CN113046448A

CN113046448A - SNP genetic marker related to sheep lambing number and application thereof

Info

Publication number: CN113046448A
Application number: CN202110539165.6A
Authority: CN
Inventors: 韩红兵; 汪林丽; 黄建伟
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2021-05-18
Filing date: 2021-05-18
Publication date: 2021-06-29
Anticipated expiration: 2041-05-18
Also published as: CN113046448B

Abstract

The invention discloses an SNP genetic marker related to the number of lambs born by sheep and application thereof. The invention provides application of a substance for detecting whether an 8283097 th deoxyribonucleotide on a No.2 chromosome in a sheep genome is A, T or A and T in identifying the lamb number traits, identifying the lamb number as multiple lambs or single lambs and identifying the lamb number. The invention finds the most significant genetic marker chr2 related to sheep lambing: 8283097, and establishes a simple detection application method of the marker, thereby providing a method for rapidly and accurately breeding excellent varieties in practical work.

Description

SNP genetic marker related to sheep lambing number and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an SNP genetic marker related to the number of lambs born by sheep and application thereof.

Background

With the development of molecular biology and bioinformatics, breeding by a molecular marker method is emerging. The superiority of the DNA molecular marker is as follows: most molecular markers have codominance and are beneficial to selection of invisible traits; the number of molecular markers is almost unlimited; simple and rapid detection means and the like. The DNA molecular markers mainly include Restriction Fragment Length Polymorphism (RFLPs) markers, Random Amplified Polymorphic DNA (RAPDs) markers, Amplified Fragment Length Polymorphism (AFLPs), Simple repeat sequences (SSRs), single nucleotide polymorphism markers (SNPs), and the like.

Single nucleotide polymorphism markers (SNPs) refer to DNA sequence polymorphisms at the genomic level caused by a single nucleotide. SNP typing methods mainly include detection methods based on electrophoresis (PCR-RFLP, PCR-SSCP, AS-PCR), detection methods based on fluorescence quantitative PCR (TaqMan probe method, HRM), direct sequencing methods, and other detection methods (mass spectrometry, SNaPshot, LDR). The PCR-RFLP is one of the most classical methods in SNP screening, restriction endonuclease is utilized to act on DNA fragments, if SNP sites exist, the length and the number of enzyme digestion products are different, the genotype of the SNP sites can be judged through agarose gel electrophoresis, and the method has the advantages of rapid detection and low cost.

The number of lambs born by the sheep is an important economic trait, and the Dongfruil sheep belongs to a foreign typical high-yield sheep variety and has high fertility.

Disclosure of Invention

The invention claims an SNP genetic marker related to the number of lambs born by sheep and application thereof.

In a first aspect, the invention claims the use of a substance for detecting whether the deoxyribonucleotide at position 8283097 on chromosome 2 of sheep genome is A, T or A and T in any one of the following:

(A1) identifying or assisting in identifying the lamb number characters;

(A2) preparing a product for identifying or assisting in identifying the lambing number character of the sheep;

(A3) identifying or assisting in identifying whether the number of lambs born by the sheep is multiple lambs or single lambs;

(A4) preparing a product for identifying or assisting in identifying whether the lambs of the sheep are multiple lambs or single lambs;

(A5) identifying or assisting in identifying the number of lambs born by the sheep;

(A6) preparing a product for identifying or assisting in identifying the number of lambs born by the sheep.

Wherein, the substance for detecting whether the 8283097 th deoxyribonucleotide on chromosome 2 in the sheep genome is A, T or A and T can be a primer pair or a primer set, or a reagent or a kit containing the primer pair or the primer set.

The primer pair consists of an upstream primer and a downstream primer; the upstream primer can be designed according to the upstream sequence of the 8283097 th deoxyribonucleotide on the No.2 chromosome in the sheep genome; the downstream primer can be designed according to the downstream sequence of the 8283097 th deoxyribonucleotide on the No.2 chromosome in the sheep genome.

In the present invention, the primer pair is a primer pair a; the primer pair A consists of an upstream primer shown by SEQ ID No.1 and a downstream primer shown by SEQ ID No. 2.

In the present invention, the primer set consists of a primer pair B and a primer pair C; the primer pair B consists of an upstream primer shown by SEQ ID No.3 and a downstream primer shown by SEQ ID No. 4; the primer pair C consists of an upstream primer shown by SEQ ID No.5 and a downstream primer shown by SEQ ID No. 6.

Further, the kit contains the primer set and also contains a restriction enzyme DraI.

In a second aspect, the invention claims a method for identifying or assisting in identifying whether the number of lambs born by a sheep to be tested is multiple lambs or single lambs.

The method for identifying or assisting in identifying whether the lambs of the sheep to be detected are multiple lambs or single lambs comprises the following steps:

(B1) detecting whether the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A, T or A and T, and then determining the genotype according to the following steps:

if the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is a homozygote of A, the genotype of the sheep to be detected is A: A;

if the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is a homozygote of T, the genotype of the sheep to be detected is T type;

if the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is a hybrid of A and T, the genotype of the sheep to be detected is A: T type;

(B2) determining whether the number of lambs born by the sheep to be tested is multiple lambs or single lambs according to the following steps: if the genotype of the sheep to be detected is A: A, the lambing number of the sheep to be detected is equal to or candidate for multiple lambs; and if the genotype of the sheep to be detected is T: T type or A: T type, the lambing number of the sheep to be detected is or is selected as single lambs.

