CN113058028A - Preparation and application of composite nano-medicine - Google Patents
Preparation and application of composite nano-medicine Download PDFInfo
- Publication number
- CN113058028A CN113058028A CN202110347258.9A CN202110347258A CN113058028A CN 113058028 A CN113058028 A CN 113058028A CN 202110347258 A CN202110347258 A CN 202110347258A CN 113058028 A CN113058028 A CN 113058028A
- Authority
- CN
- China
- Prior art keywords
- msn
- stirring
- composite nano
- drug
- nano
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1706—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6949—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit inclusion complexes, e.g. clathrates, cavitates or fullerenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/5115—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/5123—Organic compounds, e.g. fats, sugars
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5192—Processes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Optics & Photonics (AREA)
- Physics & Mathematics (AREA)
- Nanotechnology (AREA)
- Biomedical Technology (AREA)
- Marine Sciences & Fisheries (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Inorganic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to preparation and application of a composite nano-medicament. The invention constructs an LMSN-AS1411 nano drug-carrying system by synthesizing mesoporous silica and taking the mesoporous silica AS a carrier and a nucleic acid aptamer AS1411 AS a gating molecule to cover an 'object molecule' antibacterial peptide in mesoporous silica nano particles (MSN). The invention can improve the targeting property of the nano-carrier, reduce the leakage rate of the drug and provide a new choice for developing a new nano-carrier for treating cancer.
Description
Technical Field
The invention belongs to the technical field of nano material preparation, and particularly relates to a preparation method and application of a composite nano medicine. The invention firstly uses the synthesized mesoporous silica AS a carrier and uses aptamer AS1411 AS a gating molecule to seal and cover antibacterial peptide Ldehamp 2-3 of a guest molecule in Mesoporous Silica Nanoparticles (MSN) to construct a LMSN-AS1411 nano drug-carrying system. The invention can improve the targeting property of the nano-carrier, reduce the leakage rate of the drug and provide a new choice for developing a new nano-carrier for treating cancer.
Background
Nanotechnology is the discipline of designing, synthesizing, characterizing, and applying materials or devices with at least one dimension in the nanometer scale. In recent years, with the deepening of the morphology control technology of nano materials and the continuous cognition of molecular layer to disease mechanism, the treatment method based on nano particles makes a breakthrough in the treatment of diseases such as cancer, asthma, diabetes and the like.
The nano drug delivery system is a submicron-level drug carrier delivery system which is formed by taking nano particles as basic units. The characteristics of small size effect, large specific surface area and the like of the nano material enable the nano material to have unique advantages in the aspects of solubility, in-vivo circulation time, biocompatibility and the like compared with bulk phase materials, and the nano material is beneficial to overcoming the limitations of the traditional diagnosis and treatment means. The nano drug carrier can also protect drug molecules, isolate the drug molecules from the surrounding environment and prevent the inactivation of the drug; the targeted delivery of the medicine can be realized, so that the medicine can selectively target cells, and the toxicity to normal cells and tissues is effectively reduced.
The mesoporous silica nanomaterial is an inorganic silica nanomaterial with a regular pore structure. Due to its large specific surface area (>900 m2/g), adjustable pore diameter, uniform distribution and larger pore volume (>0.9cm3/g), easy surface modification, high stability, good biocompatibility and the like, and can be widely applied in the fields of catalytic separation, sensing, biomedicine, environmental protection and the like.
At present, researches carried out by taking mesoporous silicon as a drug carrier mainly focus on the use of mesoporous silicon dioxide as a platform to construct a carrier with stimulus response to realize the controllable release of drugs. By constructing a controllable release system, such as a pH response controlled release system, an oxidation-reduction response controlled release system, a biomacromolecule response controlled release system and an external stimulus response controlled release system. When the nano-carrier reaches the action site of the drug, the release of the loaded drug is realized through specific internal or external stimulation factors, so that the leakage of the drug at the non-action site is reduced, the utilization rate of the drug is improved, and the toxic and side effects are reduced.
The antibiotic peptide is a kind of natural small molecular polypeptide existing widely in various organisms, is a component of natural immune system, and has the functions of resisting exogenous microbe, eliminating pathological change cell in vivo, etc. With the progress of research, the antibacterial peptides have been paid attention to their antitumor activities. Research shows that the antibacterial peptide can intervene in cervical cancer, lung cancer, bladder cancer, liver cancer, lymphoma, thymus cancer, leukemia and the like. The research also proves that the antibacterial peptide has obvious cytotoxicity effect on various cancer cell lines including melanoma, breast cancer, lung cancer, lymphoma and leukemia, but has no killing effect on normal cells, shows selectivity on tumor cells and normal cells, and has good application prospect in the aspect of tumor treatment.
Aptamer (aptamer) is a concept proposed by Szostak et al in 1990. The aptamer refers to single-stranded DNA (ssDNA) or RNA which can be obtained by in vitro screening through the Systematic evolution of ligands by exponential enrichment (SELEX). The target range of aptamers is wide, including proteins, polypeptides, small molecules, cells, bacteria, and even tissues.
AS1411, also known AS GRO29A, is a guanine-rich oligonucleotide sequence 5'-GGT GGT GGT GGT TGT GGT GGT GGT GG3' consisting of 26 bases that inhibits the growth of a variety of tumor cells with little effect on normal cells. Research shows that AS1411 has good anti-tumor activity and can inhibit tumor cell proliferation in more than 80 tumors such AS nasopharyngeal carcinoma, liver cancer, breast cancer, lung cancer and the like. More importantly, AS1411 can specifically recognize nucleolin molecules overexpressed on the surface of tumor cells and selectively concentrate AS1411 in the tumor cells in a receptor-mediated endocytosis manner. Currently, in nucleolin-based targeted therapy, AS1411 AS a drug delivery carrier of targeting molecules is one of the most widely studied and most effective targeting strategies.
Therefore, the LMSN-AS1411 nano drug delivery system can be constructed by preparing mesoporous silica nano particles and utilizing a G-4 structure formed by the AS1411 aptamer and the DNA-1 to block MSN pores encapsulating the antibacterial peptide Lchamp 2-3. The drug-loading system can improve the targeting property of the nano-carrier, reduce the drug leakage rate and provide a new choice for developing a new nano-carrier for cancer treatment.
Disclosure of Invention
The invention aims to provide a preparation method and application of a composite nano-medicament; the antibacterial peptide Lchamp2-3 is encapsulated by MSN, and the aptamer AS1411 is used AS a gating molecule to obtain the composite nano-drug system. The prepared composite nano-drug system can be used for treating tumor cells.
In order to achieve the purpose, the invention also adopts the following technical scheme:
a preparation method of a composite nano-drug comprises the following steps:
step S1: synthesizing mesoporous silicon dioxide MSN particles, and performing amination modification on the prepared mesoporous silicon to obtain aminated mesoporous silicon MSN-NH2Then in MSN-NH2Modifying the carboxyl and ssDNA-1 to obtain DNA coupled nanoparticles MSN-DNA 1;
step S2: mixing the antibacterial peptide Lchamp2-3 and MSN-DNA1 in the same volume, and oscillating at room temperature to enable the antibacterial peptide to enter the micropores of the MSN through diffusion to obtain LMSN; and then adding a proper amount of AS1411 into the LMSN solution to enable the DNA-1 and the AS1411 to be fully combined to form LMSN-AS1411 so AS to plug MSN micropores.
The method specifically comprises the following steps:
step S11: hexadecyltrimethylammonium chloride, triethylamine and H2Heating and stirring the mixed solution of O, dropwise adding tetraethyl orthosilicate, stirring the mixture on a magnetic stirrer to obtain a crude product, treating the crude product by using a methanol solution of ethanol and NaCl to remove redundant hexadecyl trimethyl ammonium chloride, washing the crude product by using ethanol and secondary water, and freeze-drying the crude product to obtain MSN powder;
step S12: mixing MSN with ethanol and 3-aminopropyltriethoxysilane, stirring at room temperature, washing with ethanol and water, and lyophilizing to obtain MSN-NH2。
Step S13: adding MSN-NH2Adding N, N-dimethylformamide solution into succinic anhydride, stirring under nitrogen, washing with ethanol and water, and lyophilizing to obtain MSN-COOH.
Step S14: dissolving MSN-COOH in MES buffer solution, adding EDC and sulfonic acid-NHS, stirring at room temperature, adding PBS buffer solution, adding ssDNA-1, and stirring at room temperature to obtain MSN-DNA 1.
In the step S11, the final concentration of hexadecyl trimethyl ammonium chloride in the mixed solution is 0.3125M, and the final concentration of triethylamine is 0.01M; the final concentration of tetraethyl orthosilicate is 0.335M; the mass fraction of the methanol solution of NaCl is 1.0%.
Step S11, heating, stirring and reacting at the temperature of 95 ℃ for 1-2 h; the stirring temperature of the magnetic stirrer is 95 ℃, and the reaction time is 4-6 h.
The final concentration of the 3-aminopropyltriethoxysilane solution used in the step S12 is 0.085M, and the stirring time is 24-36 h.
The succinic anhydride solution used in the step S13 has a succinic anhydride final concentration of 0.5M and is stirred for 4-6 hours.
The EDC concentration used in step S14 is 10mg/mL, and the sulfonic acid-NHS concentration is 10 mg/mL; the stirring time is 10-30 min; adding ssDNA-1 at a concentration of 100 mM; the stirring time is 4-8 h.
The concentration of the antibacterial peptide in the step S2 is 1 mg/mL, and the concentration of the MSN-DNA1 is 1 mg/mL; the oscillation time is 48-72 h.
Further, the composite nano-medicament is obtained by the preparation method and is applied to preparing tumor treatment medicaments.
The invention has the beneficial effects that: the invention firstly uses the synthesized mesoporous silica AS a carrier and uses aptamer AS1411 AS a gating molecule to seal and cover antibacterial peptide Ldehamp 2-3 of a guest molecule in Mesoporous Silica Nanoparticles (MSN) to construct a LMSN-AS1411 nano drug-carrying system. The invention can improve the targeting property of the nano-carrier, reduce the leakage rate of the drug and provide a new choice for developing a new nano-carrier for treating cancer.
Drawings
FIG. 1 is a diagram of the MSN particle size of the composite nano-drug of the present invention;
FIG. 3 is a MSN infrared spectrum of the composite nano-drug of the present invention;
FIG. 4 is an atomic force microscope image of the MSN of the composite nanomedicine of the present invention;
FIG. 5 is a MSN transmission electron microscope image of the composite nano-drug of the present invention;
FIG. 2 is a potential diagram of the synthesis process of the composite nano-drug of the present invention;
FIG. 6 is a polyacrylamide gel electrophoresis image of the composite nano-drug of the present invention;
FIG. 7 is a diagram of flow cytometry detection of cellular uptake of the composite nanomedicine of the present invention;
FIG. 8 is a diagram of the cell uptake of the composite nano-drug by confocal microscopy.
Detailed Description
For further disclosure, but not limitation, the present invention is described in further detail below with reference to examples.
Example 1
A preparation method of a composite nano-drug comprises the following steps:
(1) synthesizing MSN: 10mL of 0.625M CTAC and 10mL of 0.02M TEA were mixed and stirred at 95 ℃ for 1 hour. Tetraethyl orthosilicate (TEOS, 1.5 mL) is added dropwise and uniformly, stirring is carried out continuously for 4-6 h at 95 ℃, centrifugation is carried out for 15 min at 13000 rpm, and the mixture is washed by ethanol. The product was then placed in 20 mL of 1.0 wt% NaCl in methanol, stirred at room temperature for 4-8 h, and centrifuged to remove excess CTAC. The product was then washed with ethanol and secondary water, respectively. And (5) freeze-drying to obtain MSN powder.
(2) Synthesis of MSN-NH 2: adding 100mg of MSN into 20 ml of ethanol, adding 400 mu L of APTES, stirring the mixed solution at room temperature for 24-36 hours, centrifuging at 10000rpm for 10min, and respectively washing with ethanol and water. And (5) carrying out freeze-drying to obtain MSN-NH2 powder.
(3) Synthesizing MSN-COOH: adding MSN-NH2 (50 mg) and succinic anhydride (1.00 g) into N, N-dimethylformamide solution (20 ml), and continuously stirring for 6-12 h under nitrogen. 10000rpm, 10min centrifugation, ethanol and water washing. And (5) freeze-drying to obtain MSN-COOH powder.
(4) MSN surface modification ssDNA-1: MSN-COOH was dissolved in MES buffer (pH 6.0), EDC (10 mg/ml, 15 ml) and sulfonic acid-NHS (10 mg/ml, 15 ml) were added thereto, and the mixture was continuously stirred at room temperature for 10 to 30min, followed by thorough washing (surface activation). To the mixture was added 20. mu.L of PBS buffer (100 mM, pH 7.4), followed by addition of ssDNA-1 (3 ml of 100 mM) and continuous stirring at room temperature for 4-8 hours to form the resultant DNA-conjugated nanoparticles (MSN-DNA 1). The ssDNA-1 sequence is: CTATAACTCTAAATCTAA are provided.
Example 2
A preparation method of a composite nano-drug comprises the following steps:
loading of antibacterial peptide and aptamer blocking: 1 mg/mL of antibacterial peptide is added into 1 mL of 1 mg/mL MSN-DNA1 (dissolved by 1 XPBS) in the same volume, the mixture is shaken at room temperature for 48 hours, and the antibacterial peptide enters the micropores of the MSN through the diffusion effect to prepare LMSN with the final concentration of 500 mug/mL. And (3) centrifuging at 6000 rpm for 10min, collecting supernatant, adding 3 ml of 100mM AS1411 into the LMSN solution, standing at room temperature for 12-36 h, and fully combining the DNA-1 and the AS1411 to form the LMSN-AS1411 so AS to plug MSN micropores.
AS1411 sequence:TTAGATTTAGAGTTATAGTTTTTGGTGGTGGTGGTTGTGGTGGTGGTGG are provided. Wherein the line segment is DNA2 sequence, and DNA2 can be complementarily hybridized with DNA1 sequence.
Application example 1
(1) Flow cytometry was used to detect the distribution of LMSN-AS1411 in breast cancer cells MDA-MB-231: MDA-MB-231 cells are digested and then spread in a 6-well plate, the incubator is used for overnight, and after the cells are completely attached to the wall, LMSN-AS 14112 mL with the concentration of 25 mug/mL is added into each well. A blank control group was set. Incubating for 2-8 h at 37 ℃. Discarding the culture medium containing the medicine, washing with PBS for three times, digesting and collecting the cells in a centrifuge tube, discarding the supernatant, adding 500 mu L of PBS to blow the cells uniformly, and detecting the uptake condition of the cells to the nanoparticles by using a flow cytometer.
Application example 2
(1) Confocal microscopy detection of the distribution of LMSN-AS1411 in breast cancer cells MDA-MB-231: slides were placed in 6 well cell culture plates in advance, cells were trypsinized and counted at 4X 105And inoculating the cells/hole into a 6-hole plate, slightly shaking the culture plate to distribute the cells, and culturing for 12-36 h in an incubator. After the cells are completely attached to the wall, the old culture medium is aspirated and discarded, the cells are washed for 3 times by PBS, LMSN-AS1411 with the concentration of 25 mug/mL is added into each hole, and a blank control group is set. After incubation for 2-8 h, the drug-containing medium is aspirated and washed 3 times with PBS. Staining with lysosome dye (10 nM) for 30min, washing with PBS for 3 times, staining with Hochest dye (10 mug/mL) for 10-30min in the dark, carefully clamping the slide, placing on a glass slide on which an anti-fluorescence quencher is dropped, and taking a picture with a laser confocal microscope.
(2) Evaluation: FIG. 1 is a distribution diagram of the MSN particles obtained in example 1, and the results show that the MSN nanoparticles have a uniform particle size distribution and an average particle size of about 220 nm.
FIG. 2 is an infrared spectrum of MSN obtained in example 1, and the results show that the spectrum shows that MSN is 3400 cm-1Has absorption peak of silicon hydroxyl at 1100 cm-1Has an infrared absorption peak of Si-O-Si bonds.
FIG. 3 is an AFM image of the MSN obtained in example 1, showing that the MSN is in the form of monodisperse spheres having a particle size of about 50 to 60 nm.
FIG. 4 is a TEM image of MSN obtained in example 1, and it can be seen from the image that MSN is approximately spherical, and the spheres are stuck to each other, and the average particle diameter is about 100 nm.
FIG. 5 shows MSN and MSN-NH obtained in example 12MSN-COOH potential diagram, it can be seen that CTAC-removed MSN is negatively charged, MSN-NH2Becomes positive and MSN-COOH becomes negative again.
FIG. 6 is a polyacrylamide gel electrophoresis of examples 1 and 2, wherein lane 36 shows DNA1 chain; lane 37 is DNA2-AS1411 strand; lane 38 is DNA1 strand + DNA2-AS1411 strand; lane 39 is MSN-DNA1-DNA2-AS1411 strand; lane 38 is shifted up compared to lanes 36 and 37, indicating successful hybridization of DNA1 strand to DNA2-AS1411 strand. Lane 39 shows that the DNA1 chain modified on the surface of MSN can hybridize with AS1411 chain, and the pore blocking phenomenon is generated due to the larger particle size.
FIG. 7 shows that the nano drug delivery system is used for detecting the intracellular uptake condition of the nano drug system by flow cytometry in example 1, and AS1411 aptamer is combined with nucleolin in a targeted manner, and the result shows that the nano drug delivery system has efficient targeting effect on MDA-MB-231 cells and Hela cells.
FIG. 8 is a result of application example 2 in which a confocal microscope detects the uptake of a nano-drug in a cell, and the result shows that both MDA-MB-231 cells and Hela cells have a good uptake of the nano-drug delivery system.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
FUZHOU University
<120> preparation and application of composite nano-drug
<130> 3
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 26
<212> DNA
<213> Artificial sequence
<400> 1
ggtggtggtg gttgtggtgg tggtgg 26
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
ctataactct aaatctaa 18
<210> 3
<211> 49
<212> DNA
<213> Artificial sequence
<400> 3
ttagatttag agttatagtt tttggtggtg gtggttgtgg tggtggtgg 49
Claims (10)
1. A preparation method of a composite nano-drug is characterized by comprising the following steps: the method comprises the following steps:
step S1: synthesizing mesoporous silicon dioxide MSN particles, and performing amination modification on the prepared mesoporous silicon to obtain aminated mesoporous silicon MSN-NH2Then in MSN-NH2Modifying the carboxyl and ssDNA-1 to obtain DNA coupled nanoparticles MSN-DNA 1;
step S2: mixing the antibacterial peptide Lchamp2-3 and MSN-DNA1 in the same volume, and oscillating at room temperature to enable the antibacterial peptide to enter the micropores of the MSN through diffusion to obtain LMSN; and then adding a proper amount of AS1411 into the LMSN solution to enable the DNA-1 and the AS1411 to be fully combined to form LMSN-AS1411 so AS to plug MSN micropores.
2. The method for preparing a composite nano-drug according to claim 1, characterized in that: the S1 specifically includes the following steps:
step S11: hexadecyltrimethylammonium chloride, triethylamine and H2Heating and stirring the mixed solution of O, dropwise adding tetraethyl orthosilicate, stirring the mixture on a magnetic stirrer to obtain a crude product, treating the crude product by using a methanol solution of ethanol and NaCl to remove redundant hexadecyl trimethyl ammonium chloride, washing the crude product by using ethanol and secondary water, and freeze-drying the crude product to obtain MSN powder;
step S12: mixing MSN with ethanol and 3-aminopropyltriethoxysilane, stirring at room temperature, washing with ethanol and water, and lyophilizing to obtain MSN-NH2；
Step S13: adding MSN-NH2Adding N, N-dimethylformamide solution with succinic anhydride, stirring under nitrogen, and adding ethanolWashing with water, and freeze-drying to obtain MSN-COOH;
step S14: dissolving MSN-COOH in MES buffer solution, adding EDC and sulfonic acid-NHS, stirring at room temperature, adding PBS buffer solution, adding ssDNA-1, and stirring at room temperature to obtain MSN-DNA 1.
3. The method for preparing a composite nano-drug according to claim 2, characterized in that: in the step S11, the final concentration of hexadecyl trimethyl ammonium chloride in the mixed solution is 0.3125M, and the final concentration of triethylamine is 0.01M; the final concentration of tetraethyl orthosilicate is 0.335M; the mass fraction of the methanol solution of NaCl is 1.0%.
4. The method for preparing a composite nano-drug according to claim 2, characterized in that: step S11, heating, stirring and reacting at the temperature of 95 ℃ for 1-2 h; the stirring temperature of the magnetic stirrer is 95 ℃, and the reaction time is 4-6 h.
5. The method for preparing a composite nano-drug according to claim 2, characterized in that: the final concentration of the 3-aminopropyltriethoxysilane solution used in the step S12 is 0.085M, and the stirring time is 24-36 h.
6. The method for preparing a composite nano-drug according to claim 2, characterized in that: the succinic anhydride solution used in the step S13 has a succinic anhydride final concentration of 0.5M and is stirred for 4-6 hours.
7. The method for preparing a composite nano-drug according to claim 2, characterized in that: the EDC concentration used in step S14 is 10mg/mL, and the sulfonic acid-NHS concentration is 10 mg/mL; the stirring time is 10-30 min; adding ssDNA-1 at a concentration of 100 mM; the stirring time is 4-8 h.
8. The method for preparing a composite nano-drug according to claim 1, characterized in that: the concentration of the antibacterial peptide in the step S2 is 1 mg/mL, and the concentration of the MSN-DNA1 is 1 mg/mL; the oscillation time is 48-72 h.
9. A composite nano-drug prepared by the preparation method of any one of claims 1 to 8.
10. The use of the composite nano-drug prepared by the preparation method of any one of claims 1 to 8 in the preparation of a drug for treating tumors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110347258.9A CN113058028A (en) | 2021-03-31 | 2021-03-31 | Preparation and application of composite nano-medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110347258.9A CN113058028A (en) | 2021-03-31 | 2021-03-31 | Preparation and application of composite nano-medicine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113058028A true CN113058028A (en) | 2021-07-02 |
Family
ID=76564980
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110347258.9A Pending CN113058028A (en) | 2021-03-31 | 2021-03-31 | Preparation and application of composite nano-medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113058028A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114306572A (en) * | 2022-01-06 | 2022-04-12 | 黑龙江八一农垦大学 | Mesoporous nano carrier for transferring antibacterial peptide |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110123601A1 (en) * | 2009-11-23 | 2011-05-26 | National Tsing Hua University | Biofunctionalized phospholipid-capped mesoporous silica nanoshuttles for targeted drug delivery |
| CN104324380A (en) * | 2014-10-17 | 2015-02-04 | 华东理工大学 | Nano drug carrier, preparation method and application thereof |
| CN106890340A (en) * | 2017-02-28 | 2017-06-27 | 福州大学 | A kind of pair of mesoporous silicon oxide targeted medicament carrying nano grain of aptamers modification |
| CN107469088A (en) * | 2017-06-27 | 2017-12-15 | 郑州大学 | A kind of construction method of accurate identification targeted nano carrier based on DNA paper folding arts and its application |
| CN109044993A (en) * | 2018-09-18 | 2018-12-21 | 华南理工大学 | It is a kind of to target polyethyleneglycol modified mesoporous silicon dioxide nano particle and preparation method thereof with aptamer |
| CN110101841A (en) * | 2019-06-28 | 2019-08-09 | 福州大学 | Application of the antibacterial peptide Lchamp2-3 in antitumor cell diversion medicaments |
-
2021
- 2021-03-31 CN CN202110347258.9A patent/CN113058028A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110123601A1 (en) * | 2009-11-23 | 2011-05-26 | National Tsing Hua University | Biofunctionalized phospholipid-capped mesoporous silica nanoshuttles for targeted drug delivery |
| CN104324380A (en) * | 2014-10-17 | 2015-02-04 | 华东理工大学 | Nano drug carrier, preparation method and application thereof |
| CN106890340A (en) * | 2017-02-28 | 2017-06-27 | 福州大学 | A kind of pair of mesoporous silicon oxide targeted medicament carrying nano grain of aptamers modification |
| CN107469088A (en) * | 2017-06-27 | 2017-12-15 | 郑州大学 | A kind of construction method of accurate identification targeted nano carrier based on DNA paper folding arts and its application |
| CN109044993A (en) * | 2018-09-18 | 2018-12-21 | 华南理工大学 | It is a kind of to target polyethyleneglycol modified mesoporous silicon dioxide nano particle and preparation method thereof with aptamer |
| CN110101841A (en) * | 2019-06-28 | 2019-08-09 | 福州大学 | Application of the antibacterial peptide Lchamp2-3 in antitumor cell diversion medicaments |
Non-Patent Citations (1)
| Title |
|---|
| 堵玉林等: "核酸适配体在肿瘤靶向治疗方面的研究进展", 《化学通报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114306572A (en) * | 2022-01-06 | 2022-04-12 | 黑龙江八一农垦大学 | Mesoporous nano carrier for transferring antibacterial peptide |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Daniels et al. | Sterically stabilized siRNA: gold nanocomplexes enhance c-MYC silencing in a breast cancer cell model | |
| Zhao et al. | Magnesium-stabilized multifunctional DNA nanoparticles for tumor-targeted and pH-responsive drug delivery | |
| CN107469088B (en) | Construction method for accurately identifying targeted nano-carrier based on DNA origami and application thereof | |
| US10583084B2 (en) | Liposomal formulations for delivery of nucleic acids | |
| Li et al. | A pH-sensitive multifunctional gene carrier assembled via layer-by-layer technique for efficient gene delivery | |
| Feng et al. | pH-responsive charge-reversal polymer-functionalized boron nitride nanospheres for intracellular doxorubicin delivery | |
| Taranejoo et al. | Bioreducible PEI-functionalized glycol chitosan: A novel gene vector with reduced cytotoxicity and improved transfection efficiency | |
| Wang et al. | Using hyaluronic acid-functionalized pH stimuli-responsive mesoporous silica nanoparticles for targeted delivery to CD44-overexpressing cancer cells | |
| Wu et al. | A silica–polymer composite nano system for tumor-targeted imaging and p53 gene therapy of lung cancer | |
| CN105343895A (en) | Dual-targeting ursolic acid (UA)/siRNA loaded fluorescent mesoporous silica dioxide-hyaluronic acid and application | |
| CN103566379A (en) | Preparation and application of intracellular triggering reduction sensitive drug linked gene targeted co-carrier | |
| WO2019104760A1 (en) | Integrated nanosystem for liver-targeting co-delivery of gene/drug and preparation method therefor | |
| CN102234658A (en) | Target quaternary ammonium salt cationic polymer lipid gene carrier, preparation method and application thereof | |
| CN105087596A (en) | CD20 aptamer and application thereof | |
| Teng et al. | Intracellular RNA and nuclear DNA-dual-targeted tumor therapy via upconversion nanoplatforms with UCL/MR dual-mode bioimaging | |
| CN103908676A (en) | Folic-acid-modified laponite nanometer particle, preparation thereof and applications thereof | |
| Pan et al. | Zoledronate combined metal-organic frameworks for bone-targeting and drugs deliveries | |
| CN113058028A (en) | Preparation and application of composite nano-medicine | |
| CN106727323B (en) | Hyaluronic acid nano vesicle and preparation method and application thereof | |
| CN107007550B (en) | Redox-responsive amphiphilic copolymer and preparation method and application thereof | |
| KR102180631B1 (en) | Nanoparticle complex with improved cellular uptake through surface modification using lipid and Method for manufacturing the same | |
| CN115607680A (en) | Preparation and application of gold cluster-aptamer and derivative assembly thereof | |
| CN109550057A (en) | Active targeting type gene delivery nanoparticle and its preparation method and application | |
| CN102512683A (en) | Polymer gene medicine carrier, preparation method thereof and use thereof for preparing antitumor medicine | |
| CN103599549A (en) | SiRNA (Small interfering Ribonucleic Acid)/anti-cancer drug combined transferring composite supporter and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |