), and the like, domestic and foreign scholars have developed a number of novel electrochemical detection methods for tumor markers with high sensitivity and specificity based on the rapid development. However, since the tool enzymes used in these methods are all proteins, they are susceptible to acidity, ion concentration, etc. in complex samples such as serum, etc., and are easily contaminated by other molecules to lose activity, which results in greatly reduced signal amplification effect, and seriously hinders the practical application of the corresponding methods in serological diagnosis.
On the premise of ensuring the detection specificity, the method further improves the sensitivity and stability of the electrochemical detection method in complex samples such as serum and the like, and has become a problem of great concern for researchers. However, the technical problems inherent to the currently used signal amplification strategies limit further improvements of the existing detection methods. Therefore, to realize electrochemical sensitive detection of tumor markers in serum samples, improvement of signal amplification strategies must be considered.
Disclosure of Invention
In view of the above situation, the applicant has developed a more efficient and reliable detection method by using a nucleic acid aptamer recognition molecule comprehensively and using an electrochemical technology as a main means with a hepatocellular carcinoma nucleic acid marker as a research target, and has disclosed an electrochemical biosensor based on a hepatocellular carcinoma nucleic acid marker with nano-silver and an anchored phospholipid bilayer membrane, which can realize the detection of a target tumor marker with extremely low concentration in serum, and finally provides a powerful basis for the early diagnosis of hepatocellular carcinoma.
The technical scheme of the invention is as follows:
an electrochemical biosensor based on hepatocellular carcinoma nucleic acid labeling of nano-silver and anchored phospholipid bilayer membrane, comprising the following parts: a gold electrode, a phospholipid bilayer coated on the gold electrode, and two complementary DNA single strands a (aDNA) and a1(a1DNA) positioned on the outer surface of the phospholipid bilayer; the silver nanoparticle is matched with a sensor for use, and the surface of the silver nanoparticle is modified with a DNA single chain c (cDNA); when a target DNA (target) exists, the target DNA (target) and the DNA single strand c are respectively hybridized with the 3' end of the DNA single strand a to form a Y structure; the nucleic acid sequence of the target DNA (target) is shown in SEQ ID NO. 1.
Further, the electrochemical biosensor labeled by hepatocellular carcinoma nucleic acid based on the nano-silver and anchored phospholipid bilayer membrane is characterized in that phosphorylcholine groups are carried on the outer side of the phospholipid bilayer membrane relative to the gold electrode.
Further, in the hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on the nano-silver and the anchored phospholipid bilayer membrane, the DNA single strand a1 can be complementary with the 5' end sequence of the DNA single strand a, so that an aDNA/a1DNA double strand is formed.
Further, the hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on the nano-silver and anchored phospholipid bilayer membrane has the advantages that the 3' end of the DNA single strand a carries a cholesterol group; the 5' end of the DNA single strand a1 carries a cholesterol group.
Further, the above hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid bilayer membrane has aDNA/a1DNA double strand inserted into the phospholipid bilayer on the surface of the electrode through two cholesterol groups.
Further, the sequence of the DNA single strand a is shown as SEQ ID NO. 2; the sequence of the DNA single strand a1 is shown in SEQ ID NO. 3; the sequence of the DNA single strand c is shown in SEQ ID NO. 4.
Further, the above electrochemical biosensor based on hepatocellular carcinoma nucleic acid labeling with nano silver and anchoring phospholipid bilayer membrane, wherein the modification of the DNA single strand c on the surface of the silver nanoparticle comprises the following steps: incubating cDNA with a certain concentration with silver nanoparticles; centrifuging the solution at a high speed, and removing the unbound cDNA to obtain a cDNA @ silver nanoparticle solution; and then, adding a NaCl solution into the obtained cDNA @ silver nanoparticle solution, uniformly mixing, and standing at room temperature.
Further, the hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on the nano-silver and anchored phospholipid bilayer membrane has the certain concentration of cDNA of 10 μ M.
