CN113061561B

CN113061561B - Vibrio parahaemolyticus gene deletion attenuated strain and recombinant vibrio parahaemolyticus attenuated live vaccine, and preparation method and application thereof

Info

Publication number: CN113061561B
Application number: CN202110305802.3A
Authority: CN
Inventors: 潘建义; 高智超; 查振中; 查银河
Original assignee: Zhejiang Hongsheng Biotechnology Co ltd; Zhejiang Sci Tech University ZSTU
Current assignee: Zhejiang Hongsheng Biotechnology Co ltd; Zhejiang Sci Tech University ZSTU
Priority date: 2021-03-24
Filing date: 2021-03-24
Publication date: 2022-06-10
Anticipated expiration: 2041-03-24
Also published as: CN113061561A

Abstract

The invention discloses a vibrio parahaemolyticus gene deletion attenuated strain and a vaccine based on the same. The vibrio parahaemolyticus gene deletion attenuated strain is a strain which does not contain tdhA, vcrD1 and vcrD2 genes and efficiently expresses lptD protein on an outer membrane. The vaccine of the invention is a attenuated strain containing vibrio parahaemolyticus gene deletion and a pharmaceutically acceptable diluent, and the content of the vaccine is that each head contains 10 strains⁸CFU, the diluent is PBS buffer solution passing through a 0.22 μm filter membrane or physiological saline passing through a 0.22 μm filter membrane. The safety experiment of the vibrio parahaemolyticus gene deletion attenuated strain constructed by the invention shows that the toxicity of the strain is obviously reduced, and the strain has no toxicity to experimental animals; and the immunoprotection analysis of the strain shows that the strain has efficient immunoprotection effect and can protect experimental animals from death by 100 percent.

Description

Vibrio parahaemolyticus gene deletion attenuated strain and recombinant vibrio parahaemolyticus attenuated live vaccine, and preparation method and application thereof

Technical Field

The invention relates to a vibrio parahaemolyticus gene deletion attenuated strain, a recombinant vibrio parahaemolyticus attenuated live vaccine, a preparation method and application thereof, and belongs to the technical field of biology.

Background

The gram stain result of vibrio is negative, is a halophilic bacterium, and is widely present in areas close to rivers and seawater. Vibriosis of fish, shrimp, shellfish, etc. caused by infection with pathogenic vibrio is the most important bacterial disease of aquaculture animals. Currently, 27 species of Vibrio have been found to cause vibriosis, with Vibrio parahaemolyticus (V.parahaemolyticus) being the most common. The vibrio parahaemolyticus brings potential harm to people and various organisms, and not only harms the healthy development of aquaculture industry and causes death of fishes and shrimps due to bacterial diseases, thereby causing huge economic loss, but also is a main food-borne pathogenic bacterium in China. Currently, the prevention and treatment of vibriosis are mainly to feed antibiotics, but the prescription has certain defects, and two problems of drug residue and corresponding drug resistance generated by thalli occur, so that the problems of harming human health and food safety are caused, and the inferior quality and loss of some aquatic crops are caused.

Outer membrane proteins (outer membrane proteins) are produced mainly by gram-negative bacteria, are located outside the peptidoglycan layer of bacteria, are a component constituting the bacterial cell wall thereof, are an important structure constituting the outer membrane of bacteria, and are present in high amounts in bacteria up to one-half of the total composition of the extracellular structure thereof. As a main component of the outer membrane, outer membrane proteins play an important role in the life activities of bacteria, and the maintenance of the normal morphology of bacteria, the synthesis of substances, the drug resistance of bacteria, and the like cannot be kept away. Certain outer membrane proteins of pathogenic bacteria have an adhesin effect, which contributes to the adhesion of pathogenic bacteria to host cells; some pathogenic bacteria outer membrane proteins also have the functions of anti-phagocytosis, anti-complement, anti-serum sterilization and the like, and are beneficial to the escape of pathogenic bacteria from host immune defense, thereby achieving the purpose of causing diseases. Because the outer membrane proteins are the outermost structures of bacteria, when bacteria invade a host cell, various outer membrane proteins can interact with surface proteins or receptors of the host cell to mediate infection of the host cell by pathogenic bacteria, but at the same time, the outer membrane proteins are also the proteins which are most easily recognized by the immune system of the host and are recognized as antigens by the immune system, so that some outer membrane proteins can induce the host to generate an immune response with high protection. Therefore, the outer membrane proteins of pathogenic bacteria may be antigens with important protection effects for hosts, and some outer membrane proteins are highly conserved in different pathogenic bacteria of the same genus, even some proteins have certain conservation in different bacteria of different genera, and can generate certain cross protection effects in immune responses induced by different serotype strains of different species or the same serotype, so that the outer membrane proteins of bacteria are also one of the most potential vaccine targets. Currently, many studies on the immunogenicity of vibrio outer membrane proteins have been made to show that many outer membrane proteins have good immunogenicity, including, for example, OmpW, OmpV, OmpU, OmpK, PsuA, PvuA, VPA1435, VP0764, VPA1186, VP1061, VP2850, and the like. Previous research also found that lptD, LamB, OmpA, OmpK, OmpU, VP0802, VP1243, VP0966 and the like have immunogenicity through an immunoproteomics technique. The results of these studies indicate that the outer membrane protein can effectively stimulate the body to produce specific antibodies. In addition, the research shows that some outer membrane proteins can also have 50-100% immune protection rate on the infection of corresponding pathogenic bacteria, and some outer membrane proteins can also obviously enhance the phagocytic activity of phagocyte of the body.

OMPs are a series of proteins with specific functions that transport lipopolysaccharides in gram-negative bacteria. It is not only one of the major components of the outer membrane of gram-negative bacteria, but also lipopolysaccharide plays an important role in bacterial infection of the body. The structure and function of the compound have been further elucidated, and the pathogenic mechanism has been fully explained. In recent years, it has been found that the transmembrane transport and the assembly of lipopolysaccharides from gram-negative bacteria on the outer membrane are performed by the combined action of a series of transporter LptA-G protein complexes. And the transmembrane protein lptD existing on the bacterial membrane transports lipopolysaccharide to the bacterial outer membrane under the action of another transport protein LptE, so as to form an important structure of the bacterial outer membrane. There are studies that demonstrate that bacterial growth is greatly inhibited after blocking the action of lptD, and therefore, lptD membrane proteins are considered to be the "fate gate" for survival of gram-negative bacteria. Therefore, lptD has a key role in both physiological function and virulence of bacteria. Currently, the three-dimensional structure of lptD proteins has been resolved (fig. 1).

At present, research on the immunogenicity of vibrio parahaemolyticus lptD has been carried out, which shows that lptD has good immunogenicity, and sequence analysis shows that lptD exists in all vibrios, and the amino acid sequence is highly conserved, especially the sequence homology with several common pathogenic vibrios is more than 90%, thus suggesting that lptD is a vaccine target with great development prospect. Therefore, the attenuated live vaccine based on lptD as protective antigen is developed, and a safe and effective immune prevention measure can be provided for controlling the vibriosis of the marine culture animals.

Disclosure of Invention

The invention aims to solve the technical problems that a vibrio parahaemolyticus gene deletion low virulent strain with an outer membrane for efficiently expressing lptD protein is constructed; secondly, the attenuated strain is used for preparing a vaccine for preventing or treating vibriosis.

Therefore, the invention discloses a vibrio parahaemolyticus gene deletion attenuated strain, which does not contain tdhA, vcrD1 and vcrD2 genes.

Preferably, the tdhA gene is shown in SEQ ID.NO1; the gene vcrD1 is shown as SEQ ID.NO2, and the gene vcrD2 is shown as SEQ ID.NO3.

Preferably, the vibrio parahaemolyticus gene deletion attenuated strain also comprises a recombinant vector capable of efficiently expressing lptD protein on the outer membrane of the vibrio parahaemolyticus gene deletion attenuated strain.

Preferably, the recombinant vector capable of efficiently expressing the lptD protein on the outer membrane of the vibrio parahaemolyticus gene deletion attenuated strain is pBBR1 MCS-1-ompA-lptD.

Preferably, the ompA gene sequence is shown in SEQ ID.NO4; the lptD gene sequence is shown in SEQ.ID.NO5.

In still another aspect, the present invention also provides a method for preparing the attenuated strain of vibrio parahaemolyticus gene deletion, comprising the following steps: 1) knocking out tdhA, vcrD1 and vcrD2 genes of vibrio parahaemolyticus to obtain vibrio parahaemolyticus without tdhA, vcrD1 and vcrD2 genes; 2) constructing a pBBR1MCS-1-ompA-lptD vector, transferring the vector to the vibrio parahaemolyticus in the step 1), and screening to obtain a vibrio parahaemolyticus gene deletion attenuated strain of the lptD protein efficiently expressed on the outer membrane.

In another aspect, the invention also provides a recombinant attenuated live vaccine of vibrio parahaemolyticus, which contains a vibrio parahaemolyticus gene deletion attenuated strain and a pharmaceutically acceptable diluent; the vibrio parahaemolyticus gene deletion attenuated strain does not contain tdhA, vcrD1 and vcrD2 genes and efficiently expresses lptD protein on an outer membrane.

Preferably, each head of the live vaccine provided by the invention contains the vibrio parahaemolyticus gene deletion attenuated strain with the concentration of 10⁸CFU。

Preferably, the pharmaceutically acceptable diluent is PBS buffer solution passing through a 0.22 μm filter membrane or physiological saline passing through a 0.22 μm filter membrane.

The safety experiment of the vibrio parahaemolyticus gene deletion attenuated strain constructed by the invention shows that the toxicity of the strain is obviously reduced, and no toxicity is generated to experimental animals (figure 11); and the immunoprotection analysis of the strain shows that the strain has high immunoprotection effect and can protect experimental animals from death by 100 percent (figure 12/13). And in our preliminary analysis it was found to have some cross-protection, and the antiserum it produces can immunoreact with the membrane proteins of various Vibrio species (FIG. 14).

At present, although there have been many researches on vaccine development against vibrio, such as DNA vaccine of OmpW against vibrio harveyi, multipurpose vaccine research targeting OmpK, etc., these vaccine researches provide many help for vaccine development targeting bacterial membrane proteins. However, due to the limitations of subunit vaccines, such as difficult preservation and difficult vaccination, no corresponding attention is paid to the practical production and application in the field of fishing vaccines, so that the market field of fishing genetic engineering vaccines needs to be further innovated and broken through, the novel genetic engineering attenuated vaccine not only can break through the limitations of the traditional subunit vaccine, but also can provide better immune effect, and the transmission subunit vaccine is incomparable with low virulence, good immune effect, longer immune duration and the like. Although the research on membrane proteins is increasingly intensive, the important significance of the lptD protein as a vaccine target is not highlighted, and the conservation of the lptD protein and the interspecies cross-protection of the lptD protein are not considered. Therefore, the research innovatively combines the immunoprotection of lptD and the advantages of attenuated live vaccines, further enhances the ability of lptD to induce cellular immunity and humoral immunity in attenuated strains by constructing genetically engineered vaccines and expressing protein fragments without physiological functions through outer membrane proteins, lays the foundation for novel multivalent genetically engineered vaccines, and provides a new idea. Provides powerful support for the subsequent application of lptD and attenuated live vaccines.

Drawings

FIG. 1 the three-dimensional structure of the lptD protein.

FIG. 2 gene of upstream and downstream homology arms of vcrD 2. Wherein (a) a gene fragment upstream of vcrD 2; (b) a gene fragment downstream of vcrD 2; (c) a Δ vcrD2 gene fragment.

FIG. 3 plasmid pRE112 and fusion gene fragment were double digested. Wherein (a) the pRE112 plasmid double digestion product, the linear pRE112 plasmid size is about 5700 bp; (b) the double enzyme digestion product of the upstream and downstream homologous arm fusion gene fragment of the delta vcrD2 is about 860bp in size.

FIG. 4 PCR and double restriction analysis of recombinant plasmid pRE 112-. DELTA.vcrD 2. Wherein (a) colony PCR screens positive transformants, and four samples in the figure are all positive transformants; (b) and (3) carrying out amplification on the bacteria liquid sample after PCR screening, extracting plasmids of the bacteria liquid sample, and carrying out double enzyme digestion to further determine whether the vector is constructed successfully. In the figure, two bands can be cut out by double enzyme digestion, which indicates that the construction of the recombinant vector is successful.

FIG. 5 shows the results of electrophoresis of screening by colony PCR. The method comprises the steps of performing first round screening by using upstream and downstream homologous arm primers of a target gene, continuously subculturing all bacteria liquid capable of amplifying strips to knock out the target gene, taking 1-5 bacteria liquid samples as PCR (polymerase chain reaction) results of different bacteria liquid samples, and continuously performing subsequent subculturing by taking bacteria liquid No. 1, 3 and 5 according to electrophoresis results in a figure.

FIG. 6 screening of gene-deleted strains after the second round of recombination. Wherein (a) a peripheral primer is used for primary screening, and the bacterial strain capable of amplifying a short band is determined after being subjected to amplification culture again; (b) detection was performed using peripheral primers. M: marker; 1: a wild strain; 2: knocking out a strain; 3: negative control; (c) and detecting by using the target gene primer. M: marker; 1: a wild strain; 2: knocking out a strain; 3: negative control; (d) detection was performed using plasmid specific primers. M: marker; 1: a wild strain; 2: knocking out a strain; 3: a positive control; 4: and (5) negative control.

FIG. 7 lptD, ompA-lptD gene, plasmid, gene double restriction enzyme products. Wherein (a) the lptD gene; (b) ompA-lptD gene; (c) electrophoresis results after plasmid and gene double digestion. 1-5: linear plasmid pBBR1 MCS-1; 2-11: ompA-lptD gene band.

FIG. 8 construction and characterization of plasmid pBBR1 MCS-1-ompA-lptD. Wherein (a) colony PCR screens positive transformants, the first two lanes in the figure are negative transformants, and the last two lanes are bacterial liquid samples possibly containing recombinant plasmids; (b) and continuously carrying out amplification culture on the screened strain, extracting the plasmid, and carrying out double enzyme digestion by using endonuclease to further determine whether the recombinant plasmid is successfully constructed. As shown in the figure, two bright bands appear in the lane, one band is about 4700bp, and the other band is about 1800bp, which proves the success of the recombinant plasmid construction.

FIG. 9 screening of positive transformants after recombinant plasmid binding transfer. Wherein, the upstream and downstream primers of ompA-lptD gene segment are used for colony PCR amplification, 1 to 11 samples in the figure are positive transformants, and the colony No. 12 is a negative transformant.

FIG. 10 lptD fragment is expressed on the outer membrane of VP4 strain. Wherein 1: wild strain whole protein; 2: VP4-1 holoprotein; 3: VP4-2 holoprotein; 4: wild strain membrane proteins; 5: VP4-1 membrane protein; 6: VP4-2 membrane protein.

FIG. 11 detection of toxicity of VP4 strain.

FIG. 12 results of antiserum titer determination.

FIG. 13 analysis of immunoprotection effect of VP 4.

FIG. 14 Wersternblot assay for cross-immune recognition of antisera. Wherein, the vibrio parahaemolyticus protein 1, the vibrio alginolyticus protein 2 and the vibrio vulnificus protein 3 are included.

Detailed Description

The technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. It is to be understood that the embodiments described are only some of the embodiments of the invention, and not all of them.

The chemical reagents related to the invention are all made in China.

One, experimental material and main reagent

1 materials of the experiment

Coli S17-1. lamda. pir, Vibrio parasoluble (RIMD 2210633), plasmid pBBR1MCS-1 (deposited in this laboratory); plasmid pRE112 (deposited in this laboratory); vibrio parahaemolyticus (RIMD 2210633); the gene-deleted mutant strain VP1(Δ tdhA) was from professor Kim Orth; the vibrio parahaemolyticus (RIMD 2210633) type III secretion system related gene deletion bacterium VP2 (delta vcrD1) is preserved in the laboratory; SPF grade female ICR mice were purchased from university of medicine in zhejiang.

2 Primary reagent

T4 DNA ligase was purchased from Thermo; DNAmarker was purchased from Takara; restriction endonucleases were purchased from Takara; prestained Marker available from Fermentas corporation; KOD-Plus-Neo was purchased from Toyobo company; ECL chromogenic substrates were purchased from bi yunnan biotechnology limited.

3 preparation of main solution

(1)25mg/mL chloramphenicol: weighing 0.2g of chloramphenicol solid powder, using a pipette gun to suck 8mL of absolute ethyl alcohol to dissolve the chloramphenicol powder, filtering the chloramphenicol powder after dissolution by using a sterile filter membrane with the filter pore diameter of 0.22 mu m, subpackaging the filtered stock solution in 1mL of EP tubes, and preserving the stock solution at the temperature of-20 ℃. (2) Luria-Bertani solid medium: about 1g of Tryptone, 1g of NaCl and 0.5g of Yeast Extraction were weighed, dissolved in 100mL of purified water until no solid powder was present, 1.5g of agar was added, and the mixture was autoclaved at 121 ℃ for 30 minutes, poured into a sterile petri dish, and stored at 4 ℃. (3) TCBS medium: weighing 8.6g TCBS culture medium solid into a 100mL conical flask, adding 100mL purified water, shaking fully after boiling for 15 minutes to dissolve the culture medium, boiling for 15 minutes, pouring into a 90mm culture dish, air drying, and storing in a refrigerator at 4 ℃ for later use. (4) TCBS medium (containing 10. mu.g/mL chloramphenicol): weighing 8.6g TCBS culture medium solid, adding 100mL purified water into a 100mL conical flask, shaking uniformly, boiling for 15min, shaking sufficiently to dissolve the culture medium, boiling for 15min, cooling to below 60 ℃, adding 40 mu L chloramphenicol with the concentration of 25mg/mL, shaking sufficiently, pouring into a 90mm culture dish, air drying, and storing at 4 ℃. (5) 30% of Arc-Bis (29: 1): 5g of methylene bisacrylamide and 145g of acrylamide are dissolved in 400mL of deionized water, and finally the volume is fixed to 1L, and the mixture is filtered by using a sterile filter membrane with the diameter of 0.22 mu m and stored in a brown bottle. (6) PBS phosphate buffer: 1.83g of Na2HPO4 & 12H2O, 0.12g of KH2PO4, 0.1g of KCl, and 4g of NaCl were weighed, dissolved in 400mL of purified water, and after dissolution, the pH was adjusted to 7.4 by using hydrochloric acid or sodium hydroxide. Adding appropriate amount of purified water, metering to 500mL with 500mL graduated cylinder, sterilizing at 121 deg.C for 30min, and storing at room temperature. (7) 10 × protein electrophoresis buffer: 30.29g of Tris was weighed to give a final concentration of 25mM, 10g of SDS was weighed to give a final concentration of 0.1% (m/v), 144.1g of glycine was weighed to give a final concentration of 190mM, and double distilled water was added to give a final volume of 1L. (8) TBST buffer: 25mM Tris, 150mM NaCl, 0.05% (v/v) Tween-20, adjusted to pH 7.4 with HCl and stored at 4 ℃ until use. (9) Membrane protein solubilizing agent: and (3) preparing an ultrasonic lysate, and adding 1% Triton X-100 to obtain the compound.

Second, Experimental methods

1 primer design

1.1 primer design of recombinant vector and acquisition of ompA sequence signal peptide

The OmpA (VPA1186) protein sequence is searched in Uniprot, the partial sequence of the signal peptide is obtained, the nucleic acid sequence of the signal peptide fragment is obtained by searching the nucleic acid sequence in NCBI and aligning the nucleic acid sequence (ATGAACAAAGTAGCAATTGCAGTAGCAGCAGTGGTAGCTGGTAGTAGCGCGCTTTTAAACTCTGCT CAAGCT), and the signal peptide fragment is handed to GeneWiz (Suzhou) for synthesis.

Searching a nucleic acid sequence of lptD (VP0339) in an NCBI website, analyzing the nucleic acid sequence and designing a Primer, analyzing by using Primer 5.0 software, finally designing a Primer of a partial sequence (673 bp-2346 bp, 1674bp in total) of an lptD gene, and designing a Primer for overlap extension PCR. The primer sequences are shown in Table 2-1.

TABLE 2-1 PCR primers

1.2 Gene knockout related primer design

The vcrD2 gene sequence was looked up in NCBI website, primers were designed and analyzed by Primer 5.0 software. Finally, a series of primer sequences related to gene knockout are designed. See table 2-2 for details.

TABLE 2-2 Gene knockout primers

2vcrD2 knock-out

2.1 amplification of the homology arms of vcrD2

Respectively taking pRE 112-delta vcrD2-F1/pRE 112-delta vcrD2-R1, pRE 112-delta vcrD2-F2/pRE 112-delta vcrD2-R2 as primers and the whole genome of Vibrio parahaemolyticus as a template, respectively amplifying gene sequences of upstream and downstream homologous arms of the vcrD2 gene, and carrying out PCR reaction at the annealing temperature of 62 ℃ according to the instruction of polymerase. After amplification, agarose electrophoresis was used for examination. The reaction system and reaction conditions are shown in tables 2-3 and tables 2-4.

TABLE 2-3 PCR reaction System

TABLE 2-4 PCR reaction System

2.2 amplifying the fusion gene fragment of the upstream and downstream genes of the vcrD2 gene, and respectively recovering and purifying products after electrophoresis detection according to the kit instruction. The gene fragments of the upstream and downstream homology arms of the vcrD2 gene were recovered. The two gene fragments were mixed at a certain molar ratio (1: 1) and used as a template for overlap extension PCR, and overlap extension PCR reaction was carried out at an annealing temperature of 61 ℃ (Table 2-5).

TABLE 2-5 PCR reaction System

2.3 the gene fragment and the product of the double enzyme digestion amplification of the vector (upstream and downstream homology arms of. delta. vcrD 2) are recovered and purified after electrophoresis test to obtain the fusion gene fragment. The fusion fragment of the recovered upstream and downstream gene fragments of Δ vcrD2 and the vector pRE112 were cleaved with KpnI and SacI endonucleases, respectively, and the optimum reaction temperature of the endonucleases was 37 ℃ according to the product instructions (tables 2-6 and 2-7), which required about 40 min. And (3) recovering and purifying the enzyme-digested product.

TABLE 2-6. delta. vcrD2 fusion fragment double enzyme digestion system

TABLE 2-7 pRE112 plasmid double restriction enzyme System

2.4 ligation of the digested fusion fragment to plasmid the product of Δ vcrD2 obtained by double digestion was ligated to the product of double digestion of suicide plasmid pRE112 to construct recombinant plasmid, which was ligated using DNA ligase for 1h at 22 ℃ in a ligation reaction system as shown in tables 2-8.

TABLE 2-8. DELTA. vcrD2 ligation reaction System

2.5 transformation of recombinant plasmid into E.coli S17-1 (. lamda. pir) competent cells (1) 10. mu.L of the ligation product was transferred to a sterile 1.5mL EP tube using a pipette, 100. mu.L of S17-1 competent cells were added thereto and gently mixed, and left on ice for 30 min. (2) It is transferred to a metal bath at 42 ℃ for reaction for about 40-90 s. (3) The EP tube was quickly transferred to an ice bath for ice-bath cooling for about 3-4 minutes and then removed after cooling. (4) Adding 800 mu L of fresh LB liquid culture medium into competent cells, mixing the competent cells with the liquid culture medium, placing the mixture into a constant-temperature metal bath at 37 ℃ for activation for 10min after gentle mixing, performing gas bath oscillation culture at the speed of 150rpm for 45min in a constant-temperature shaking table at 37 ℃ after full activation to activate thalli (5), taking 4000g of the cultured bacterial liquid, centrifuging for 1min, removing 600 mu L of culture solution, slightly blowing and suspending and mixing thalli precipitates, and coating 150 mu L of the transformed bacterial liquid on a solid LB plate culture medium plate with proper Chl resistance by using a glass rod after uniform mixing. (6) Culturing at 37 deg.c to plate culture medium to grow single colony.

2.6 identification of Positive transformants containing recombinant plasmids by PCR of the bacterial solution the monoclonal colonies were carefully picked on a solid medium plate on which the monoclonal colonies grew, and screened by colony PCR using two pairs of primers pRE112- Δ vcrD2-F1/pRE112- Δ vcrD2-R2, which are the target gene primers, according to the same reaction procedures as those shown in tables 2-5.

2.7 sequencing identification of recombinant plasmids Positive transformants are transferred to a new LB medium for propagation, after overnight culture until enough bacteria exist, plasmids are extracted by using a plasmid extraction kit, and gene sequencing identification is carried out on the extracted recombinant plasmids.

2.8 Gene knockout first recombination (1) Escherichia coli S17-1 (lambda pir) positive transformant and parahemolytic vibrio culture medium which are successfully transferred and detected are respectively inoculated into 100mL LB and LBS liquid culture medium according to the proportion of 1:100 for amplification culture, Chl with proper content is added into the culture medium, and the culture medium is subjected to gas bath shake culture at 37 ℃ and 100r/min until the OD600 is about 1.0. (2) 1mL of two cultured bacterial liquids were centrifuged at 4 ℃ and 3000g/min for 3 min. The cells were collected in an EP tube, resuspended using an appropriate volume of phosphate buffer, repeated 2-3 times, and finally resuspended in approximately 100. mu.L of fresh medium. (3) Uniformly mixing the two bacterial liquids according to the proportion of 5:1, taking 100 mu L of the mixed bacterial liquid, dripping the mixed bacterial liquid on an LB solid plate in three drops, and placing the mixed bacterial liquid in an ultra-clean workbench for tens of minutes to ensure that the bacterial liquid is completely absorbed by a culture medium. The plate culture medium is placed upside down in a bacterial incubator and cultured for 10-12h at 37 ℃. (4) After visible bacterial plaque is on the plate, 1mL LB or LBS liquid culture medium is used for washing, the washed bacterial liquid is diluted according to a certain proportion, after the bacterial liquid is diluted to a certain multiple, 100 plus 200 mu L of bacterial liquid is taken to be coated on a TCBS plate containing chloramphenicol resistance, and the TCBS plate is placed upside down in a 37 ℃ incubator to be cultured until visible dark green single bacterial colony grows out. (5) And (3) inoculating the dark green monoclonal colonies grown on the selected plate into an LB liquid culture medium for amplification culture so as to be used for subsequent gene knockout.

2.9 Gene knockout recombination (1) the bacterial liquids successfully transferred by the first joining are respectively inoculated into LB liquid culture medium containing 10% sucrose, and are cultured overnight by air bath shaking under the conditions of 37 ℃ and 180r/min for propagation. (2) After the constant-temperature gas bath shake culture is carried out for 12-16h, 50 mu L of the bacterial liquid is taken by a liquid transfer gun and transferred to 5mL of fresh LB culture medium containing 10% of cane sugar, and the gas bath shake culture is continued overnight under the culture conditions of 37 ℃ and 180 r/min. (3) And (3) repeating the step (2) for continuous subculture for several times, carrying out PCR reaction identification on the bacterial liquid, carrying out PCR reaction by using peripheral primers pRE 112-delta vcrD2-F4/pRE 112-delta vcrD2-R4, diluting the bacterial liquid capable of amplifying two long and short peripheral gene strips by a certain time until a single bacterial strain capable of being identified grows on the plate, taking a proper amount of bacterial liquid, coating the bacterial liquid on a TCBS agar plate containing 10% of sucrose, and inversely placing the bacterial liquid in an incubator at 37 ℃ until a dark green single bacterial strain appears. (4) Colony PCR identification was performed on colonies growing on the plates. The primers pRE 112-delta vcrD2-F4/pRE 112-delta vcrD2-R4 are used for PCR amplification, namely target gene primers are used for PCR amplification, and the condition that a band cannot be amplified is the initial success of gene knockout.

Amplification of 3lptD Gene and fusion with ompA Signal peptide fragment

3.1 amplification of lptD Gene fragment Using lptD-F/pBBR1MCS-1-lptD-R as primers and Vibrio parahaemolyticus genomic DNA as a template, two thirds of the gene fragment after lptD was amplified, and PCR was carried out at an annealing temperature of 62 ℃ with reference to the polymerase instruction manual (tables 2 to 9).

TABLE 2-9 PCR System

3.2 fusion PCR of lptD and ompA Signal peptide Gene the amplification fragment of lptD was purified and recovered according to the procedure of the gel recovery kit manual, and PCR reaction was carried out at an annealing temperature of 61 ℃ with reference to the polymerase instruction manual, using the ratio of the amplification fragment to the synthesized ompA signal peptide in a molar ratio of 1:1 as a template for overlap extension PCR (2-10).

TABLE 2-10 PCR reaction System

3.3 double digestion treatment of fusion gene fragment and shuttle plasmid, recovery and purification are carried out after electrophoresis inspection of the amplification product of the overlap extension PCR. The recovered gene product and shuttle vector pBBR1MSC-1 were subjected to double digestion with KpnI and SacI endonucleases, respectively, and the reaction was carried out at 37 ℃ for 40min, the digestion system is shown in tables 2-11 and 2-12. And (3) carrying out electrophoresis detection on the product after enzyme digestion and recovering the product for subsequent experiments.

TABLE 2-11 ompA-lptD fusion fragment double enzyme digestion system

TABLE 2-12 pBBR1MCS-1 plasmid double digestion system

3.4 the fusion fragment is connected with the linear vector, the product obtained by double enzyme digestion of the ompA-lptD recombinant gene fragment and the linear plasmid obtained by double enzyme digestion of the shuttle plasmid vector pBBRMCS-1 are connected through DNALase, and the two gene fragments are connected through the viscous end to construct the recombinant plasmid which can be replicated and expressed in the vibrio parahaemolyticus. The reaction conditions were 22 ℃ and 1 hour, and the ligation reaction systems are shown in tables 2 to 13.

TABLE 2-13 ompA-lptD fusion fragment ligation reaction System

3.5 transformation of ligation products into E.coli S17-1 (. lamda. pir) competent cells (1) 10. mu.L of ligation products were pipetted into a 1.5mL EP tube, 100. mu.L of S17-1 competent cells were added and mixed gently, and placed on ice for 30 min. (2) It is transferred to a metal bath at 42 ℃ for reaction for about 40-90 s. (3) The EP tube was quickly transferred to an ice bath for ice-bath cooling for about 3-4 minutes and then removed after cooling. (4) Adding 800 μ L of fresh LB liquid culture medium into the competent cells, mixing, gently mixing, placing in a 37 deg.C constant temperature metal bath for activation for 10min, and performing gas bath shaking culture at 150rpm in a 37 deg.C constant temperature shaking table for 45min to activate thallus. (5) Centrifuging the activated bacterial liquid for 1min under the condition of 4000g, removing 600 mu L of culture liquid, slightly blowing and suspending the precipitate uniformly, and coating 150 mu L of bacterial liquid on a culture plate containing a proper antibiotic. (6) The plates were incubated at 37 ℃ for 12-16h until single colonies grew.

3.6 PCR identification of bacterial solution transformation results A single clone was picked from a plate on which colonies were grown and placed in a PCR system, and colony PCR was performed using pBBR1MCS-1-ompA-F/pBBR1MCS-1-lptD-R primers, and the PCR reaction program was as shown in tables 2 to 10.

3.7 sequencing and identification of recombinant plasmid the positive transformant after PCR test is transferred to a new LB or LBS culture medium for continuous amplification culture. Extracting plasmid from the cultured bacterial liquid, determining the extracted plasmid, performing double enzyme digestion reaction and gene sequencing to identify the reliability of the recombinant plasmid, and storing the correctly-detected strain at-80 ℃ for later use.

3.8 transfer of recombinant plasmid into Gene deficient Strain the recombinant plasmid was transferred from Escherichia coli S17 strain into Gene deficient strain VP3 using the conjugal transfer method, which is referred to as conjugal transfer in 2.2.2.8.

3.9PCR identification of Positive transformants the transferred plates were plated until single colonies grew, single clones were carefully picked, colony PCR was performed using pBBR1MCS-1-ompA-F/pBBR1MCS-1-lptD-R primers, and positive transformants were selected, and the PCR reaction program was as shown in tables 2 to 10.

4 expression of the expression vector in attenuated strains

4.1 extraction of bacterial holoprotein and membrane protein (1) monoclonal inoculation of recombinant Vibrio parahaemolyticus (gene-deleted strain) and wild strain in LBS liquid medium containing chloramphenicol, and gas bath shake culture at 37 deg.C and 200r/min for about 14 h. (2) The recombinant vibrio parahaemolyticus (gene deletion strain containing recombinant plasmid) and wild strain are respectively inoculated into 100mL of LBS culture medium according to the proportion of 1:100, proper antibiotics are added, and the air bath shake culture is carried out under the conditions of 37 ℃ and 200r/min until the OD is about 0.8. (3) The bacterial liquid is subpackaged in a centrifuge tube, balanced according to the requirements of a centrifuge and placed at the right position, and centrifuged at 6000g for 10min at 4 ℃ to collect the thallus. (4) The collected pellet was washed by suspension using an appropriate amount of phosphate buffer, re-centrifuged under the same conditions, and repeated 2-3 times. (5) And (3) resuspending the bacterial pellet washed by the phosphate buffer solution into an ultrasonic lysate with a proper volume again to obtain a bacterial suspension, and carrying out ultrasonic disruption on the bacterial suspension. (6) Centrifuging the solution after ultrasonication at 4 deg.C at 10000g/min for 15min, removing 1mL of supernatant as bacterial leucoderma, and storing at-80 deg.C. (7) Centrifuging the residual 9mL of holoprotein at 4 ℃ and 31200rpm for 1h to extract bacterial membrane protein, dissolving with membrane protein solubilizer, and storing at-80 ℃ for use.

4.2Western-Blot protein expression assay (1) SDS-PAGE was performed on total protein and membrane protein of about 50. mu.g of recombinant strain and wild strain, respectively. (2) The protein gel obtained by SDS-PAGE is subjected to membrane transformation under the parameters of 100V and 100min, and the whole membrane transformation process is carried out in ice water. (3) And (5) sealing the PVDF membrane by using 5% skimmed milk powder after the membrane conversion is finished. (4) The treatment was performed by incubating overnight at 4 ℃ using anti-lptD serum as primary antibody. (5) TBST 5 membrane washing. (6) Goat anti-mouse antibody was used as the secondary antibody and incubated for 2h at room temperature. (7) TBST washed the membrane 5 times and developed.

5 toxicity detection of virulence Gene deletion strains

Selecting five mice in each of the control group and the experimental group, and performing intraperitoneal injection on the control group by 5 multiplied by 10⁷CFU Vibrio parahaemolyticus, 5X 10 intraperitoneal injection in experimental group⁷An attenuated strain of CFU. Mice were observed for survival over time.

6 preparation of antiserum

6.1 immunization of mice with the recombinant attenuated strain five mice were selected from the control group and the experimental group, and the experimental group was injected subcutaneously with 106CFU of the recombinant attenuated strain every 7 days. The control group was injected with physiological saline. Mice were immunized a total of 4 times

6.2 after the mice are immunized by antiserum prepared by blood sampling, a needle is inserted from the lower part of the chest clavicle of the mouse, jugular vein is punctured for blood sampling, and the blood is collected into an EP tube. The EP tube is firstly placed in an incubator at 37 ℃ and placed in a refrigerator at 4 ℃ to wait for blood coagulation, the blood coagulation is centrifuged at 4 ℃ and 3500rpm for 15min, the upper serum is carefully sucked, and the blood is carefully stored at-80 ℃ so as to be used in the future experiments. And preparing control group serum as a control.

7 antiserum potency assay

After obtaining the antiserum, the titer of the antiserum was measured, and Dot-Blot was performed using the whole protein of Vibrio parahaemolyticus as a substrate for immunization with the recombinant live vaccine. (1) Dropping 1 μ L of the extracted whole protein of Vibrio parahaemolyticus on the PVDF membrane treated with methanol, placing on the filter paper soaked with the membrane transferring solution, and incubating in a constant temperature incubator at 37 deg.C for 30 min. (2) The mixture is sealed by using a skim milk powder solution with the mass fraction of 5%, and the sealing time is about 2 hours. (3) The PVDF membrane was rinsed three times with TBST solution. (4) The obtained antiserum is subjected to gradient dilution with different proportions, generally by using TBST, the diluted dilutions containing different contents of serum are used as antibodies, about 1 mu L of serum is respectively dripped on corresponding protein imprints by using a pipette gun, and the PVDF membrane with the antibodies is incubated at the constant temperature of 37 ℃ for 1.5h to ensure that the antigens and the antibodies are fully combined. (5) After incubation, the PVDF membrane was rinsed three times with TBST, immersed with 1:5000 diluted goat anti-mouse antibody after membrane washing, and incubated at room temperature for 2h to bind the primary antibody. (6) After incubation, the PVDF membrane was washed three times with TBST, developed according to the ECL chemiluminescence method protocol, and stored by photography.

8 immunoprotection evaluation of attenuated live vaccines

Mice in experimental group (using recombinant vibrio parahaemolyticus vaccine for subcutaneous injection for immunization) and mice in control group (using phosphate buffer for subcutaneous injection for immunization) are respectively injected with a lethal dose (108CFU) of vibrio parahaemolyticus wild strain in the abdominal cavity, and the survival condition of the mice is observed within a certain time.

Example 1 successful obtaining of a virulence gene vcrD2 knock-out strain (designated VP3)

The details of the method for obtaining the tdhA and vcrD1 gene knock-out strain are described in master graduate paper published in the laboratory (in Zhenzhong, Vibrio parahaemolyticus effector protein VPA1324 study on host cell immune response regulation, Zhejiang university of science, 2018).

1PCR amplification vcrD2 upstream and downstream homologous arm gene sequence and fusion PCR amplification fusion gene fragment

According to the gene sequence of vcrD2(VPA1355) in NCBI database, the upstream and downstream homologous arm fragments of the gene were amplified by using two primer pairs pRE 112-delta vcrD2-F1/-R1 and pRE 112-delta vcrD2-F2/-R2 respectively, and the results showed that the two PCR products were in agarose gel 540bp and 320bp respectively (FIGS. 2a and b). After recovery, fusion PCR was performed using pRE112- Δ vcrD2-F1/-R2 primers to obtain fusion fragments of upstream and downstream homology arms, and the sizes were determined to be consistent with the theoretical size (860bp) (FIG. 2 c).

2pRE112 plasmid double restriction and fusion fragment double restriction

And carrying out double enzyme digestion on the extracted plasmid and the fusion gene fragment obtained by polymerase chain reaction amplification by using KpnI and SacI enzymes respectively, and carrying out 1% agarose check after enzyme digestion, recovering and purifying. The results show that there is a significant band between 5000bp and 10000bp after plasmid double digestion (FIG. 3a), and the band after fusion gene fragment double digestion is below 1000bp (FIG. 3 b). The results indicate successful plasmid double cleavage.

PCR and double restriction enzyme assay of 3 recombinant plasmid pRE112- Δ vcrD2

The fusion fragment was ligated with the linear pRE112 plasmid and transformed into S17-1. lambda. pir strain, after screening with LB (25ug/mL Chl) solid plates, single clones were picked up on the plates and PCR was performed using pRE 112-. DELTA.vcrD 2-F1/-R2 to verify whether the single clones were positive transformants, which indicated successful screening of positive transformants (FIG. 4 a). Screening and carrying out amplification culture on an S17-1 strain containing the recombinant plasmid according to the PCR result, extracting the plasmid and carrying out double enzyme digestion to detect whether the recombinant vector contains a segment of the target gene, wherein the double enzyme digestion result shows that the sample subjected to double enzyme digestion treatment can have two bands, one band is slightly bright and is positioned at the position of about 5000-10000bp, the other band is darker and is positioned at the position of about 800-1000bp, and the two bands correspond to the position of the linear pRE112 plasmid and the position of the fusion gene segment (figure 4b), so that the construction of the gene knockout plasmid is completed. The sequence comparison analysis shows that the gene sequence is completely consistent with the fusion fragment gene sequence, which indicates that the gene knockout vector pRE 112-delta vcrD2 is successfully obtained.

4 first round of recombinant screening

As described above, the successfully constructed pRE 112-. DELTA.vcrD 2 plasmid was transferred into a Vibrio parahaemolyticus gene-deleted strain (. DELTA.tdhA,. DELTA.vcrD 1) by the gene transfer method of conjugative transfer to perform gene knockout. The first round of recombination screening after the joint transfer is carried out by upstream and downstream homology arm primers and fusion fragment primers of a target gene. The fact that the peripheral primers cannot amplify a band and the fusion fragment primers can amplify two bands indicates that the first round of recombination succeeds, but in view of instability of colony PCR, operation requirements and small probability of gene recombination, the upstream and downstream homology arm primers of the target gene can be used for PCR amplification of a colony with the length of 860bp, namely, the second round of recombination is carried out. A portion of the single clones were screened for use in the second round of recombination (FIG. 5).

5 second round of recombinant screening

And (3) carrying out secondary recombination on the monoclone successfully recombined in one round under the pressure of sucrose, and checking the result of the secondary recombination in a PCR way after passage for a plurality of times, namely whether the gene knockout is successful or not. Three conditions are required to be met for judging whether gene knockout is successful: (1) only one short band lacking the target gene can be amplified by using peripheral primer PCR; (2) the target gene primer can not be used for amplifying a band; (3) the sacB primer for the negative selection gene on the pree 112 vector failed to amplify a band. Firstly, using peripheral primers, checking whether a gene deletion strain capable of amplifying a short band exists in the subcultured bacteria liquid through bacteria liquid PCR, further screening through TCBS (10% sucrose), and screening out a strain with a successful gene knock-out through colony PCR. The results show that two bands can be amplified by using peripheral primer PCR in partial bacterial liquid after passage (FIG. 6a), and a monoclonal clone with successful vcrD2 gene knockout can be successfully screened after screening (FIGS. 6b, c and d). These results all indicate that in the newly obtained strain, virulence gene vcrD2 could not be detected by PCR, indicating that vcrD2 was successfully knocked out and virulence of the attenuated strain was further attenuated at the molecular level.

Example 2 successful construction of the vector pBBR1MCS-1-ompA-lptD

1PCR amplification of lptD gene fragment and overlapping extension PCR to obtain ompA-lptD gene fragment

The 748bp-1343bp gene fragment (249 bp-781bp fragment corresponding to lptD protein) was PCR amplified using primers (see table 2-1) based on the lptD whole gene sequence and the three-dimensional structure of lptD displayed on NCBI with VP genome as template (fig. 7 a). Then, the DNA sequence having the lpTD fragment and the signal peptide of the outer membrane protein OmpA was coupled (synthesized) by overlap extension PCR, and it was revealed that the lpTD gene fragment containing the ompA signal sequence was successfully obtained (FIG. 7 b). The fusion gene fragment and the pBBR1MCS-1 plasmid obtained need to be cut by using corresponding restriction endonuclease and then can be subjected to the next ligation experiment, and the experimental result is shown in FIG. 7 c. The ompA-lptD fusion gene segment is successfully amplified and subjected to double enzyme digestion, and a pBBR1MCS-1 plasmid vector is also successfully subjected to enzyme digestion, so that the ompA-lptD fusion gene segment can be used for subsequent experiments.

Construction of plasmid pBBR1MCS-1-ompA-lptD

The ompA-lptD gene fragment is connected with the plasmid pBBR1MCS-1 after enzyme digestion to obtain a recombinant vector, the recombinant vector is transformed into an escherichia coli S17-1 strain, and the results of PCR verification by colony PCR and upstream and downstream primers of the ompA-lptD gene fragment show that two colonies which possibly contain the recombinant plasmid are successfully screened (figure 8 a). The two colonies are transferred to a new LB culture medium for amplification culture, plasmids of the two colonies are extracted, the purified plasmids are subjected to double enzyme digestion verification (figure 8b) by using corresponding restriction endonucleases and are sequenced, as shown in the figure, the result shows that a lane has a band at the position of 5000bp and a bright band with the size of about 1700bp, and after sequencing, the gene sequence obtained by sequencing is completely consistent with the gene sequence of a target fusion fragment, which indicates that the pBBR1MCS-1-ompA-lptD recombinant vector is successfully constructed.

3 transfer of the recombinant vector pBBR1MCS-1-ompA-lptD to knock-out Strain VP3

The pBBR1MCS-1-ompA-lptD vector was successfully constructed and transferred to S17 strain, the recombinant plasmid was transferred to knock-out strain VP3 by conjugative transfer, PCR screening was performed after screening by TCBS (25. mu.g/mL Chl), and positive transformants were selected for expression of the target protein after screening with upstream and downstream primers of ompA-lptD gene fragment (FIG. 9).

Example 3 achieving expression of the lptD fragment on the outer Membrane of Strain VP3

To achieve expression of the lptD fragment on the outer membrane of strain VP3, the present study fused the signal peptide of the outer membrane protein OmpA to the N-terminus of the lptD fragment. The expression vector pBBR1MCS-1-ompA-lptD constructed above was transformed into an attenuated strain VP3, an attenuated expression strain was obtained and named VP4, cytoplasmic proteins and membrane proteins of VP and VP4 were extracted separately, and expression of lptD fragment was detected by Western Blot, which revealed that lptD fragment did not show a clear band in cytoplasmic protein sample and a clear band was detected in membrane protein sample (FIG. 10), indicating that lptD fragment was expressed on the membrane of VP4 strain.

Example 4 virulence detection of strains after virulence gene knockout and serial passage

The VP4 strain is a strain containing an expression vector and knockout of a plurality of key virulence genes, and in order to discuss the possibility of the strain as a recombinant attenuated live vaccine, the toxicity of the gene knockout strain VP4 is firstly detected. Respectively mixing 5 × 10⁷The VP and VP4 strains of CFU were injected into the abdominal cavity of mice, and the survival of the mice was observed. As a result, it was found that all mice injected with VP3 strain survived, whereas all mice injected with VP strain had a mortality of 100% within 24 hours (FIG. 11). The result shows that after three key virulence genes tdhA, vcrD1 and vcrD2 are knocked out and are continuously passed for nearly 100 generations, the virulence of vibrio parahaemolyticus is greatly reduced, and the phenomenon of virulence reversion is not found in the process of passing for 100 generations, which indicates that the knocked-out strain can not cause damage to immune animals as an attenuated vaccine and can be used as a vector of a recombinant attenuated live vaccine.

Example 5 antiserum titer detection after immunization with recombinant live attenuated vaccines

In order to preliminarily detect the immune protection of the recombinant live attenuated vaccine, the recombinant live attenuated vaccine is used for immunizing an ICR mouse, and after antiserum is obtained, the titer of the antiserum is measured. Dot-Blot analysis was performed using the whole protein of Vibrio parahaemolyticus as a substrate, and the results are shown in FIG. 12. The results show that antiserum can still bind to the protein of Vibrio parahaemolyticus at a dilution factor of 5000 and is significantly stronger than the non-specifically bound control serum (immunized with PBS). This demonstrates that antibodies are successfully obtained in animals after immunization with recombinant live attenuated vaccines, providing the basis for further immunoprotection analysis.

Example 6 immunoprotective assay of VP4

To initially detect the immunoprotection effect of the recombinant live attenuated vaccine VP4, mice were immunized for a period of time at an immunizing dose of about 10⁸CFU/mouse (dilution is PBS buffer solution passing through 0.22 μm filter or physiological saline passing through 0.22 μm filter), then the mice are injected with a lethal dose (5X 10)⁷CFU) (RMID 2210633), and observing survival of mice within one week after injection, wherein the results show that mice in an unimmunized control group die completely within 8h after injection, and mice in an experimental group have no adverse reaction; within one week after immunization, no death was seen in the experimental group mice, and the status of the mice was always good, i.e., the immune protection rate for the mice was 100% (fig. 13). The results show that the recombinant attenuated live vaccine developed by the research has good immune protection effect and canFor use in attenuated live vaccines, and for subsequent further study.

In addition, the laboratory uses antiserum generated by the recombinant attenuated vaccine immune mouse constructed in the research to carry out western blot detection, and the antiserum can not only carry out immunoreaction with vibrio parahaemolyticus membrane protein, but also carry out stronger immunoreaction with membrane proteins of vibrio alginolyticus and vibrio vulnificus (the specific result is shown in figure 14).

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.

Sequence listing

<110> Zhejiang Hongshan Cheng Biotechnology Ltd

<120> vibrio parahaemolyticus gene deletion attenuated strain, recombinant vibrio parahaemolyticus attenuated live vaccine, preparation method and application thereof

<160> 5

<170> PatentIn version 3.5

<210> 1

<211>933

<212>DNA

<213> tdhA Gene sequence

<400> 1

gaattcacga cgaatcggag ccaaaattct tcggtgattt cagctatcta ccaagcgata 60

aggcattaat ggccatgtta ccgcttgagg aatcacagat gacgttgatt attcttttac 120

gcaacaaagc ctcatagagt tgtaagcact atcaaagatt tcaagaagtg ttttttttca 180

tgattattca gtttactttt ttgggttttt tggctttcat gaaacctgcc attctggcaa 240

agttattaat caattcagag gtttttttat gaagtaccga tattttgcaa aaaaatcatt 300

tttatttata tccatgttgg ctgcattcaa aacatttgcc tttgagcttc catctgtccc 360

ttttcctgcc cccggttctg atgagatatt gtttgttgtt cgagatacaa cttttaatac 420

caatgcaccg gtcaatgtag aggtctctga cttttggaca aaccgtaatg taaaaagaaa 480

accgtacaaa gatgtttatg gtcaatcagt attcacaacg tcaggtacta aatggctgac 540

atcctacatg actgtgaaca ttaatgataa agactataca atggcagcgg tgtctggcta 600

taagcacggt cattctgctg tgttcgtaaa atcagatcaa gtacagcttc aacattccta 660

tgattctgta gctaactttg ttggtgaaga tgaagattct attccaagta aaatgtattt 720

ggatgaaact ccagaatatt ttgttaatgt agaagcatat gagagtggta gtggtaatat 780

attggtaatg tgtatatcca acaaagaatc gttttttgaa tgtaaacatc aacaataaaa 840

ataaaaagcc acagaatatt ctgtggcttt gaaaatgatt aataataatt tctaatttat 900

gcatgccaat gcaaaactag attgagtacg tgt 933

<210> 2

<211>2118

<212>DNA

<213> vcrD1 Gene sequence

<400> 2

atgaataagt tgatcgatat tctaaacaag gtagggcaac gcaaagacat catgctcgca 60

gtgatgttgc tggcgatcgt ctttatgatg attttgcctt tgccaactgc actagtggat 120

gtgctgatcg gcgcaaacat gagtattgcc gtcgtgttgc tgatgttggc gatttacatc 180

accacgccac tggagttttc ggcgtttccg gcagtattgt tgataacgac gctatttcgt 240

ttgtccctgt ctatcaccac gacacgtttg atcctgcttc aaggcgatgc gggtcaaatc 300

gtttacacct ttggtaactt tgttgttggc ggcaaccttg tcgttggtat cgtggtcttc 360

ctgatcataa ctattgtaca gtttatggtg atcaccaaag gttcggagcg tgttgctgaa 420

gttagtgctc gattctctct tgatgccatg ccgggcaaac agatgagtat cgacggtgac 480

atgcgcgctg gagttatcga tgttcacgag gcgcgtcatc gccgttctct gatcgagaaa 540

gagagtcaaa tgtacggctc gatggacggc gcaatgaagt tcgtaaaagg cgactccatt 600

gcgggcttgg tgatcatcat cgtgaacatc ttgggtggcg tcaccattgg cgtcacgcaa 660

aaaggcatga gcgcgtcaga ggcgcttgag ctgtttgcga ttttgaccgt aggggatggc 720

ttggtatcgc agattcctgc gctatttatc gcgatcaccg ctggtattat cgttacgcgt 780

gtttcccacg aagactcggc cgacttgggc tccgacattg gcgggcaagt cacggctcag 840

cctcgagcac tgttgattgg tggtgtgctg ctggtcttgt tcgctctgat ccctggcttt 900

ccgaaaatta cattcctagt gctggctttg gtggtcggtg gcggcggttt ttacctcttc 960

tatcaacaga aaaagcaaac cgaatcagaa agcagcgatc tgccgagctt tgtcgcgcag 1020

ggagcgggtt ctcctgccgc aaaacccaat aaaccaacgc cgtctcgtgg tagcaaaggc 1080

aaattgggcg agcaagaaga gtttgcgatg acagtgccac tgcttatcga tctggattca 1140

agcttacaag aaagcctaga agccgtcgca ctgaacgacg aactcgccag agtaagacgc 1200

gcgttgtatc tcgatcttgg tgtaccgttt ccgggaattc acctgcgttt taacgacggg 1260

atgaaaaacg gcgaatactt gattcagttg caagaagtgc ccgttgcacg tggtcgtatt 1320

gagaaagaca aattgctggt cacagaagga agcgaccaga ttgagttgct tggtgtgccg 1380

tttgagcaag atgacgactt cctcccggga gtctcgagtc tttgggtcgc acaaagctat 1440

caagagaagt tgactgcgag ccatgtcggc ttccttacac cagatcgtat tttgacgttc 1500

catctatcac acgtattgaa agagtacgcg caagatttta ttgggattca agaaactcgc 1560

tacctacttg agcaaatgga aggcagttat tctgaattgg tgaaagaggc gcagcgcatc 1620

gtcccgctac aaaaaatgac ggagattttg caacgtttgg tatctgagga catttcgatt 1680

cgtaaccttc gcgtcatttt ggaggccatg gtcgagtggg gacaaaagga aaaagatgtc 1740

gttcagttga cggaatacat tcgttcaagc ttaaagcgtt acatctgtta caagtacgcg 1800

agcggtcaga acatgctgcc ggcgtacctt ctcgatcaga gcctcgaaga cacgattcgc 1860

agcggtattc gacaaacctc ggcgggcagc tacttagcgc ttgacccttc ggttacgcag 1920

caatttgtta gcgacgtaaa acagaccgta ggcgatttaa gccgtatgcc gaacaagcct 1980

gttctggtgg tttctatgga tgtgcgtcgt tatgttcgaa agctgattga atccgaatat 2040

tacgatttgc ccgttctatc gtttcaagaa ctcactcagc agatcaacat tcagccactt 2100

ggacgggtag ggatgtaa 2118

<210> 3

<211>1887

<212>DNA

<213> vcrD2 Gene sequence

<400> 3

atgatttcaa aactacgtaa ttcaacacta ctatttaatc caagtagtgt gatgattgca 60

tttttgctac caacaatcat attggtaaca ctgcctggtg tggtcatcga cttttttttg 120

ttgattagct ttgtaagctc agcgttgctg ttgattatca tgctagaaaa cgaccaaccg 180

ctgaaagtta catttttacc tacaatggta ttacttttaa ccacgtttcg actgttgtta 240

tctattgcta cgacaagaaa catcatcgca aacgaagatg taggccgagt tattgagacg 300

attggtgagt tcgtgatggg gggaaaccta atctcgggtc ttttgatctt cgtcattatt 360

actattgtac agtttctcgt tgtgacaaaa ggtggtgaac gtgttgccga ggtaggtgcg 420

cgattctcgt tagatgcttt acctggtaag cagatgacca ttgatgggga cctgaaaagt 480

ggtcttattt ccggagagca ggctcaaaag cttcgtgctg atctcggtac ggaaaacaaa 540

ctgtttggtt cactagatgg agcgatgaag ttcgtaaaag gtgacgcgat tgctggtatc 600

ctgatcagcc ttgtcaactt gtttggtgga atttatgtgg gcatcaacca gtttgatttg 660

tcgctgtcgg agagcgtgaa gcgattctcg gtacttacga ttggggatgg ccttgtttca 720

cagataccga gtttgttgtt atcaatggca tgtggtgttt atctgactcg tattaaaggc 780

tcggaagacg aatccagttc gtttataagc caaatgatgg cgcagattag aacattctgg 840

aagagtcttt tagtggttgg tgtagtgatt atgctaattg gcctactaaa tccaacatta 900

atgtatgtct gtttgccact tgctgtgctc tgcgtagtta tggctttatt gctttggaaa 960

aaaaatggaa acaacagtgt tgctgtaaag tttgagccag aaggaagtgg tgttttcgaa 1020

tctctaaaat ttgtatttcg tgatgggcaa tatcaaagcc taatcaaaaa acgcctgaag 1080

gctgttgaag agagagtttg gggacaagcg ttaggtgaac cagcggtgct tgtagatcct 1140

gatttagatg ttgatatcgc agtgtatatt tcgggtatac aaacgtacca attttctcaa 1200

agctcggctg aaggcatcgt ggaaatatta aatgatgaca catttaatct gcatgatgac 1260

ttgagttcaa acttggatga aattattagt tatttcattc aaacgagact cattgaaaaa 1320

tacaatttac aacatagctg taacattgtc gcagaattag cttcacagag tgaaatcatg 1380

aagagtgaaa ttgattctgc tgttggttta aatcgtgttc atgatgttct gaaacaaatg 1440

attcgttctc cagaatttta tttggaccga gtaagctttt ttgaatctct tatttattgg 1500

tcgagagttg aaaatgatcc taggaactgg ctcacacgga ttcgacatca agctaggtac 1560

gaaattaccg ctcgcttatt aaatagtgat ggaaaggttc acgtaatgtt gcttagtcct 1620

gaactgactg aggaaattag tgggtatgta gcaggtgagt ttgaagactt tgagagactg 1680

attgagatcc agaaagcact aaaatcagaa atcaagcgtt tacttctatc tcataagaat 1740

agacctgtgt tagttgtgaa cgataatgaa cttaacgttg ttaaaacatt tgttcaacaa 1800

gtcatgtcaa cgctaatcgt ttgtagccat agtgatattg tagacaacaa ttgcatatct 1860

agttcagagg taattaacat acaatag 1887

<210> 4

<211>906

<212>DNA

<213> ompA Gene sequence

<400> 4

atgaaaacga cgattcgctt gttgagcggc attatgattg gtgcattgtt agcaggttgc 60

gctaccgaaa cttacgtgag ccaagaaaac cgagagaaat tcgccgatgt gaatgtctct 120

aaatttctta ttagtgagtg cttagcgccg cagcgagaaa ttcatattgc cgttgcagag 180

cactttgatt tcgacaaatt caagattcga gaagcagatg cgacaagtct ggatgcgttt 240

attcgcgata ttcaaggttt aagcggacgc attaccattg tcggtcacac tgattacaaa 300

ggttcaaacg agtacaacga cgcgctttct ctgcgccgag cacaatccgt tgcggcgtac 360

ctcaagcagc agcttgatcc cactttttat gattgggaga ttaagcactt tggcgagact 420

caaccgctta cgctcgatac ttcagatcaa gcgcgtgccg aaaaccgccg agcgtacgtc 480

atgtttgagg aggcgcaaaa atacgatgag atgccattct gcgaacctcc aaagccagag 540

cgtaaggttt atatgaccat gacgccacac tttgactttg atcagtcaga gttgaaagct 600

gaagatctca ctcagctcga tgatttcatt gaacagttac aagggttaga aggcagcatt 660

ttggttgcag ggcacactga tcaagtcggc tcgctttctt acaatgaaaa attggcagag 720

cgacgagctc aaactgtggt cgaatatctc aagaccaaac ttgatgcgtc gcggcttgtt 780

tgggaggtca aagcgtttgg tgaactgcaa ccggtcataa atcaaacgac ttcggaagca 840

aacgcactga atcgacgtac ctttatcgta tttaaagaga gtgaacacgg acaactgaca 900

gaataa 906

<210> 5

<211>2346

<212>DNA

<213> lptD Gene sequence

<400> 5

atgcaacatt tctcccgcac atttttagcg gcctctatca gcaccgcctt gtttgtaccc 60

accactcaag ctgaagcgaa tatcaatgat agtgtgcagg aaatgcccat cacagatcaa 120

tgtttggtcg agacaagtgg tgaggaggac gcgctaaatt ccccagtcgt agtacaagct 180

gatagtcttc aggcgatcaa tggcgacaaa gcccaatact ccggcaacgt agaagtgacg 240

caaggaccaa agaagattac tgcggatagc gtgacacttc atcagcaaga caatgtagtg 300

gtagcggaag gtaacgtaac cttcaatgac ggtaaggtga aggcgcgctc tgatcgtgtc 360

accaacgaca tcaaccgaga taccttctcg ctagaaaata ccgactacca attcctttgc 420

cagcaaggtc gaggtaccgc agcgtatatc gcacgtacgg gtcaatccgt ttatgagctg 480

gaagacggct ctatcacatc atgccctcaa ggcgataact cttggcgatt agtcgcatca 540

ggtattgatg tcgaccaaga tgaagaaacc gctacactgc accaccctcg ttttgaagta 600

ttggacgttc ccgtttttta cgtaccgtac ttaacaatgc caattggtga tacgcgtaag 660

acaggtttcc tattcccttc tctgtcgtat ggctccaacg atggtatgga agttgagatt 720

ccattctatt ggaacatcgc gcctgagtac gacatgacga ttaccccgtt atacatgcag 780

aagcgtggta acaagctcga cgctgatttt cgttacctaa ccgatggttg gggacaaggt 840

gaaatcaaag gcgagtacat gaacagcgac aagaagtaca acgacgagtc gcgttggggt 900

taccagttca aacatgaagg catcatcaac aagcaatggt tagtcaactt agactactcc 960

aaagtcagcg atattgatta cttccgagat ctcagctctg atattggtaa ccgagaagat 1020

ggtcagttgc ttcaagaagg tgaagtacaa taccgttcga atttctggga tgcatcactg 1080

cgagttcgtg atttccaaat cctacttcaa gacgagaacc aaccataccg tctgctgcct 1140

cagttggatt tgaactacta cacaccactc atgggcaatt acgttaactt tgacgtgaag 1200

agccaaatca gccgctttga tactgatgat acagctaagc ccgatgcaac tcgtgttcac 1260

gtagagccag gtcttactat cccgctttcg aactcatggg cgacatggac tacagaagct 1320

cgtgtcctat cgacatacta ctctcaagac ttaacagggc taacagatac taatttacgc 1380

aaccagcttg atgaaaacgt atcacgcgtc atcccagagt tccgtacgca tgcgcgtatg 1440

tatctagagc gtgacactag ctggattgaa ggctacacac aaacgctaga gcctcagttg 1500

cagtacttgt atgtccctga agaagatcag acgaacatct acaactacga taccaccttg 1560

ctgcaaactg actactatgg tctattccgc agccgtaaat acagtggcat tgataagatc 1620

gcatcagcaa accagttgag ttacggtgca agtactcgat tctttgatga tgactataaa 1680

gagcgcctca atatctcgtt tggtcagatc tactacttcg ataagaaaac caagatcagt 1740

aacagtccta gcgtgccaga tgagacctca aactactcat cttgggctat tgaaacagac 1800

ttcaactaca acgattacct gttctaccac ggcggtattc aatacgacat tgatttgagc 1860

gcaatgcagc ttgctaacag cacgctggaa taccaattca atggtggttt tgttcaaggt 1920

aactaccgtt acgtcactcg agaatacatc gaagatacga tcattctcga aaacctagat 1980

acgatcactc gtaaggggat ttcacaagcg ggtattgtag cggcttacga gttcaaccca 2040

agctggtctg caagtggtca gtactactat gacctgaatg aaaacattga tatggaatgg 2100

ttggcgagcg tgcgctacca atctgactgt tggtactttg gtttgacata ttccaaccaa 2160

ctgcttggct gggatgaaaa agccatcggc agtgctggcg catcaccaaa atacgaaaac 2220

aacatcagcg tgaactttgg tattcaaggt tttgcaacca accaacgagc tgatactgcg 2280

gcgaaagagc ttgatggctc agacaacgca atcaaatacg gtcgtccatt ctatttgaac 2340

aattaa 2346

Claims

1. A vibrio parahaemolyticus gene deletion attenuated strain, which is characterized in that the vibrio parahaemolyticus gene deletion attenuated strain does not contain tdhA, vcrD1 and vcrD2 genes; the vibrio parahaemolyticus gene deletion attenuated strain also comprises a recombinant vector capable of efficiently expressing lptD protein on the outer membrane of the vibrio parahaemolyticus gene deletion attenuated strain; the recombinant vector capable of efficiently expressing the lptD protein on the outer membrane of the vibrio parahaemolyticus gene deletion attenuated strain is pBBR1 MCS-1-ompA-lptD.

2. The attenuated strain of vibrio parahaemolyticus gene deletion of claim 1, wherein the tdhA gene is as set forth in SEQ ID No. 1; the gene vcrD1 is shown as SEQ ID.NO2, and the gene vcrD2 is shown as SEQ ID.NO3.

3. The attenuated strain of vibrio parahaemolyticus gene deletion of claim 1, wherein the ompA gene sequence is shown in seq id no 4; the lptD gene sequence is shown in SEQ ID.NO5.

4. A method for preparing the attenuated strain of vibrio parahaemolyticus gene deletion of any one of claims 1 to 3, comprising the steps of:

1) knocking out tdhA, vcrD1 and vcrD2 genes of vibrio parahaemolyticus to obtain vibrio parahaemolyticus without tdhA, vcrD1 and vcrD2 genes;

2) constructing a pBBR1MCS-1-ompA-lptD vector, transferring the vector to the vibrio parahaemolyticus in the step 1), and screening to obtain a vibrio parahaemolyticus gene deletion attenuated strain of the lptD protein efficiently expressed on the outer membrane.

5. A recombinant attenuated live vaccine of Vibrio parahaemolyticus, comprising the attenuated strain of Vibrio parahaemolyticus gene deletion of claim 1 and a pharmaceutically acceptable diluent.

6. The live vaccine of claim 5, wherein each head of the live vaccine contains attenuated strain with Vibrio parahaemolyticus gene deletion at a concentration of 10⁸CFU。

7. A live vaccine according to claim 5, wherein the pharmaceutically acceptable diluent is PBS buffer over a 0.22 μm filter or physiological saline over a 0.22 μm filter.