In a third aspect, the invention claims a method for identifying or assisting in identifying the number of lambs born by a test sheep.

The method for identifying or assisting in identifying the number of lambs born by the sheep to be detected, which is claimed by the invention, can comprise the following steps:

(C1) detecting whether the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A, T or A and T, and then determining the genotype according to the following steps:

(C2) determining the number of lambs born by the sheep to be tested according to the following steps: the number of lambs of the sheep to be detected with the genotype of A: A is more than that of the sheep to be detected with the genotype of T: T or A: T, or more than that of the sheep to be detected with the genotype of A: T.

In the steps (B1) and (C1), whether the deoxyribonucleotide at position 8283097 on chromosome 2 in the genome of the sheep to be tested is a, T, a or both a and T can be detected according to a method comprising any one of the following steps:

p1, carrying out nested PCR amplification by using the genomic DNA of the sheep to be detected as a template and adopting the primer set to obtain an amplification product (namely, firstly carrying out first round PCR amplification by using the genomic DNA of the sheep to be detected as a template and adopting the primer set B to obtain a first round amplification product, and then carrying out second round PCR amplification by using the first round amplification product as a template and adopting the primer set C to obtain a second round amplification product, namely the amplification product); then, the amplification product is cut by restriction enzyme DraI, and whether the 8283097 th deoxyribonucleotide on chromosome 2 in the genome of the sheep to be tested is A, T or A and T is determined according to the cutting result as follows: if the enzyme digestion product contains 106bp target bands and does not contain 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A; if the enzyme digestion product contains a 106bp target band and 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A and T; if the enzyme digestion product does not contain 106bp target bands but contains 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is T.

P2, taking the genomic DNA of the sheep to be detected as a template, and carrying out PCR amplification by adopting the primer pair to obtain an amplification product; and sequencing the amplification product, and determining whether the 8283097 th deoxyribonucleotide on the chromosome 2 in the genome of the sheep to be tested is A, T or A and T according to the sequencing result.

In a fourth aspect, the present invention claims a substance having a function represented by the following (a), (B) or (C):

(A) identifying or assisting in identifying the lamb number characters;

(B) identifying or assisting in identifying whether the number of lambs born by the sheep is multiple lambs or single lambs;

(C) and identifying or assisting in identifying the number of lambs born by the sheep.

The substance claimed by the invention is specifically the substance described above for detecting whether the deoxyribonucleotide at position 8283097 on chromosome 2 in the genome of sheep is A, T or A and T. I.e.a primer pair as described hereinbefore or a primer set as described hereinbefore or a reagent as described hereinbefore or a kit as described hereinbefore.

In a fifth aspect, the invention claims any of the following applications:

(D1) use of a substance as hereinbefore described in the third aspect for identifying or assisting in identifying a sheep lambing number trait, or for the manufacture of a product for identifying or assisting in identifying a sheep lambing number trait;

(D2) use of a substance as hereinbefore described in the third aspect in, or in the manufacture of a product for, identifying or assisting in, identifying a number of lambs in a sheep or a single lamb;

(D3) use of a substance as hereinbefore described in the third aspect for identifying or assisting in identifying the number of lambs born by a sheep, or for the manufacture of a product for identifying or assisting in identifying the number of lambs born by a sheep;

(D4) use of a method according to the second aspect or a substance according to the third aspect in sheep breeding.

In each of the above aspects, the sheep to be tested may be selected from: dongfuill sheep, small tailed Han sheep, Hu sheep, Texel sheep or Black Safok sheep.

In the above aspects, the lambing rate is more than or equal to 180%. The single lambs mean that the lambing rate is less than or equal to 100 percent.

In the present invention, the physical location on the sheep genome is the Ovis aries Oar _ v3.1 version as reference sequence.

The genome information of 36 Dongfuil sheep is obtained based on the whole genome re-sequencing technology, the individual sequencing data coverage can averagely reach 7 x, after the detection and quality control of variation information are completed, SNP markers which are obviously related to the lamb characters are screened by adopting a whole genome association analysis method, 3 genetic markers which reach a whole genome suggested significant level threshold are screened in total, and the genetic markers are chr2:8283097, the T → a mutation (p ═ 6.462E-06), rs413468688, the C → a mutation (p ═ 2.599E-05), rs400952839, the G → a mutation (p ═ 4.945E-05), with chr2:8283097 being the most significant genetic marker. The invention finds the most significant genetic marker chr2 related to sheep lambing: 8283097, and establishes a simple detection application method of the marker, thereby providing a method for rapidly and accurately breeding excellent varieties in practical work.

Drawings

FIG. 1 shows the distribution of absorbance values of genomic DNA stock solutions of blood of Dongfruil sheep.

FIG. 2 shows the result of 1% agarose gel electrophoresis detection of a genomic DNA stock solution of Dongfruil sheep blood.

FIG. 3 shows the distribution of the detected mutation sites on the genome of Dongfruil sheep.

FIG. 4 is a graph of the PCA analysis of 34 sheep individuals. PC1, principal component 1; PC2 Main component 2. Different figures represent different sheep individuals.

FIG. 5 is a Q-Q plot for evaluating whether the statistical model is reasonable.

Figure 6 is a manhattan plot of the lambing trait GWAS results, noting that: the abscissa of the graph is sheep chromosome number, and 27 represents the X chromosome; the ordinate is the result of-log 10 of the p-value after correlation analysis and correction. The straight line represents the 5% whole genome significance level threshold line and the dashed line represents the whole chromosome significance level threshold line (whole genome suggested significance level threshold line).

FIG. 7 shows the PCR product of the sequence at position chr2: 8283097. The fragment size was 755bp, and different lanes indicate PCR amplification products in different sheep subjects.

FIG. 8 shows the genotypes detected by the sequencing of the sites chr2:8283097 in high-yield sheep and low-yield sheep.

FIG. 9 is a schematic diagram of genotyping at the chr2:8283097 site.

FIG. 10 is a case gel diagram of the PCR-RFLP genotyping of the genetic marker at the chr2:8283097 locus. The notation in the figure is: AA genotype, 106 bp; AT genotype, 106bp, 76bp, 30 bp; TT genotype, 76bp, 30 bp.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 Whole genome correlation analysis to obtain novel SNP genetic marker for sheep lambing number

First, phenotype collection

The group of the preliminary association analysis selects 36 pure-breed Dongfrui sheep from the Shunyang Aoxin sheep farm in Beijing, the reproductive trait phenotype difference is obvious in the group with continuous lambing records for more than two years, and the group with the lambing rate more than or equal to 180 percent is marked as a multi-lambing group (26 lambs); the group with lambing rate less than or equal to 100% was scored as single lambs (10). Wherein, the lambing rate is (number of born lambs/number of lambing ewes) multiplied by 100%.

Two, phenol-chloroform method for extracting animal blood genome DNA

1. After mixing the blood of fresh Dongfruil sheep, 800. mu.L of the blood is sucked into a 2ml centrifuge tube by a pipette gun, Hanks or PBS with the same volume is added, centrifugation is carried out for 10min at 12000rpm, and the supernatant is discarded.

2. Add 800. mu.L of erythrocyte lysate to the tube and mix well by vortexing on a vortex shaker (no pellet at the bottom of the tube and no large blood clot).

3. To each tube, 800. mu.L of leukocyte lysate and 30. mu.L of proteinase K were added and mixed by pipette.

4. The solution is placed in a constant temperature water bath kettle and is placed at a constant temperature of 56 ℃ overnight.

5. The solution is taken out and placed at normal temperature, 600 mu L of Tris-saturated phenol is respectively added, the mixture is evenly mixed by inversion for 10min, and the mixture is centrifuged at 12000rpm for 10min at 4 ℃.

6. The supernatant of the solution was pipetted into a new 2mL centrifuge tube, taking care not to pipette into the middle or bottom layer, and pipetting up a little bit, and then taking the supernatant and disposing it. Adding 600 μ L phenol/chloroform solution at volume ratio of 1:1, shaking up and down, and mixing for 10 min. Centrifuging at 10000rpm for 10min, sucking about 500 μ L of the supernatant, and placing in a new 1.5mL centrifuge tube.

7. Repeat step 6 and aspirate the supernatant.

8. Adding phenol/chloroform/isoamyl alcohol mixed solution with the volume ratio of 25:24:1 in the same volume, reversing and uniformly mixing for 10min, centrifuging for 10min at 4 ℃ and 12000rpm, and taking the upper aqueous phase to a centrifuge tube of 1.5 ml.

9. 2 times volume of precooled absolute ethyl alcohol is added, and the centrifuge tube is slowly rotated until white flocculent precipitate which can be seen by naked eyes appears. The enucleated aqueous acid can be heated to 65 ℃ in advance of the metal bath.

10. The above solution was centrifuged at 12000rpm at 4 ℃ for 10min, and the supernatant was discarded (directly poured) to obtain a precipitate. Washing with 75% ethanol for 1-2 times, 13000rpm, centrifuging for 10min, removing supernatant, and removing residual liquid by pipette. Placing in a super clean bench, and placing at maximum air volume for 5 min.

11. Checking whether the alcohol is dried in the air or not, taking out the alcohol from a clean bench if the alcohol is dried in the air, respectively adding 30 mu L of preheated enucleated enzyme water into each tube, slightly blowing and beating the solution to dissolve the precipitate, and detecting the concentration by using a miniature nucleic acid concentration measuring instrument after the solution is uniformly mixed.

12. The identification was carried out by 1% agarose gel electrophoresis using marker 1.

Genomic DNA was extracted from 36 Toffli sheep blood by phenol-chloroform method, and the concentration of DNA stock solution and absorbance values (A260/A230 and A260/A280) were determined, and most of the sample concentrations reached 500 ng/. mu.L on average, and as can be seen from FIG. 1, the absorbance values were mostly in the high level range. 200ng of DNA and 10 XLoading Buffer are mixed and subjected to electrophoresis detection on 1% agarose gel, the result is shown in figure 2, and the positions and brightness of bands of all lanes are consistent, which shows that the homogenization effect is good, and the bands are clear and have no tailing. The result shows that the extracted DNA is not degraded, and the sample basically meets the experimental requirements of whole genome sequencing database construction, subsequent conventional PCR and the like.

Triple, whole genome resequencing

Sending the extracted high-quality DNA to Beijing AnnuoYouda for library construction, finishing whole genome re-sequencing on 36 Dongfruil sheep based on an Illumina HiSeq2000 sequencing platform, wherein the effective sequencing depth can reach 7 x, each individual can obtain 103,168,030 high-quality reads on average, Q30 can reach 90.79 on average, and the total amount of sequencing data and the sequencing quality meet the basic requirements of next analysis. See table 1 for details.

TABLE 1 quality of sequencing data (Listing section)

Sample numbering	Rawreads	Cleanreads	Rateofcleanreads	CleanQ30baserate
					178	109,487,002	106,937,696	97.67％	90.82％
290	107,839,054	106,134,000	98.42％	90.97％
					300	108,527,066	106,369,796	98.01％	90.71％
242	108,591,370	106,083,468	97.69％	89.85％
					B039	104,569,300	102,368,520	97.89％	90.45％

Note: q30 indicates the percentage of the total bases that the correct recognition rate of a sequenced base is 99.9% or more.

Fourth, SNP variation detection

Before SNP variation detection, the quality control of the off-line sequencing file is required, and the filtering conditions are as follows: (1) rejecting reads with a base number higher than 10% that cannot be identified by sequencing; (2) removing reads polluted by the joint; (3) rejecting reads with a base mass of less than 40%; (4) redundancy is removed. In the process, SeqPrep is used for completing joint removal, combination and redundancy removal of the read, Sickle software is used for removing low-quality reads, and the obtained clean data can be used for the next mutation detection.

1. BWA software alignment

BWA software is mainly used for comparing genome data, and reads obtained by second-generation sequencing can be spliced back to a reference genome (Ovis aries Oar _ v3.1) to complete comparison. Before alignment, an index needs to be established for a sheep reference genome, and because the sheep genome is about 3Gb or so, the alignment is completed by using default parameters after the index is established by using an bwa v0.7.15 version-abwtsw parameter. It should be noted here that the latest version of mutation detection software cannot identify the alignment file without header file, and header file should be added here, and the present invention is implemented by using the addorardgroups tool of Picard-tools v 1.119.

2. Reordering the files obtained by the preliminary comparison

Looking at the sam files obtained by the above alignment, it can be seen that the file ordering is random, rather than in the order of chr1, chr2 and chr3 … chromosomes, which results in that the later tools for mutation detection cannot identify the alignment results, and therefore the results need to be re-ordered. The present invention accomplishes the reordering using the pincard-tools v1.119 version of sortsam.

3. Comparing the files, compressing and sorting again

The sam file occupies a large resource and needs to be converted into its binary bam file. This was done using sam tools v 1.3.1. And then, sorting the bam files according to corresponding entries of the same chromosome and the sequence of coordinates from small to large by using a sortsam tool of Picard-tools v1.119 version, and basically finishing the comparison work of clean data.

4. Redundant culling

The redundancy removal during the quality control of the original data only eliminates completely consistent sequences, and can not distinguish the redundancy generated by PCR over-amplification in the library building process. These sequencing redundancies can be aligned to the same position of the reference genome together with the reads of the species themselves, resulting in inaccurate sequencing depth statistics at that position, and variations detected based on the redundant sequences have no biological significance, resulting in reduced variation detection reliability. It is therefore desirable to eliminate these extraneous duplicates as much as possible and this study uses the MarkDuplicates tool from Picard-tools v1.119 version to accomplish the de-redundancy.

5. Secondary alignment of insertion/deletion regions

This procedure will perform a local secondary alignment of the Indels (insertion/deletion) regions, reducing the error rate of global alignment due to these specific sequences. When global alignment is executed, a large number of base mismatches occur near an Indel region, and if the region obtains enough reads for splicing, the alignment software cannot align a plurality of reads with a reference genome at the same time to realize error correction, so that the mismatched bases can be misjudged as variation sites. The invention uses GATK v3.6.0 version Realigner TargetCreator tool to search the area needing secondary comparison, and uses Indel Realigner tool to complete secondary comparison.

6. Variation detection

Before formal mutation detection is started, the BQSR (base quality score correction) of the GATK is used for completing correction, then the genotypGVCFs process in the GATK tool package is adopted, mutation detection is independently performed on each individual, and then mutation files are merged to complete final detection.

7. Filtering of variant detection results

The source mass fraction of the variant test sites was directly filtered by hard filtration (Varianthard-filterr). Because the sample size is lower than 40, the invention adopts a hard filtering method, and the setting parameter is (-filter expression "QD < 2.0" | -filter expression "FS < 60.0" | -filter expression "MQ < 40.0" | -filter rExpression "MQRankSum < 12.5" | -filter expression "ReadPosRankSum < 8.0" |). Thus, genetic variation detection is completed.

After BWA alignment, the present invention used GATK for mutation site genotyping, and 20,169,142 SNP sites, about 2,800,000 Indels, were preliminarily detected in 36 individuals. Since GWAS mainly aims at SNP variation, SNPs information in a variation file is separately proposed for further filtering. The detected mutation sites are visualized on the sheep chromosome by using a Variantantanotatioinintegrator tool provided by UCSC (http:// genome. UCSC. edu /), and the result is shown in figure 3, and as can be seen from the figure, the mutation sites basically and completely cover the sheep genome, so that the subsequent whole genome association analysis is facilitated.

Quality control of variation data

Not all of the above-identified high quality SNPs meet the requirements of subsequent analysis, and further filtration of these SNPs is required. Using Plink software to filter the SNP sites at population level, 2 individuals were knocked out due to a genotyping rate of less than 70%; 19,423,030 SNPs were excluded due to a call rate value below 85%; 463,601 SNPs are removed because the Minimum Allele Frequency (MAF) does not reach the standard, the minimum MAF value in the population of the invention is 1/72, and the threshold value is set to be 0.01 according to the empirical value; 0 SNP due to significant deviation from Ha's-WeinbergEquilibrium (p)<10^-6) And filtered out, and finally high-quality genotyping data of the 34 individuals at 282,511 SNP sites is obtained.

Sixthly, group principal component analysis

In order to eliminate the deviation of genetic correlation estimation between individuals caused by non-causal linkage disequilibrium, the invention selects independent SNPs on autosomes to carry out principal component analysis. The detected variant file is converted into a plink binary file through vcftools software, and then the variant information located on an autosome is selected by using a GCTA program to perform principal component analysis, so that the grouping information of the PC1, the PC2 and the PC3 is obtained. Reading this information into R can then complete the visualization of the results, which are shown in fig. 4. 34 individuals are respectively represented by different geometric figures, and obvious aggregation blocks do not appear in the figure, which indicates that the genetic background of the population is relatively uniform, and the population stratification phenomenon basically does not exist, probably because the related population for test mostly originates from the same small region, and the genetic background is very close. Is beneficial to the subsequent whole genome association analysis.

Seventh, genome-wide association analysis between variation site-lambing traits

According to the test, single-factor case-control design is carried out according to the characteristics of the lamb-bearing property of the sheep, and GWAS is carried out on the mutation site and the lamb-bearing property of the sheep by using chi-square test and logistic models respectively. The variant detection file is converted into a format which can be identified by Plink software, and then the whole genome association analysis of the sheep lambing traits is carried out by using a logistic model of plinkv1.9.0.

The analysis results were first presented in Q-Qplot (FIG. 5) to evaluate whether the statistical model is reasonable. As shown, most of the scatter points in the graph are on a 45 ° diagonal (expected value), but generally limited by the number of samples and the variables that can be calculated by the model, and the observed values are still lower than the expected values, and the model construction is approximately satisfactory. In addition, the phenotype trend of the sheep lambing traits is determined to be closer to binomial distribution rather than normal distribution by considering the characteristics of the sheep lambing traits, so the Q-Qplot result can only be used as a reference. The Q-Qplot results show on the one hand that there is indeed no population stratification (expectation value is substantially fitted to the observation), on the other hand it can also be seen that there are few points in this trial where the observation value is higher than the expectation value, i.e. there are few points where a significant level of correlation across the whole genome is reached.

On the basis of reasonable construction of an analysis model, the GWAS result is more visually displayed by using a Manhattan diagram, which is shown in figure 6.

In order to reduce the false positive rate of the repeated test, the p value obtained by the genome-wide association analysis is corrected by using a linkage disequilibrium corrected Bonferroni correction method (the number of times of performing genome-wide LD blocking correction multiple tests is corrected), and the corrected p value is actually equivalent to 162819 independent SNPs used for GWAS, so that the p value of the Bonferroni corrected significant level of 5% of the whole genome is 3.07E-6, and the significant p value of the whole chromosome level (the whole genome suggested significant level) is 6.14E-5. As can be seen from fig. 6, the SNPs reaching a significant level of the whole genome total 0; a total of 3 SNPs that achieved significant levels of the whole genome proposal (see table 2 for details). FIG. 6 shows that SNPs that reach the suggested significant level for the whole genome (p <6.14E-5) include: 2 SNPs located on chromosome 2 of sheep and 1 SNP located on chromosome 16 of sheep. Wherein chr2:8283097 is the most significant genetic marker associated with sheep lambs.

TABLE 2 number of lambs Bonferroni corrected genome-wide suggested significant level of SNPs site information

Marking	Chromosome	Position on chromosome	Genotype(s)	Recent genes	p-adjust
						2:8283097	2	8283097	T/A	TNC	6.462E-06
rs413468688
		2	74430325	C/A	KDM4C	2.599E-05
rs400952839
		16	10136771	G/A	NAIP	4.945E-05

Note: position is referenced to Ovis aries Oar _ v3.1 version.

Example 2 genetic marker population verification and correlation analysis

Based on the significant genetic markers obtained in the correlation analysis test, primers are designed by using Primer6.0 software to amplify the most significant genetic marker chr2 in 20 Dongfuill sheep, 31 small tailed han sheep and 16 Hu sheep represented high-yield (the empirical lambing rate is more than or equal to 180%) sheep varieties and 24 Techsel sheep and 17 black Safek sheep represented low-yield (the empirical lambing rate is less than or equal to 100%): 8283097 and performing sanger sequencing to complete genotyping, analyzing genetic indexes and performing chi-square test based on a list table to analyze the correlation with the lambing traits.

Firstly, extracting sample DNA

Refer to the instructions provided with the Tiangen blood genome extraction kit.

Second, primer design

The invention is based on the fact that the genetic marker chr2 to be detected: 8283097 the position on the sheep genome is selected to contain the 1000bp sequence of the site for primer design. The primer sequences are listed in Table 3, and the primers were synthesized by Beijing Kingzhi corporation and Shanghai bioengineering, Inc. Using ddH₂O was diluted to 10. mu.M and stored at-20 ℃.

TABLE 3 sequence of the mutation site sequencing primers

Third, PCR amplification and sequencing

The extracted DNA of each sheep variety is used as a template, the primers in the table 3 are respectively used for PCR amplification, and the gel electrophoresis result shows that the band size is correct and then the band is sent to Beijing Jinzhi corporation for sequencing.

PCR amplification reaction system and amplification procedure: the total volume of the amplification reaction was 25. mu.L, and the components were: DNA template 1. mu.L, 10. mu. mol/L each 0.75. mu.L, 2mmol/L dNTP 2.5. mu.L, KOD-Plus-Neo 0.5. mu.L, 10 XPCR buffer 2.5. mu.L, 25mmol/L MgSO₄1.5 μ L, made up to 25 μ L with sterile deionized water.

The PCR reaction program is: pre-denaturation at 94 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 30s, extension at 68 ℃ for 35s (35 cycles), and final extension at 68 ℃ for 5 min.

(1) PCR amplification result of the sequence at the position chr2:8283097

mu.L of the PCR product was detected by 2% agarose gel electrophoresis. The electrophoresis result is shown in FIG. 7, the product band is clear, no primer dimer exists, the specificity is good, and the target fragment is cut into gel, recovered and sent to the company for sequencing.

(2) Sequencing results of PCR amplification products

The base sequence and peak pattern near the chr2:8283097 site were examined by SnapGene software, and the results showed that the site detected three genotypes (wild homozygous T/T, heterozygous A/T and mutant homozygous A/A) in the Dongfrel, small tailed han sheep, and Hu sheep high-yielding sheep population and Tecke sheep and Black Safuk sheep low-yielding sheep population, and the results are shown in FIG. 8, with the position of the marker in the red inverted triangle.

Fourth, the genetic analysis of the group at the chr2:8283097

Detecting a potentially significant related genetic marker chr2:8283097 obtained by whole genome association analysis in high-yield sheep (the lambing rate is more than or equal to 180%) represented by Dongfrel sheep, small tailed han sheep and Hu sheep and low-yield sheep (the lambing rate is less than or equal to 100%) represented by Texel sheep and Black Safox sheep, and counting the frequency of the locus in the population and the frequency of genotyping. The results are shown in Table 4.

TABLE 4 allele frequency and genotype frequency in high and low yielding sheep varieties of Chr2:8283097

Note: the number of samples is in parentheses.

The results firstly verify the genotyping accuracy of the mutation sites based on the resequencing data at the previous stage, the frequency of the most significant mutation site chr2:8283097 is detected in different sheep species, and the base label graph of the sequence of the site is shown in FIG. 9. Allelic variations at position chr2:8283097 in the population were T (wild type) and A (mutant), Table 4 showing that T (wild type) was 0.149 frequent in the high yielding population tested and 0.610 frequent in the low yielding population tested; the frequency of A (mutant) in the high yielding population tested was 0.851 and in the low yielding population tested was 0.390. A single-factor case-control test between high-yield, low-yield and individual genotypes is designed, and chi-square test is carried out based on a list with the degree of freedom of 1 (Table 5 and Table 6) to verify whether the two have a correlation. The test results chi 2 ═ 27.3, p <0.01 (table 5), chi 2 ═ 41.3 and p <0.01 (table 6) are all very significant, and the results of the test are all very significant, and the original hypothesis is overturned (the two are not correlated), namely the high and low lambing rate is obviously correlated with the individual genotype. The population validation results again indicate that the potentially most significant site chr2:8283097 may be a causative mutation that causes a trait difference or an important marker associated with a trait due to linkage disequilibrium with nearby functional genes.

TABLE 5 Chifang test component cases (heterozygous and mutant homozygous)

Grouping	Single lamb	Multi lambs	Total up to	Multiple lambs rate
					Hybrid (+ -)	24	18	42	0.43
Mutant homozygous (- -)	4	48	52	0.92
					Total up to	28	66	94	0.70

TABLE 6 Chifang test grouping (wild homozygous versus mutant homozygous)

Example 3 establishment of method for detecting polymorphism of genetic marker at chr2:8283097

First, amplification site chr2:8283097 fragment

Extracting sheep genome DNA, detecting its concentration and quality, and storing at-20 deg.C. The sequence around the chr2:8283097 site is as follows (SEQ ID No. 7):

GTTTCATGGATATGCTGATTTGCACTGTATTTTAGAGTCTGCGTATAAGCGATCAGTGTAATACTCCCAGAAGAGAATACTGAGCACAGTTCCCTGCGCTGCACAGGAAGCCATTATTAGTTATGTGTACATCTCAAGCCCAATCTCCCAGCGTCTCTCTCCATCCACCCCTTCTCTCTGGGCAGCCATAAGTTTGTTTTCTACATCTGCAACTCTATTTCTGTTTTGAAAATAAGCTCATTTGTACCATTTTTT (or A) AAAAAATATTCCACATGTAAAAGATATCATATTTGTCCTTCATCTGACTTACTTCACTCAGTATGACAATCTCTAGATCCATCCATGTTGCTGAAAATG

The following primer pairs were designed based on the sequence around position chr2:8283097 (Table 7).

TABLE 7 amplification site chr2:8283097 sequence primer pairs

Note: underlined C in the primer pair 2 is a mismatch base which is artificially set, so that if the position of the chr2:8283097 of the sheep to be tested is T, a DraI recognition sequence (TTTAAA) is formed, and if the position is A, the DraI recognition sequence cannot be formed.

Diluting the extracted sheep genome by 50 ng/muL-100 ng/muL, and taking 1 muL as a template. An amplification reaction system and an amplification program: the total volume of the amplification reaction was 50. mu.L, and the amplification was performed using primer set 1, which had the following components: 1 mu L of DNA template, 1 mu L of each 10 mu mol/L primer, 25 mu L of EasyTaqMix (Beijing Quanji Biotech Co., Ltd.), and the volume of the template is filled to 50 mu L with sterilized deionized water; the PCR reaction program is: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 62.8 ℃ for 30s, extension at 72 ℃ for 25s (33 cycles), and final extension at 72 ℃ for 7 min.

The PCR product of the first step was diluted 10-fold, and 1. mu.L was taken as a template. An amplification reaction system and an amplification program: the total volume of the amplification reaction was 50. mu.L, and the amplification was performed using primer set 2, which had the following components: 1 mu L of DNA template, 1 mu L of each 10 mu mol/L primer, 25 mu L of EasyTaqMix (Beijing Quanji Biotech Co., Ltd.), and the volume of the template is filled to 50 mu L with sterilized deionized water; the PCR reaction program is: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 58.2 ℃ for 30s, extension at 72 ℃ for 15s (34 cycles), and final extension at 72 ℃ for 7 min.

Secondly, performing enzyme digestion and electrophoresis detection on DraI

Taking the PCR product in the last step, preparing an enzyme digestion system as follows: amplification product 4. mu.L, Cutsmart 1. mu.L, ddH₂O4.5. mu.L, DraI (NEB, USA) 0.5. mu.L. After water bath at 37 ℃ for 30min, 2 μ L of Loading Buffer was added, electrophoresis analysis was performed by 3% agarose gel, and the results of enzyme digestion typing were observed and recorded in a gel imaging system. DraI does not recognize the site when both chr2:8283097 positions are A and is marked as AA genotype (106bp), DraI recognizes the site when both mutant site bases are T and is marked as TT genotype (76bp +30bp), and when both A and T exist, the site is marked as AT genotype (106bp +76bp +30 bp).

Third, practical application case of genetic marker polymorphism detection method of site chr2:8283097

Amplifying a target fragment containing chr2:8283097 sites by using a primer S1 in example 2, sequencing the target fragment, selecting AA genotype (Hu sheep), AT genotype (Tecke sheep) and TT genotype (Tecke sheep) sheep individual genomes in the target fragment, and performing the first step, the second step and the third step in the example, wherein the result is shown in figure 10, when the site of chr2:8283097 is AA genotype, DraI does not recognize the site, and only a 106bp band exists after enzyme digestion; when the base of the mutation site is TT genotype, DraI identifies the site, and after enzyme digestion, a 76bp and 30bp band is formed; when the base of the mutation site is AT genotype, DraI identifies the site containing T, and bands with the sizes of 106bp, 76bp and 30bp are obtained after enzyme digestion (because the content of nucleic acid is too small, the 30bp band of the AT genotype is weaker, but the typing is not influenced). The final results demonstrate that typing of the genetic marker at position chr2:8283097 can be accomplished by cleavage with DraI of the target product obtained by amplification using primer pair 2 and primer pair 3.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> university of agriculture in China

<120> SNP genetic marker related to sheep lambing number and application thereof

<130> GNCLN211204

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence

<400> 1

tgtatagact agtttgcctc tgc 23

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

gtttagttgc taattcatgt ccg 23

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

gtctgcgtat aagcgatcag t 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

cagcaacatg gatggatcta g 21

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence

<400> 5

ttgaaaataa gctcatttgt accattctt 29

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<400> 6

ctagagattg tcatactgag tgaag 25

<210> 7

<211> 354

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (255)..(255)

<223> w is t or a

<400> 7

gtttcatgga tatgctgatt tgcactgtat tttagagtct gcgtataagc gatcagtgta 60

atactcccag aagagaatac tgagcacagt tccctgcgct gcacaggaag ccattattag 120

ttatgtgtac atctcaagcc caatctccca gcgtctctct ccatccaccc cttctctctg 180

ggcagccata agtttgtttt ctacatctgc aactctattt ctgttttgaa aataagctca 240

tttgtaccat ttttwaaaaa atattccaca tgtaaaagat atcatatttg tccttcatct 300

gacttacttc actcagtatg acaatctcta gatccatcca tgttgctgaa aatg 354

Claims

1. Use of a substance for detecting whether a deoxyribonucleotide at position 8283097 on chromosome 2 in a sheep genome is A, T or A and T in any one of the following:

(A1) identifying or assisting in identifying the lamb number characters;

2. Use according to claim 1, characterized in that: the substance for detecting whether the 8283097 th deoxyribonucleotide on chromosome 2 in the sheep genome is A, T or A and T is a primer pair or a complete set of primer pairs or a reagent or a kit containing the primer pair or the complete set of primer pairs;

the primer pair consists of an upstream primer and a downstream primer; the upstream primer is designed according to the upstream sequence of 8283097 th deoxyribonucleotide on chromosome 2 in the sheep genome; the downstream primer is designed according to the downstream sequence of the 8283097 th deoxyribonucleotide on the No.2 chromosome in the sheep genome.

3. Use according to claim 2, characterized in that: the primer pair is a primer pair A; the primer pair A consists of an upstream primer shown by SEQ ID No.1 and a downstream primer shown by SEQ ID No. 2; or

The complete set of primer pair consists of a primer pair B and a primer pair C; the primer pair B consists of an upstream primer shown by SEQ ID No.3 and a downstream primer shown by SEQ ID No. 4; the primer pair C consists of an upstream primer shown by SEQ ID No.5 and a downstream primer shown by SEQ ID No. 6.

4. Use according to claim 3, characterized in that: the kit contains the primer set and also contains restriction enzyme DraI.

5. Any one of the following methods:

the method I comprises the following steps: a method for identifying or assisting in identifying whether the number of lambs born by a sheep to be tested is multiple lambs or single lambs comprises the following steps:

(B2) determining whether the number of lambs born by the sheep to be tested is multiple lambs or single lambs according to the following steps: if the genotype of the sheep to be detected is A: A, the lambing number of the sheep to be detected is equal to or candidate for multiple lambs; if the genotype of the sheep to be detected is T type or A T type, the lamb number of the sheep to be detected is or is selected as single lamb;

method II: a method for identifying or assisting in identifying the number of lambs born by a sheep to be tested can comprise the following steps:

6. The method of claim 5, wherein: in the steps (B1) and (C1), whether the deoxyribonucleotide at position 8283097 on chromosome 2 in the genome of the sheep to be tested is A, T or A and T is detected according to a method comprising any one of the following steps:

p1, taking the genomic DNA of the sheep to be detected as a template, and carrying out nested PCR amplification by using the primer set pair in claim 3 to obtain an amplification product; then, the amplification product is cut by restriction enzyme DraI, and whether the 8283097 th deoxyribonucleotide on chromosome 2 in the genome of the sheep to be tested is A, T or A and T is determined according to the cutting result as follows: if the enzyme digestion product contains 106bp target bands and does not contain 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A; if the enzyme digestion product contains a 106bp target band and 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is A and T; if the enzyme digestion product does not contain 106bp target bands but contains 76bp and 30bp target bands, the 8283097 th deoxyribonucleotide on the No.2 chromosome in the genome of the sheep to be detected is T;

p2, using the genomic DNA of the sheep to be detected as a template, and carrying out PCR amplification by using the primer pair in claim 2 or 3 to obtain an amplification product; and sequencing the amplification product, and determining whether the 8283097 th deoxyribonucleotide on the chromosome 2 in the genome of the sheep to be tested is A, T or A and T according to the sequencing result.

7. A substance having a function represented by the following (A) or (B) or (C), which is the substance for detecting whether a deoxyribonucleotide at position 8283097 on chromosome 2 in the genome of a sheep is A or T or A and T according to any one of claims 1 to 4;

(A) identifying or assisting in identifying the lamb number characters;

8. Any of the following applications:

(D1) use of a substance according to claim 7 for identifying or aiding in identifying a sheep lambing number trait, or in the manufacture of a product for identifying or aiding in identifying a sheep lambing number trait;

(D2) use of a substance according to claim 7 in, or in the manufacture of a product for, identifying or assisting in identifying a number of lambs in a sheep or a single lamb;

(D3) use of a substance according to claim 7 for identifying or aiding in identifying the number of lambs born in a sheep, or for the manufacture of a product for identifying or aiding in identifying the number of lambs born in a sheep;

(D4) use of the method of claim 5 or 6 or the agent of claim 7 in sheep breeding.

9. The use or method or substance of any of claims 1-8, wherein: the sheep to be tested is selected from: dongfuill sheep, small tailed Han sheep, Hu sheep, Texel sheep or Black Safok sheep.

10. The use or method or substance of any one of claims 1-9, wherein: the lambing rate is more than or equal to 180 percent; and/or said single lambs means that the lambing rate is less than or equal to 100%.