Further, the preparation and detection method of the hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on the nano-silver and anchored phospholipid bilayer membrane comprises the following steps:
s1 pretreatment of the gold electrode;
s2 assembling phospholipid double layers on the surface of the gold electrode;
s3, modifying DNA single-chain a and a1 on the surface of the phospholipid bilayer;
s4, synthesizing silver nanoparticles and modifying a DNA single chain c on the surface of the silver nanoparticles;
s5, putting a sample to be detected, and hybridizing the sample with the DNA single chain c on the surface of the silver nano-particles and the 3' end sequence of the DNA single chain a on the surface of the gold electrode respectively to form a Y-shaped structure when the target DNA exists, so that the silver nano-particles are captured to the surface of the gold electrode to generate obvious electrochemical response; when the target DNA does not exist, the silver nanoparticles cannot be captured to the surface of the gold electrode, and finally the generated electrochemical response is very weak.
Further, a kit for early diagnosis of hepatocellular carcinoma, which comprises the hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on the nano-silver and anchored phospholipid bilayer membrane.
According to the technical scheme, the invention has the following beneficial effects
The liver cell cancer tumor marker is a research target, the aptamer is taken as a recognition molecule, the marker detection and a DNA self-assembly signal amplification strategy are combined through reasonable design, a novel electrochemical sensing method with high accuracy and sensitivity is developed, the detection of the target tumor marker with extremely low concentration in serum is realized, and finally a powerful basis is provided for early diagnosis of hepatocellular carcinoma. And the following problems a. how to improve the applicability of the electrochemical detection method of the hepatocellular carcinoma tumor marker in serological diagnosis are solved. b. How to introduce a DNA self-assembly signal amplification strategy in an electrochemical detection method of a tumor marker. c. How to efficiently realize the DNA self-assembly signal amplification process in the electrochemical detection of tumor markers.
Drawings
FIG. 1, schematic for the detection of target DNA (target);
fig. 2, (a) ultraviolet-visible absorption spectrum of silver nanoparticles (B) electrochemical response spectrum of silver nanoparticles;
FIG. 3 shows a schematic diagram of the process of lipid bilayer formation and DNA double strand intercalation on the surface of a gold electrode and an alternating current impedance (EIS) characterization map;
FIG. 4, Linear voltammograms (LSV) obtained at 500 pM Target and in a series of control experiments: (a) detecting 500 pM Target; (b) detection of blank control (i.e., 0 pM Target); (c) 500 pM Target was tested, but the control cDNA (i.e., ct-cDNA, which contains only the sequence complementary to Target, but no sequence complementary to aDNA) was used; (d) 500 pM Target was tested, but with control aDNA (i.e., ct-aDNA, which contains only the sequence complementary to Target, but no sequence complementary to cDNA);
FIG. 5 shows (A) polyacrylamide gel electrophoresis (PAGE) for characterizing the formation of the Y-shaped structure and (B) a fluorescence spectrum for characterizing the formation of the Y-shaped structure;
figure 6, optimization experiment of silver nanoparticle surface modification cDNA concentration: (A) and the ultraviolet-visible absorption spectrogram is obtained when cDNA with different concentrations is used for modifying the silver nanoparticles. (B) The ratio of the absorbance value at 398 nm (A398) to the absorbance value at 550 nm (A550) in the UV-vis absorption spectrum as a function of the cDNA concentration;
FIG. 7, the LSV peak current value obtained when detecting 500 pM Target) varies with the assembly time of the Y-shaped structure;
FIG. 8, (A) LSV profiles obtained at a series of different concentrations of Target, from a to i, are 0, 1, 10, 50, 100, 200, 400, 500 and 1000 pM, respectively. (B) The LSV peak current value is in relation with targets with different concentrations, and an embedded graph is a linear relation between the LSV peak current value and the targets with different concentrations;
FIG. 9, (A) LSV peak current values obtained when 500 pM Target and control systems were tested: SM is a single base mutant sequence, TM is a double base mutant sequence, Random is a Random sequence completely different from the Target sequence, and Blank is Blank. (B) The peak current values of LSV obtained when 500 pM Target was detected in different systems: PBS is phosphate buffered, 10% -FBS is 10% fetal bovine serum, 50% -FBS is 50% fetal bovine serum, 10% -HS is 10% human serum, and 50% -HS is 50% human serum.
