CN113046439A - miRNA marker for detecting female breast cancer and application thereof - Google Patents
miRNA marker for detecting female breast cancer and application thereof Download PDFInfo
- Publication number
- CN113046439A CN113046439A CN202110382857.4A CN202110382857A CN113046439A CN 113046439 A CN113046439 A CN 113046439A CN 202110382857 A CN202110382857 A CN 202110382857A CN 113046439 A CN113046439 A CN 113046439A
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- mirna
- seq
- female breast
- mirna marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention relates to the technical field of markers for detecting female breast cancer, in particular to a miRNA marker for detecting female breast cancer and application thereof. The marker is miR-98-3p, and the sequence of the marker is SEQ ID NO. 1: CUAUACAACUUACUACUUUCCC are provided. Taking serum or/and plasma of a patient as a sample, measuring the concentration of the miRNA marker in the sample, and judging whether the concentration is 103And more than pmol/L, determining whether the breast cancer is suffered. The marker of the invention has better accuracy.
Description
Technical Field
The invention relates to the technical field of markers for detecting female breast cancer, in particular to a miRNA marker for detecting female breast cancer and application thereof.
Background
Breast cancer is one of the most common malignancies in women and is also the leading cause of cancer-related death in women. Data reported in Globocan 2018: in women worldwide, the incidence of breast cancer is as high as 24.2%, and the mortality rate is 15% of the first causes of cancer death in women. In China, the incidence rate of breast cancer is also on the rising trend year by year. The current cancer data of residents in China issued by professor Chenwangqing of the national cancer center shows that the 5-year expected incidence of breast cancer of women in China reaches 156/10 ten thousands of people; meanwhile, epidemiological research shows that the proportion of breast cancer patients in young women in China is remarkably higher than that in the west, the peak and the foot of the disease is 10 years earlier than that in the west, and the disease is clearly contrasted with that of the patients in European and American countries above 2/3 after menopause. Age ≤ 40 years is defined as a category of young breast cancer in the guideline, young patients usually have high lymph node metastasis rate, high histological grade, high clinical stage, high triple negative proportion, and "four high and one large" characteristics of large mass, and relatively poor prognosis; the result may be related to the lack of attention to breast examination in young women, and also related to the lack of simple, convenient and effective means for detecting breast cancer in young women in the current medical field.
Mammography is a commonly-developed means of breast cancer screening in the European and American countries, which reduces the risk of breast cancer death by 16-20%. However, the female in China is of a light age, small and compact breast, so that the sensitivity and specificity of the female to X-ray photography are low, and ultrasonic examination becomes one of the main means for female screening in China based on the condition. However, the existing research data show that 91.4% of breast cancers discovered by ultrasound are invasive cancers, and 30.5% of breast cancers discovered by X-ray radiography are in situ cancers, that is, most of breast cancers diagnosed by ultrasound are in situ cancers only showing calcification, which means that although the detection rate of breast cancers by breast ultrasound is equivalent to that of breast cancers by X-ray radiography, the efficiency of ultrasound screening for discovering early-stage breast cancers is poor. Currently, breast cancer is diagnosed primarily by pathological examination, but such invasive tests are not suitable for large-scale clinical screening.
In recent years, researches show that different components in a blood sample can be used as biomarkers for early diagnosis, prognosis prediction and screening of malignant tumors, and the application prospect is wide. While miRNAs are used as a biomarker in peripheral circulation blood and are also a research hotspot for cancer body fluid biopsy, unique serum miRNAs are helpful for early discovery and diagnosis of malignant tumors, and some screening products are in a scientific validation stage, and some screening products even enter a clinical validation stage.
miRNAs are a class of small, non-coding RNAs of about 18-25 bases in length that can be involved in regulating gene expression by binding to the 5 'or 3' UTR region of the target gene. The way in which it regulates gene expression is mainly through degradation of mRNA or inhibition of protein translation processes, and plays an important role in many biological functions. In breast cancer tissues, miRNAs may act as both oncogenes and tumor suppressors, and circulating miRNAs may be associated with disease progression, therapeutic response and patient survival, suggesting that miRNAs levels in serum or plasma may act as non-invasive blood biomarkers. The widely accepted model of breast cancer development suggests that the process is generally that of hyperplasia of the breast from simple epithelial cell hyperproliferation leading to hyperplasia of the breast to Ductal Carcinoma In Situ (DCIS) to invasive ductal carcinoma, in which miRNAs play an important role; the up-regulation of miR-21 is reported to play an important role in the occurrence and development processes of breast tumors. Furthermore, the differential miRNA profile, in addition to being able to distinguish between normal and cancerous tissues, can also successfully classify different subtypes of a particular cancer, particularly breast cancer. And the miRNA spectrum is used for predicting the drug resistance of breast cancer chemotherapy, targeted therapy and endocrine therapy and has promising application prospect. The research of Mitsuhashi and the like in 2017 shows that three miRNAs (miR-183-5p, miR-194-5p and miR-1285-5p) can be used as accurate biomarkers for prognosis of breast cancer patients independently or in combination, and have good reference significance. In the breast cancer patients, the young breast cancer is more invasive, the molecular typing mainly comprises triple negative and her-2 overexpression, and the drug resistance phenomenon easily occurs in the treatment process.
At present, no relevant miR-98-3p is reported in the breast cancer-related literature.
Disclosure of Invention
Technical problem to be solved
In view of the above disadvantages and shortcomings of the prior art, the present invention provides a novel miRNA marker miR-98-3p for detecting female breast cancer, which has a high accuracy.
(II) technical scheme
In order to achieve the purpose, the invention adopts the main technical scheme that:
in a first aspect, the embodiment of the present invention provides a miRNA marker for detecting female breast cancer, which is miR-98-3p, and the sequence of the miRNA marker is SEQ ID No. 1: CUAUACAACUUACUACUUUCCC are provided.
In a second aspect, the present invention provides a reverse transcription primer for the miRNA marker, whose sequence is SEQ ID No. 2: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGG GAAA are provided.
In a third aspect, the embodiment of the present invention provides a method for detecting female breast cancer by using the miRNA marker, including the following steps: taking serum or/and plasma of a patient as a sample, measuring the concentration of the miRNA marker in the sample, and judging whether the concentration is 103And pmol/L or more.
Optionally, the serum or/and plasma is isolated from peripheral blood.
Optionally, determining the concentration of the miRNA marker in the sample by means of PCR; in the PCR method, miRNA is used as a template for carrying out reverse transcription reaction;
the forward primer is SEQ ID NO.3: CGCGGCCTATACAACTTACTACTTTCC;
the reverse primer is SEQ ID NO.4: CCAGTGCAGGGTCCGAGGTA.
In a fourth aspect, the embodiment of the present invention provides an application of the miRNA marker in preparing a kit for detecting female breast cancer.
Optionally, the kit comprises a reverse transcription primer SEQ ID NO.2, a forward primer SEQ ID NO.3, a reverse primer SEQ ID NO.4, a reverse transcriptase, a buffer, dNTP, a DNA polymerase and a probe.
(III) advantageous effects
The invention has the beneficial effects that:
the miRNA marker for detecting female breast cancer provided by the invention is miR-98-3p, is used as a new biomarker for female breast cancer, and can have high accuracy for diagnosing female breast cancer.
The miRNA marker miR-98-3p can be accurately detected through the PCR detection kit, and can realize the in-vitro rapid detection of a patient, so that the female breast cancer can be diagnosed.
Drawings
FIG. 1 is a standard graph of PCR reaction of miRNA;
FIG. 2 is a graph showing the results obtained by the method of example 1 in a breast cancer patient and a healthy patient.
Detailed Description
For the purpose of better explaining the present invention and to facilitate understanding, the present invention will be described in detail by way of specific embodiments with reference to the accompanying drawings.
The miRNA marker miR-98-3p for detecting female breast cancer provided by the embodiment of the invention has a sequence of SEQ ID NO. 1: CUAUACAACUUACUACUUUCCC are provided.
The female breast cancer can be Luminal A type, Luminal B type, HER2 Rich or Triple Negative type.
Wherein, the female breast cancer can be in clinical disease stage 0, I, II, III or IV.
The invention provides a reverse transcription primer specially used for the miRNA marker, the sequence of which is SEQ ID NO. 2:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAA。
which can be
The embodiment of the invention provides a method for detecting female breast cancer by using the miRNA marker, which comprises the following steps: taking serum or/and plasma of a patient as a sample, measuring the concentration of the miRNA marker in the sample, and judging whether the concentration is 103And pmol/L or more.
Wherein the serum or/and plasma is isolated from peripheral blood; which has a higher accuracy.
Wherein the concentration of the miRNA marker in the sample is determined by a PCR method; in the PCR method, miRNA is used as a template for carrying out reverse transcription reaction;
the reverse transcription primer is SEQ ID NO. 2:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAA；
the forward primer is SEQ ID NO.3:
CGCGGCCTATACAACTTACTACTTTCC；
the reverse primer is SEQ ID NO.4: CCAGTGCAGGGTCCGAGGTA are provided.
Wherein, a reverse transcription reaction is carried out by using the synthesized miR-98-3p, a standard curve of the miR-98-3p is made, and the level of the miRNA marker in a sample from a subject is detected, wherein if the concentration of the marker exceeds 103pmol/L, indicating that the subject has breast cancer.
The embodiment of the invention provides application of the miRNA marker in preparation of a kit for detecting female breast cancer.
The kit comprises a reverse transcription primer SEQ ID NO.2, a forward primer SEQ ID NO.3, a reverse primer SEQ ID NO.4, reverse transcriptase, a buffer solution, dNTP, DNA polymerase and a probe.
Wherein the probe is SYBR green.
In order to better understand the above technical solutions, exemplary embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. While exemplary embodiments of the invention are shown in the drawings, it should be understood that the invention can be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Example 1
The kit comprises a reverse transcription primer SEQ ID NO. 2: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAA,
The forward primer is SEQ ID NO.3: GCGGCCTATACAACTTACTACTTTCC,
The reverse primer is SEQ ID NO.4: CCAGTGCAGGGTCCGAGGTA,
Reverse transcriptase, buffer, dNTPs, DNA polymerase and probe.
The method for detecting by using the kit of the embodiment comprises the following specific steps:
extraction of miRNA from S1 serum sample: separating serum from peripheral blood of a patient, adding equal volume of TRIZOL into 300ul of serum, violently shaking for 10s, mixing, and standing at 4 deg.C for 5 min; adding 100ul chloroform, shaking vigorously for 15s, and standing at 4 deg.C for 5 min; centrifuging at 14000g for 15min at 4 ℃, and sucking the upper aqueous phase into a new EP tube; adding 300ul isopropanol, reversing up and down, mixing, and standing at 4 deg.C for 10 min; centrifuging at 12000g for 10min at 4 ℃; removing the supernatant, adding 1ml of 75% ethanol to clean RNA precipitate; centrifuging at 8500g for 5min at 4 ℃; discarding the supernatant, leaving the RNA precipitate at the bottom of the tube, drying, adding 10ul DEPC water to dissolve, and storing in a refrigerator at-80 ℃;
reverse transcription of S2 miRNA and fluorescent quantitative PCR: carrying out reverse transcription reaction by taking miRNA as a template, and configuring a reverse transcription reaction system according to the following proportion:
10X Reaction buffer 1.50ul, reverse transcription primer 3.00ul, reverse transcriptase 1.00ul, 100mM dNTPs 0.50ul, miRNA to be detected 1.00ul, sterile double distilled water 3.00 ul; centrifuging the prepared system for a short time to perform reverse transcription reaction; after the reverse transcription is finished, the fluorescent quantitative PCR detection is carried out according to SYBR green master mix instructions. The reverse transcription primer sequences were prepared as follows:
SEQ ID NO.2：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAA、
the forward primers used in PCR were:
SEQIDNO.3：CGCGGCCTATACAACTTACTACTTTCC；
the reverse primers used in the PCR were as follows:
SEQ ID NO.4：CCAGTGCAGGGTCCGAGGTA；
the reverse transcription reaction conditions were as follows:
16 ℃/30 minutes;
42 ℃/30 minutes;
85 ℃/5 minutes;
4℃/∞；
the fluorescent quantitative PCR reaction conditions are as follows:
50 ℃/2 minutes;
95 ℃/10 minutes;
(95 ℃/15 sec → 60 ℃/1 min, fluorescence detection) x 40 cycles
Preparation of a standard curve of S3: and (3) diluting the synthesized cDNA of the miR-98-3p to the following concentration: 10pmol/L, 100pmol/L, 103pmol/L、104pmol/L、105pmol/L. And (3) performing the fluorescent quantitative PCR reaction conditions of the step S2 on each concentration by taking sterile double distilled water as a blank control, wherein the reaction conditions are as follows:
50 ℃ for 2 minutes
95 ℃/10 minutes
(95 ℃/15 sec → 60 ℃/1 min, fluorescence detection) x 40 cycles
A standard curve was prepared by using the logarithmic value of the cDNA concentration log10 as the abscissa and the Ct value detected by Q-PCR as the ordinate.
The standard curve shown in fig. 1 was obtained by this example.
S4 determining the miRNA marker level in the sample from the subject according to the method of step S3 from the serum obtained in step S1, wherein the marker is detected at a concentration of more than 103pmol/L, indicating that the subject has breast cancer.
To confirm the effectiveness of the miRNA markers the following assays were performed:
80 breast cancer patients and 88 healthy people were selected to test the expression level of miR-98-3p in serum according to the method of example 1, and the results are shown in FIG. 2: the expression level of miR-98-3p in the serum of 80 breast cancer patients is higher than 103pmol/L, the average value is 1245pmol/L, and the expression quantity of miR-98-3p in the serum of 88 normal persons is less than 103pmol/L, average 552 pmol/. Thus, can be 103And the mol/L is used as a judgment basis for judging whether the breast cancer patient is the breast cancer patient.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
Claims (7)
1. A miRNA marker for detecting female breast cancer, comprising: it is miR-98-3p, and the sequence thereof is SEQ ID NO. 1: CUAUACAACUUACUACUUUCCC are provided.
2. A reverse transcription primer for the miRNA marker of claim 1, having the sequence of SEQ ID No. 2:
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAA。
3. a method for detecting female breast cancer by using the miRNA marker of claim 1, comprising the steps of: taking serum or/and plasma of a patient as a sample, measuring the concentration of the miRNA marker in the sample, and judging whether the concentration is 103And pmol/L or more.
4. The method for detecting female breast cancer by using miRNA markers of claim 3, wherein: the serum or/and plasma is isolated from peripheral blood.
5. The method for detecting female breast cancer by using miRNA markers of claim 3, wherein: determining the concentration of the miRNA marker in the sample by a PCR method; in the PCR method, miRNA is used as a template for carrying out reverse transcription reaction;
the forward primer is SEQ ID NO.3: CGCGGCCTATACAACTTACTACTTTCC;
the reverse primer is SEQ ID NO.4: CCAGTGCAGGGTCCGAGGTA.
6. Use of the miRNA marker of claim 1 for the preparation of a kit for the detection of female breast cancer.
7. Use of a miRNA marker according to claim 6 for the preparation of a kit for the detection of female breast cancer, wherein: the kit comprises a reverse transcription primer SEQ ID NO.2, a forward primer SEQ ID NO.3, a reverse primer SEQ ID NO.4, reverse transcriptase, a buffer solution, dNTP, DNA polymerase and a probe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110382857.4A CN113046439A (en) | 2021-04-09 | 2021-04-09 | miRNA marker for detecting female breast cancer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110382857.4A CN113046439A (en) | 2021-04-09 | 2021-04-09 | miRNA marker for detecting female breast cancer and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113046439A true CN113046439A (en) | 2021-06-29 |
Family
ID=76519375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110382857.4A Withdrawn CN113046439A (en) | 2021-04-09 | 2021-04-09 | miRNA marker for detecting female breast cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113046439A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116355899A (en) * | 2022-10-27 | 2023-06-30 | 福建医科大学附属第一医院 | Female breast cancer marker, detection method thereof and detection probe primer |
-
2021
- 2021-04-09 CN CN202110382857.4A patent/CN113046439A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116355899A (en) * | 2022-10-27 | 2023-06-30 | 福建医科大学附属第一医院 | Female breast cancer marker, detection method thereof and detection probe primer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Elshimy et al. | MiR-133a and MiR-155 as potential minimally invasive biomarkers in breast cancer | |
| CN106148529B (en) | LncRNA marker related to gastric cancer, special detection primer, detection method, kit and application thereof | |
| CN108624688B (en) | Application of hsa _ circ _0012755 as prostate cancer molecular target in preparation of medicines and kits | |
| Lu et al. | Combined detection of plasma miR-127-3p and HE4 improves the diagnostic efficacy of breast cancer | |
| Peña-Cano et al. | Deregulated microRNAs and adiponectin in postmenopausal women with breast cancer | |
| CN108531586B (en) | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof | |
| CN109897855A (en) | A kind of serum miRNA marker and its application in the cancer of pancreas early diagnosis that pancreatitis mediates | |
| WO2018219264A1 (en) | Use of long-chain non-coding rna as prostatic cancer molecule marker | |
| Yin et al. | Peripheral blood circulating microRNA‐4636/− 143 for the prognosis of cervical cancer | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN113337613B (en) | Serum exosome tsRNA marker related to liver cancer, probe and application thereof | |
| CN113046439A (en) | miRNA marker for detecting female breast cancer and application thereof | |
| CN110699459A (en) | Application of microRNA in exosome in breast cancer clinical evaluation | |
| Jiang et al. | Changes in the expression of serum MiR-887-5p in patients with endometrial cancer | |
| Zhang et al. | High expression of microRNA-200a/b indicates potential diagnostic and prognostic biomarkers in epithelial ovarian cancer | |
| CN107858424B (en) | Application of miRNA-4731-3p as primary lung cancer diagnosis marker | |
| CN108753981A (en) | Application of the quantitative detection of HOXB8 genes in colorectal cancer Index for diagnosis | |
| CN114058697B (en) | Application of reagent for detecting exosome miR-6774-3p or miR-6776-5p | |
| CN111575374B (en) | Molecular marker for early pancreatic tumor detection, detection method and application thereof | |
| CN111334577A (en) | Laryngeal squamous carcinoma molecular marker hsa _ circ _0004547, detection method and application | |
| CN107858425A (en) | Applications and detection method of the miRNA 4741 as primary hepatic carcinoma diagnosis mark | |
| CN114058698B (en) | Application of reagent for detecting exosome miR-6879-5p in preparation of thyroid cancer metastasis detection kit | |
| El-Sayed Shiha et al. | MicroRNA 122 as adiagnostic biomarker for hepatitis C-related hepatocellular carcinoma | |
| CN115948546B (en) | Exosome miRNA biomarker for breast cancer and application thereof | |
| CN104774916B (en) | Biomarker combination used for detection of chemotherapy curative effect and/or prognosis of metastatic colorectal cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20210629 |