Detailed Description
The invention will be further elucidated by means of several specific examples, which are intended to be illustrative only and not limiting.
Regarding the electrochemical measurement method: the electrochemical measurement method of the present invention comprises Linear Sweep Voltammetry (LSV) and electrochemical alternating current impedance spectroscopy (EIS), and is performed on the electrochemical workstation CHI660 c. The P1/AuE electrode served as the working electrode, and the Ag/AgCl electrode and the platinum electrode served as the reference electrode and the counter electrode, respectively. Setting the EIS spectrum working condition: the bias voltage is 0.224V, the amplitude is 5-mV, and the frequency range is 0.1 Hz to 10 kHz. LSV scanning, working solution 1M KCl, working voltage-0.01 to 0.13V.
Examples
1. Preparation and principle of the sensor.
An electrochemical biosensor based on hepatocellular carcinoma nucleic acid labeling with nano-silver and anchored phospholipid Bilayer membrane has detection principle shown in figure 1, and is prepared by assembling Lipid Bilayer (LB) on surface of gold electrode (AuE); the lipid bilayer has a large number of phosphorylcholine groups on its outer side, and can efficiently form a hydrated layer in a solution, thereby serving as a barrier against nonspecific adsorption of complex components in serum such as proteins. Subsequently, two single-stranded DNAs with cholesterol (cholestrol) groups modified at the ends are respectively named as aDNA = SEQ ID No.2= 5' -TCAACATCAGCTCAGGATATATATGTGT-ttt-3 ' -cholestrol and a1DNA = SEQ ID No.3= cholestrol-5 ' -ttt-ACACATATAT-3 ', and a1DNA can be complementary to the 5' end sequence of the aDNA, so as to form an aDNA/a1DNA double strand, and the double strand can be inserted into a lipid bilayer on the surface of the electrode through the two cholesterol groups; meanwhile, a single-stranded DNA is synthesized and modified on the surface of the silver nanoparticle, namely cDNA = SEQ ID NO.4=5 '-CCTGAGCTAGTCTGATAAGCTA-TTTTT-3' -SH, and the prepared cDNA @ AgNPs are used as an electrochemical signal probe used in the experiment. When the target dna (target) = SEQ ID No.1= 5'-TAGCTTATCAGACTGATGTTGA-3' exists, the target dna (target) hybridizes with the cDNA on the surface of the silver nanoparticle and the a dna 3' terminal sequence on the surface of the electrode, respectively, to form a Y-shaped structure, thereby capturing the silver nanoparticle to the surface of the electrode, resulting in a significant electrochemical response. When the target dna (target) is not present, the silver nanoparticles cannot be captured to the electrode surface, and the resulting electrochemical response is very weak.
2. Preparation and validation of silver nanoparticle probes
(1) Preparation: in the presence of CTAB, reducing sodium borohydride prepares AgNPs with positive charges. Briefly, 2 mL of ethanol solution containing 1 mM CTAB was first placed in 30 mL of 5mM AgNO3 in water and stirred at room temperature for 15 min. 1% of NaBH4 fresh formulation solution was then added dropwise to the mixture until the color stabilized yellow-green.
(2) And (3) verification: referring to the attached figure 2, the prepared silver nanoparticles have characteristic absorption peaks near 396 nm, which are consistent with the literature; the inset is a Transmission Electron Microscope (TEM) image of the silver nanoparticles, which were prepared to have a particle size of about 10 nm, as shown. The prepared silver nanoparticles have obvious linear volt-ampere (LSV) response near 0.07V, which shows that the silver nanoparticles have good Ag/AgCl volt-ampere response and can be used as an electrochemical signal probe used in the experiment.
3. Preparation and verification of phospholipid double-layer gold electrode
(1) Electrode pretreatment: firstly, the gold electrodes are sequentially polished by sand paper of 1000 meshes and 500 meshes, and then the processed electrodes are sequentially polished on flannelette by aluminum powder of 0.5 micron and 0.03 micron. And then, the electrodes are sequentially placed into alcohol and purified water for ultrasonic washing for 5 minutes. The surface of the electrode was treated by dropping a solution of tiger fish (sulfuric acid: hydrogen peroxide = 1: 3) for 5 minutes, and then the surface was rinsed with purified water. And finally, drying the surface of the electrode by using nitrogen for later use.
(2) Preparation of lipid bilayer: firstly, soaking a pretreated gold electrode in an ethanol solution containing 2mm of DPPTE at room temperature overnight to form a first lipid bilayer, and then washing the electrode with ethanol to remove the non-covalently bound DPPTE. The DPPTE modified electrode was soaked in a solution containing 25mm DPPC (decane: ethanol = 3:1) for 5 min. And secondly, cooling the electrode to 20 ℃ to form a second lipid bilayer layer, and finally soaking the electrode in 0.1M KCl solution for 2h to form a lipid bilayer layer film on the gold electrode.
(3) Insertion of the DNA double strand: aDNA was reacted with a1DNA and the treated electrode in a buffer solution at room temperature for 10 hours. The a1DNA and the aDNA5 are complementary in end sequence, so that the a1DNA and the aDNA5 can form an aDNA/a1DNA double strand, and the double strand can be inserted into a lipid bilayer on the surface of the electrode through two cholesterol groups. After the time is over, the unbound DNA on the surface is removed with a buffer solution.
(4) And (3) verification: referring to FIG. 3, the diameter of the semicircular part in the EIS pattern gradually increased with the formation of lipid bilayer and the intercalation of DNA double strand, which indicates that the impedance of the electrode surface gradually increased. This is consistent with experimental assumptions, since lipid bilayers and DNA duplexes can form significant steric hindrance effects at the electrode surface, impeding electron transfer between the electrochemically active molecule potassium ferricyanide and the electrode.
4. Detection of target DNA (target)
Referring to fig. 4, as shown in the figure, the method can obtain a significant LSV response when used for detecting a Target of 500 pM, while only a very low LSV response can be obtained in all three control experiments, which indicates that the method can be used for detecting a Target, and a detection signal depends on the formation of a Y-shaped structure.
Further description of the sequences in FIG. 4: (a) detecting 500 pM Target; (b) detection of blank control (i.e., 0 pM Target); (c) detect 500 pM Target but use the control cDNA (i.e. ct-cDNA = SEQ ID No.5= 5'-CCTACTGTATCTGACTACAACT-3', the DNA only comprising the sequence complementary to Target and not the sequence complementary to a DNA); (d) 500 pM Target was tested, but with control aDNA (i.e., ct-aDNA = SEQ ID NO. 6= 5'-ATCGAATAGTCTGATGACATAT-3', which only contains the sequence complementary to Target, but NO sequence complementary to cDNA).
Verification of the Y Structure
Referring to FIG. 5, in order to demonstrate that a stable Y-shaped structure can be formed only when Target is present, we used to characterize the formation of the Y-shaped structure by a polyacrylamide gel electrophoresis (PAGE) graph as shown in FIG. 5 (A), wherein a band M is a DNA Marker, a band 1 is a system after 1. mu.M Target, 1. mu.M aDNA and 1. mu.M cDNA are reacted at 4 ℃ for 1 hour, and a band 2 is a system after 1. mu.M aDNA and 1. mu.M cDNA are reacted at 4 ℃ for 1 hour. The correctness of the design structure is demonstrated by fig. 5 (a), demonstrating the feasibility and rationality of the design structure. In addition, the formation of the Y-shaped structure is characterized by the fluorescence spectrum shown in FIG. 5 (B), in this experiment, the 3 'end of cDNA is modified with a fluorescent group FAM, and the 5' end of aDNA is modified with a quencher group Eclipse. As shown in fig. 5 (B), when Target is absent, cDNA and a dna are respectively dissociated in the solution, the fluorophore and the quencher are far away from each other, and the system has stronger fluorescence emission (curve a); when Target is present, a Y-shaped structure is effectively formed, and at this time, the 3 'end of cDNA and the 5' end of aDNA are adjacent to each other, resulting in that the fluorophore and the quencher are spatially close to each other, and the fluorescence emission of the fluorophore is significantly quenched (curve b).
6 optimization of the detection conditions
See fig. 6, in the experiment, different concentrations of cDNA (DNA single strand c) were used to incubate with silver nanoparticles; subsequently, the solution was centrifuged at 10000 rpm to remove unbound cDNA; and then, adding 0.5 mol/L NaCl solution into the obtained cDNA @ silver nanoparticle solution, uniformly mixing, standing at room temperature for 10 minutes, and measuring the ultraviolet-visible absorption spectrum of the solution. The naked silver nano particles have stronger electrostatic repulsion, and keep good dispersibility in the solution. When a certain concentration of NaCl solution is added into the silver nanoparticle solution, the Na + ions can neutralize the negative charges on the surfaces of the nanoparticles, so that the electrostatic repulsion between the particles is reduced, and the silver nanoparticles can be aggregated. However, if the surface of the silver nanoparticles is modified with DNA, the silver nanoparticles can be maintained in a dispersed state at a higher cation concentration. As shown in the figure, as the concentration of the cDNA used increases, the amount of cDNA modified on the surface of the silver nanoparticle gradually increases, resulting in gradually improved dispersibility of the silver nanoparticle in the presence of high concentration Na + ions; when the cDNA concentration reaches 10 mu M, the silver nanoparticles are not substantially aggregated under the condition of high concentration Na + ions, so that 10 mu M can be used as the optimal cDNA concentration for silver nanoparticle modification.
Referring to fig. 7, in addition, as the assembling time increases, the LSV peak current value gradually increases, and when the assembling time reaches 60 min, the LSV peak current value is basically kept stable; therefore, 60 min can be used as the optimal time for assembling the Y-shaped structure.
7 detection sensitivity verification
To evaluate the sensitivity of the designed method, different concentrations of Target were added under optimal conditions. See fig. 8 (a), the electrochemical response increases with increasing Target concentration. The results were in accordance with experimental design expectations. The main reason for this is that the formation of a Y-shaped structure is promoted by increasing the concentration of Target, and the increase of electrochemical signals is realized. FIG. 8 (B) shows the relationship between the LSV peak current value and the Target concentration in the range of 1 to 1000 pM, and the inset is the linear relationship between the LSV peak current value and the Target concentration in the range of 1 to 500 pM, the linear equation is y = 0.01x + 0.306, R2= 0.99; the detection limit of the method to Target is calculated to be 0.72 pM.
See fig. 9 (a), which shows the electrochemical reaction in different control systems. Peak currents only occur when Target is present, whereas in different control systems only relatively low peak currents are observed, whether in single-base or double-base or random sequences. The high specificity of our method is shown by the difference in electrochemical reactions of Target and different control systems, due to the high selectivity of the wye-structure. The electrochemical reaction of Target at the same concentration in PBS buffer (buffer) or fetal bovine serum (serum) at various concentrations is shown in FIG. 9 (B). From the results in the figure, it can be seen that the Target is basically even whether the Target is the peak current in the buffer solution or the peak current in the serum of the fetal calf with different concentrations, and the ideal and satisfactory applicability of the serum sample is proved by the method. The result shows that the method has higher specificity and sample applicability.
Further description of the sequence in fig. 9: (A) LSV peak current values obtained when 500 pM Target and control systems were tested: wherein SM = SEQ ID No.7= 5'-ATCGAATAGTCTGACAACAACT-3' is a single base mutant sequence, TM = SEQ ID No.8 = ATCGAATAGTCTGACTACAACT is a double base mutant sequence, Random = SEQ ID No.9= 5'-AATCGTAACATTGGCATGCAGA-3' is a Random sequence completely different from the Target sequence, Blank is used.
As can be seen from the above examples 1-7, the invention combines target marker detection with DNA self-assembly signal amplification strategy by reasonable design, improves accuracy and sensitivity, realizes detection of target tumor marker with extremely low concentration in serum, and is expected to provide basis for early diagnosis of hepatocellular carcinoma.
The above are only preferred embodiments of the present invention, and the scope of the present invention should not be limited thereby, and all the equivalent changes and modifications made by the claims and the summary of the invention should be covered by the protection scope of the present patent application.
SEQUENCE LISTING
<110> Suzhou Jianxiong professional technical institute
<120> an electrochemical biosensor labeled by hepatocellular carcinoma nucleic acid based on nano-silver and anchored phospholipid bilayer membrane
<130> 2021
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> artificial
<400> 1
tagcttatca gactgatgtt ga 22
<210> 2
<211> 33
<212> DNA
<213> artificial
<400> 2
tcaacatcag ctcaggatat atatgtgttt ttt 33
<210> 3
<211> 15
<212> DNA
<213> artificial
<400> 3
<210> 4
<211> 27
<212> DNA
<213> artificial
<400> 4
cctgagctag tctgataagc tattttt 27
<210> 5
<211> 22
<212> DNA
<213> artificial
<400> 5
cctactgtat ctgactacaa ct 22
<210> 6
<211> 22
<212> DNA
<213> artificial
<400> 6
atcgaatagt ctgatgacat at 22
<210> 7
<211> 22
<212> DNA
<213> artificial
<400> 7
aucgaauagu cugacuacaa cu 22
<210> 8
<211> 22
<212> DNA
<213> artificial
<400> 8
atcgaatagt ctgactacaa ct 22
<210> 9
<211> 22
<212> DNA
<213> artificial
<400> 9
aatcgtaaca ttggcatgca ga 22
Claims (2)
1. An electrochemical biosensor labeled by hepatocellular carcinoma nucleic acid based on nano-silver and anchoring phospholipid bilayer membrane is characterized by comprising the following parts: the gold electrode, the phospholipid bilayer coated on the gold electrode, and two complementary DNA single strands a and a1 positioned on the outer surface of the phospholipid bilayer; the silver nanoparticle is matched with a sensor for use, and a DNA single chain c is modified on the surface of the silver nanoparticle; when the target DNA exists, the target DNA and the DNA single strand c are respectively hybridized with the 3' end of the DNA single strand a to form a Y structure; the nucleic acid sequence of the target DNA is shown as SEQ ID NO. 1;
the outer side of the phospholipid bilayer, which is opposite to the gold electrode, carries phosphorylcholine groups;
the DNA single strand a1 can be complementary with the 5' end sequence of the DNA single strand a, thereby forming aDNA/a1DNA double strand;
the 3' end of the DNA single strand a carries a cholesterol group; the 5' end of the DNA single strand a1 carries a cholesterol group;
the aDNA/a1DNA double strand is inserted into a phospholipid double layer on the surface of the electrode through two cholesterol groups;
the sequence of the DNA single strand a is shown as SEQ ID NO. 2; the sequence of the DNA single strand a1 is shown in SEQ ID NO. 3; the sequence of the DNA single strand c is shown as SEQ ID NO. 4;
the method for modifying the DNA single strand c on the surface of the silver nanoparticle comprises the following steps: incubating cDNA with a certain concentration with silver nanoparticles; centrifuging the solution at a high speed, and removing the unbound cDNA to obtain a cDNA @ silver nanoparticle solution; then, adding a NaCl solution into the obtained cDNA @ silver nanoparticle solution, uniformly mixing, and standing at room temperature;
the concentration of the cDNA at a certain concentration is 10 mu M.
2. A kit for early diagnosis of hepatocellular carcinoma, which comprises the electrochemical biosensor labeled with hepatocellular carcinoma nucleic acid based on nanosilver and anchored phospholipid bilayer membrane according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110338354.7A CN113073131B (en) | 2021-03-25 | 2021-03-25 | Hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid double-layer membrane |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110338354.7A CN113073131B (en) | 2021-03-25 | 2021-03-25 | Hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid double-layer membrane |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113073131A CN113073131A (en) | 2021-07-06 |
| CN113073131B true CN113073131B (en) | 2021-12-14 |
Family
ID=76611383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110338354.7A Active CN113073131B (en) | 2021-03-25 | 2021-03-25 | Hepatocellular carcinoma nucleic acid labeled electrochemical biosensor based on nano-silver and anchored phospholipid double-layer membrane |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113073131B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107543850A (en) * | 2017-07-28 | 2018-01-05 | 苏州健雄职业技术学院 | Detect biology sensor of trypsase and its preparation method and application |
| CN110172438A (en) * | 2019-06-11 | 2019-08-27 | 湖南大学 | A kind of functional modification method of cell membrane |
| CN106198673B (en) * | 2016-07-14 | 2019-10-01 | 青岛大学 | Electrochemica biological sensor based on aptamer/nanometer silver probe Yu EXO I enzyme |
| CN112410330A (en) * | 2020-10-26 | 2021-02-26 | 山东大学 | DNA probe, universal electrochemical sensing platform, detection method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2019530485A (en) * | 2016-07-07 | 2019-10-24 | メモリアル スローン ケタリング キャンサー センター | Imaging system and method for particle-driven, knowledge-based and predictive cancer radiogenomics |
| CN111542345A (en) * | 2017-09-15 | 2020-08-14 | 卫材公司 | Chlorotoxins and uses thereof |
| CN111220666A (en) * | 2020-01-09 | 2020-06-02 | 济南大学 | Efficient miRNA detection based on hemin-induced biocatalysis photoelectric sensitive interface |
-
2021
- 2021-03-25 CN CN202110338354.7A patent/CN113073131B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106198673B (en) * | 2016-07-14 | 2019-10-01 | 青岛大学 | Electrochemica biological sensor based on aptamer/nanometer silver probe Yu EXO I enzyme |
| CN107543850A (en) * | 2017-07-28 | 2018-01-05 | 苏州健雄职业技术学院 | Detect biology sensor of trypsase and its preparation method and application |
| CN110172438A (en) * | 2019-06-11 | 2019-08-27 | 湖南大学 | A kind of functional modification method of cell membrane |
| CN112410330A (en) * | 2020-10-26 | 2021-02-26 | 山东大学 | DNA probe, universal electrochemical sensing platform, detection method and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| "Antifouling lipid membrane coupled with silver nanoparticles for electrochemical detection of nucleic acids in biological fluids";Xihui Jiang等;《Analytica Chimica Acta》;20210611;第1177卷;第1-6页 * |
| "Colorimetric detection of cancer biomarker based on enzyme enrichment and pH sensing";Xiangyang Miao等;《Sensors and Actuators B: Chemical》;20200613;第320卷;第1-8页 * |
| "Supported Lipid Bilayer Formation and Lipid-Membrane-Mediated Biorecognition Reactions Studied with a New Nanoplasmonic Sensor Template";Magnus P. Jonsson等;《NANO LETTERS》;20071201;第7卷(第11期);摘要 * |
| "基于纳米金膜和稳定Y型结构的DNA电化学传感器";董晓娅等;《化学学报》;20120714;第70卷(第13期);摘要，图1，第1460页右栏第2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113073131A (en) | 2021-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | RNA aptamer-based electrochemical aptasensor for C-reactive protein detection using functionalized silica microspheres as immunoprobes | |
| Chen et al. | A novel non-invasive detection method for the FGFR3 gene mutation in maternal plasma for a fetal achondroplasia diagnosis based on signal amplification by hemin-MOFs/PtNPs | |
| Shi et al. | High-performance and versatile electrochemical aptasensor based on self-supported nanoporous gold microelectrode and enzyme-induced signal amplification | |
| Cao et al. | A multiple aptasensor for ultrasensitive detection of miRNAs by using covalent-organic framework nanowire as platform and shell-encoded gold nanoparticles as signal labels | |
| Qian et al. | Ultrasensitive electrochemical detection of DNA based on Zn2+ assistant DNA recycling followed with hybridization chain reaction dual amplification | |
| Zhou et al. | Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles | |
| Shen et al. | Electrochemical aptasensor for highly sensitive determination of cocaine using a supramolecular aptamer and rolling circle amplification | |
| Wang et al. | Design of a sandwich-mode amperometric biosensor for detection of PML/RARα fusion gene using locked nucleic acids on gold electrode | |
| Zhang et al. | Silica-nanoparticle-based interface for the enhanced immobilization and sequence-specific detection of DNA | |
| Nam et al. | Highly sensitive electrochemical detection of proteins using aptamer-coated gold nanoparticles and surface enzyme reactions | |
| Li et al. | A sensitive electrochemical aptasensor based on water soluble CdSe quantum dots (QDs) for thrombin determination | |
| JP2015503095A (en) | Analyte detection | |
| TW200902976A (en) | Composite modified electrode trip | |
| CN110646486B (en) | Lead ion sensor based on hybrid chain reaction and TdT regulation and control and application | |
| Wu et al. | Ultrasensitive electrochemical biosensor for microRNA-377 detection based on MXene-Au nanocomposite and G-quadruplex nano-amplification strategy | |
| Xie et al. | Electrochemical detection of lipopolysaccharide based on rolling circle amplification assisted formation of copper nanoparticles for enhanced resistance generation | |
| Zouari et al. | Determination of miRNAs in serum of cancer patients with a label-and enzyme-free voltammetric biosensor in a single 30-min step | |
| Shi et al. | Self-powered dual-mode sensing strategy based on graphdiyne and DNA nanoring for sensitive detection of tumor biomarker | |
| Zhang et al. | A novel electrochemical aptasensor for serum dopamine detection based on methylene blue-integrated m-PdNFs signal material | |
| Hua et al. | Quantum dots as immobilized substrate for electrochemical detection of cocaine based on conformational switching of aptamer | |
| Liao et al. | Hybridization chain reaction triggered poly adenine to absorb silver nanoparticles for label-free electrochemical detection of Alzheimer's disease biomarkers amyloid β-peptide oligomers | |
| Xiong et al. | Electrochemiluminescence based determination of micro-RNA using target-guided assembly of gold nanoparticles on an electrode modified with Nafion, carbon nanotubes and polyvinylpyrrolidone | |
| Wang et al. | Fluorescent/electrochemical dual-signal response biosensing strategy mediated by DNAzyme-ferrocene-triggered click chemistry for simultaneous rapid screening and quantitative detection of Vibrio parahaemolyticus | |
| JP4625547B2 (en) | Methods and apparatus for biomolecule detection | |
| Hou et al. | DNAzyme-guided polymerization of aniline for ultrasensitive electrochemical detection of nucleic acid with bio-bar codes-initiated rolling circle amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |